Search Results

Search found 17487 results on 700 pages for 'static members'.

Page 533/700 | < Previous Page | 529 530 531 532 533 534 535 536 537 538 539 540  | Next Page >

  • Invalid cast exception

    - by user127147
    I have a simple application to store address details and edit them. I have been away from VB for a few years now and need to refreash my knowledge while working to a tight deadline. I have a general Sub responsible for displaying a form where user can add contact details (by pressing button add) and edit them (by pressing button edit). This sub is stored in a class Contact. The way it is supposed to work is that there is a list with all the contacts and when new contact is added a new entry is displayed. If user wants to edit given entry he or she selects it and presses edit button Public Sub Display() Dim C As New Contact C.Cont = InputBox("Enter a title for this contact.") C.Fname = frmAddCont.txtFName.Text C.Surname = frmAddCont.txtSName.Text C.Address = frmAddCont.txtAddress.Text frmStart.lstContact.Items.Add(C.Cont.ToString) End Sub I call it from the form responsible for adding new contacts by Dim C As New Contact C.Display() and it works just fine. However when I try to do something similar using the edit button I get errors - "Unable to cast object of type 'System.String' to type 'AddressBook.Contact'." Dim C As Contact If lstContact.SelectedItem IsNot Nothing Then C = lstContact.SelectedItem() C.Display() End If I think it may be something simple however I wasn't able to fix it and given short time I have I decided to ask for help here. I have updated my class with advice from other members and here is the final version (there are some problems however). When I click on the edit button it displays only the input box for the title of the contact and actually adds another entry in the list with previous data for first name, second name etc. Public Class Contact Public Contact As String Public Fname As String Public Surname As String Public Address As String Private myCont As String Public Property Cont() Get Return myCont End Get Set(ByVal value) myCont = Value End Set End Property Public Overrides Function ToString() As String Return Me.Cont End Function Sub NewContact() FName = frmAddCont.txtFName.ToString frmStart.lstContact.Items.Add(FName) frmAddCont.Hide() End Sub Public Sub Display() Dim C As New Contact C.Cont = InputBox("Enter a title for this contact.") C.Fname = frmAddCont.txtFName.Text C.Surname = frmAddCont.txtSName.Text C.Address = frmAddCont.txtAddress.Text 'frmStart.lstContact.Items.Add(C.Cont.ToString) frmStart.lstContact.Items.Add(C) End Sub End Class

    Read the article

  • Go - Using a container/heap to implement a priority queue

    - by Seth Hoenig
    In the big picture, I'm trying to implement Dijkstra's algorithm using a priority queue. According to members of golang-nuts, the idiomatic way to do this in Go is to use the heap interface with a custom underlying data structure. So I have created Node.go and PQueue.go like so: //Node.go package pqueue type Node struct { row int col int myVal int sumVal int } func (n *Node) Init(r, c, mv, sv int) { n.row = r n.col = c n.myVal = mv n.sumVal = sv } func (n *Node) Equals(o *Node) bool { return n.row == o.row && n.col == o.col } And PQueue.go: // PQueue.go package pqueue import "container/vector" import "container/heap" type PQueue struct { data vector.Vector size int } func (pq *PQueue) Init() { heap.Init(pq) } func (pq *PQueue) IsEmpty() bool { return pq.size == 0 } func (pq *PQueue) Push(i interface{}) { heap.Push(pq, i) pq.size++ } func (pq *PQueue) Pop() interface{} { pq.size-- return heap.Pop(pq) } func (pq *PQueue) Len() int { return pq.size } func (pq *PQueue) Less(i, j int) bool { I := pq.data.At(i).(Node) J := pq.data.At(j).(Node) return (I.sumVal + I.myVal) < (J.sumVal + J.myVal) } func (pq *PQueue) Swap(i, j int) { temp := pq.data.At(i).(Node) pq.data.Set(i, pq.data.At(j).(Node)) pq.data.Set(j, temp) } And main.go: (the action is in SolveMatrix) // Euler 81 package main import "fmt" import "io/ioutil" import "strings" import "strconv" import "./pqueue" const MATSIZE = 5 const MATNAME = "matrix_small.txt" func main() { var matrix [MATSIZE][MATSIZE]int contents, err := ioutil.ReadFile(MATNAME) if err != nil { panic("FILE IO ERROR!") } inFileStr := string(contents) byrows := strings.Split(inFileStr, "\n", -1) for row := 0; row < MATSIZE; row++ { byrows[row] = (byrows[row])[0 : len(byrows[row])-1] bycols := strings.Split(byrows[row], ",", -1) for col := 0; col < MATSIZE; col++ { matrix[row][col], _ = strconv.Atoi(bycols[col]) } } PrintMatrix(matrix) sum, len := SolveMatrix(matrix) fmt.Printf("len: %d, sum: %d\n", len, sum) } func PrintMatrix(mat [MATSIZE][MATSIZE]int) { for r := 0; r < MATSIZE; r++ { for c := 0; c < MATSIZE; c++ { fmt.Printf("%d ", mat[r][c]) } fmt.Print("\n") } } func SolveMatrix(mat [MATSIZE][MATSIZE]int) (int, int) { var PQ pqueue.PQueue var firstNode pqueue.Node var endNode pqueue.Node msm1 := MATSIZE - 1 firstNode.Init(0, 0, mat[0][0], 0) endNode.Init(msm1, msm1, mat[msm1][msm1], 0) if PQ.IsEmpty() { // make compiler stfu about unused variable fmt.Print("empty") } PQ.Push(firstNode) // problem return 0, 0 } The problem is, upon compiling i get the error message: [~/Code/Euler/81] $ make 6g -o pqueue.6 Node.go PQueue.go 6g main.go main.go:58: implicit assignment of unexported field 'row' of pqueue.Node in function argument make: *** [all] Error 1 And commenting out the line PQ.Push(firstNode) does satisfy the compiler. But I don't understand why I'm getting the error message in the first place. Push doesn't modify the argument in any way.

    Read the article

  • On Redirect - Failed to generate a user instance of SQL Server...

    - by Craig Russell
    Hello (this is a long post sorry), I am writing a application in ASP.NET MVC 2 and I have reached a point where I am receiving this error when I connect remotely to my Server. Failed to generate a user instance of SQL Server due to failure in retrieving the user's local application data path. Please make sure the user has a local user profile on the computer. The connection will be closed. I thought I had worked around this problem locally, as I was getting this error in debug when site was redirected to a baseUrl if a subdomain was invalid using this code: protected override void Initialize(RequestContext requestContext) { string[] host = requestContext.HttpContext.Request.Headers["Host"].Split(':'); _siteProvider.Initialise(host, LiveMeet.Properties.Settings.Default["baseUrl"].ToString()); base.Initialize(requestContext); } protected override void OnActionExecuting(ActionExecutingContext filterContext) { if (Site == null) { string[] host = filterContext.HttpContext.Request.Headers["Host"].Split(':'); string newUrl; if (host.Length == 2) newUrl = "http://sample.local:" + host[1]; else newUrl = "http://sample.local"; Response.Redirect(newUrl, true); } ViewData["Site"] = Site; base.OnActionExecuting(filterContext); } public Site Site { get { return _siteProvider.GetCurrentSite(); } } The Site object is returned from a Provider named siteProvider, this does two checks, once against a database containing a list of all available subdomains, then if that fails to find a valid subdomain, or valid domain name, searches a memory cache of reserved domains, if that doesn't hit then returns a baseUrl where all invalid domains are redirected. locally this worked when I added the true to Response.Redirect, assuming a halting of the current execution and restarting the execution on the browser redirect. What I have found in the stack trace is that the error is thrown on the second attempt to access the database. #region ISiteProvider Members public void Initialise(string[] host, string basehost) { if (host[0].Contains(basehost)) host = host[0].Split('.'); Site getSite = GetSites().WithDomain(host[0]); if (getSite == null) { sites.TryGetValue(host[0], out getSite); } _site = getSite; } public Site GetCurrentSite() { return _site; } public IQueryable<Site> GetSites() { return from p in _repository.groupDomains select new Site { Host = p.domainName, GroupGuid = (Guid)p.groupGuid, IsSubDomain = p.isSubdomain }; } #endregion The Linq query ^^^ is hit first, with a filter of WithDomain, the error isn't thrown till the WithDomain filter is attempted. In summary: The error is hit after the page is redirected, so the first iteration is executing as expected (so permissions on the database are correct, user profiles etc) shortly after the redirect when it filters the database query for the possible domain/subdomain of current redirected page, it errors out.

    Read the article

  • .Net Entity Framework SaveChanges is adding without add method

    - by tmfkmoney
    I'm new to the entity framework and I'm really confused about how savechanges works. There's probably a lot of code in my example which could be improved, but here's the problem I'm having. The user enters a bunch of picks. I make sure the user hasn't already entered those picks. Then I add the picks to the database. var db = new myModel() var predictionArray = ticker.Substring(1).Split(','); // Get rid of the initial comma. var user = Membership.GetUser(); var userId = Convert.ToInt32(user.ProviderUserKey); // Get the member with all his predictions for today. var memberQuery = (from member in db.Members where member.user_id == userId select new { member, predictions = from p in member.Predictions where p.start_date == null select p }).First(); // Load all the company ids. foreach (var prediction in memberQuery.predictions) { prediction.CompanyReference.Load(); } var picks = from prediction in predictionArray let data = prediction.Split(':') let companyTicker = data[0] where !(from i in memberQuery.predictions select i.Company.ticker).Contains(companyTicker) select new Prediction { Member = memberQuery.member, Company = db.Companies.Where(c => c.ticker == companyTicker).First(), is_up = data[1] == "up", // This turns up and down into true and false. }; // Save the records to the database. // HERE'S THE PART I DON'T UNDERSTAND. // This saves the records, even though I don't have db.AddToPredictions(pick) foreach (var pick in picks) { db.SaveChanges(); } // This does not save records when the db.SaveChanges outside of a loop of picks. db.SaveChanges(); foreach (var pick in picks) { } // This saves records, but it will insert all the picks exactly once no matter how many picks you have. //The fact you're skipping a pick makes no difference in what gets inserted. var counter = 1; foreach (var pick in picks) { if (counter == 2) { db.SaveChanges(); } counter++; } There's obviously something going on with the context I don't understand. I'm guessing I've somehow loaded my new picks as pending changes, but even if that's true I don't understand I have to loop over them to save changes. Can someone explain this to me?

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • passing data from a client form via jquery ajax dinamicly

    - by quantum62
    i wanna insert specification of members that enter in textboxs of form in the database .i do this operation with jquery ajax when i call webmetod with static value the operation do successfully.for example this code is ok. $.ajax({ type: "POST", url:"MethodInvokeWithJQuery.aspx/executeinsert", data: '{ "username": "user1", "name":"john","family":"michael","password":"123456","email": "[email protected]", "tel": "123456", "codemeli": "123" }', contentType: "application/json; charset=utf-8", dataType: "json", async: true, cache: false, success: function (msg) { $('#myDiv2').text(msg.d); }, error: function (x, e) { alert("The call to the server side failed. " + x.responseText); } } ); but when i wanna use of values that enter in textboxes dynamically error occur.whats problem?i try this two code <script type="text/javascript"> $(document).ready( function () { $("#Button1").click( function () { var username, family, name, email, tel, codemeli, password; username = $('#<%=TextBox1.ClientID%>').val(); name = $('#<%=TextBox2.ClientID%>').val(); family = $('#<%=TextBox3.ClientID%>').val(); password = $('#<%=TextBox4.ClientID%>').val(); email = $('#<%=TextBox5.ClientID%>').val(); tel = $('#<%=TextBox6.ClientID%>').val(); codemeli = $('#<%=TextBox7.ClientID%>').val(); $.ajax( { type: "POST", url: "WebApplication20.aspx/executeinsert", data: "{'username':'username','name':name, 'family':family,'password':password, 'email':email,'tel':tel, 'codemeli':codemeli}", contentType: "application/json;charset=utf-8", dataType: "json", async: true, cache: false, success: function(msg) { alert(msg); }, error: function (x, e) { alert("The call to the server side failed. " + x.responseText); } } ); } ) }) </script> or $(document).ready( function () { $("#Button1").click( function () { var username, family, name, email, tel, codemeli, password; username = $('#<%=TextBox1.ClientID%>').val(); name = $('#<%=TextBox2.ClientID%>').val(); family = $('#<%=TextBox3.ClientID%>').val(); password = $('#<%=TextBox4.ClientID%>').val(); email = $('#<%=TextBox5.ClientID%>').val(); tel = $('#<%=TextBox6.ClientID%>').val(); codemeli = $('#<%=TextBox7.ClientID%>').val(); $.ajax( { type: "POST", url: "WebApplication20.aspx/executeinsert", data: '{"username" : '+username+', "name": '+name+', "family": '+family+', "password": '+password+', "email": '+email+', "tel": '+tel+' , "codemeli": '+codemeli+'}', contentType: "application/json;charset=utf-8", dataType: "json", async: true, cache: false, success: function(msg) { alert(msg); }, error: function (x, e) { alert("The call to the server side failed. " + x.responseText); } } ); } ) })

    Read the article

  • Working with friends. Poor career choice?

    - by a_person
    Hi all, Hope you can help me solve somewhat of a moral dilemma. Some time ago, after just a few years of living in U.S. and having to take any job I could get my hands on a friend of mine submitted recommended me for an open position at the company that he was working for. I could have not been happier. I do not have a degree of any sort, however, by being passionate about CS and with constant drive for self education I've became a somewhat of a strong generalist. Every place I worked for recognized me for that quality and used me on various projects where set of technology in hand had no overlap with set of knowledge of the team members. Rapidly I've advanced to Sr. Programmer position and the trend of me following a friend from one place to another have started and continued on for a few years. My friend's goal always been to become an IT Director, mine is to become the best programmer I can be. To my knowledge I've accommodated his goals as much as I could by taking a back seat, and letting him take the lead. Fast forward to today. He's a manager, and I am on his team. I am unhappy and I in considerable amount of suffering. I am not being utilized to my potential, it's almost exact opposite, I am being micromanaged to an unhealthy extent, my decisions, and suggestions are constantly met with negative connotation. Last week I had to hear about how my friend is a better programmer than I am. My ego was ecstatic about this one /s. In addition to that working in the field of BI have exhausted itself for most parts. The only pleasure of my work is being derived from making everything as dynamic and parameter driven as possible. This is the only area where a friend of mine does not feel competent enough to actually micromanage. Because of my situation I feel a fair amount of guilt and ever growing resentment. I need your advice, maybe you've dealt with this expression of ego before, needs of self vs the needs of your friend. Is working with a friend a poor choice? Thank you for reading in.

    Read the article

  • C++ Undeclared Identifier (but it is declared?)

    - by Joshua
    I'm pretty sure I've included the qanda class, but when I try to declare a vector that contains it or a class of that type I get an error saying that qanda is undefined. Any idea what the problem might be? bot_manager_item.h #pragma once #include "../bot_packet/bot_packet.h" #include <vector> class bot_manager_item; #include "qanda.h" #include "bot_manager.h" class bot_manager_item { public: bot_manager_item(bot_manager* mngr, const char* name, const char* work_dir); ~bot_manager_item(); bool startup(); void cleanup(); void on_push_event(bot_exchange_format f); bool disable; private: void apply_changes(); bot_manager *_mngr; std::string _name; std::string _work_dir; std::string _message; std::string _message_copy; std::vector<qanda> games; qanda test; char _config_full_path[2600]; }; qanda.h #ifndef Q_AND_A #define Q_AND_A #include "users.h" #include "..\bot_packet\bot_packet.h" #include "bot_manager.h" #include <string> #include <algorithm> #include <map> #include <vector> #include <fstream> class qanda { public: qanda(bot_manager * manager, std::string name, std::string directory); ~qanda(){}; void room_message(std::string username, std::string user_message); void timer_tick(); private: // data members std::string question; std::string answer; std::string directory; std::string command_prefix; std::string name; Users users; std::map <std::string, std::string> questions_and_answers; int time_per_question; // seconds int time_between_questions; // seconds int timer; // milliseconds bool is_delayed; bool is_playing; bot_manager * manager; // functions void new_question(); void send_message(std::string msg); void announce_question(); void load_questions(); }; #endif

    Read the article

  • Combobox INotifyPropertyChanged event not raised!!!

    - by nagiah
    I created a combobox and set observable collection as the itemsource and implemented INotifyPropertyChanged on the observable collection item. Even after that, when I select different item in the combobox, the OnPropertyChange method is not invoked. I think I am not making the binding properly. Could any one please correct me/ suggest me in this regard. ---------------------------------MainPage.xaml--------------------------------------------------- <StackPanel Width="300"> <ComboBox Name="cboName"></ComboBox> <TextBox Name="tbxName" Text="{Binding Path=name,Mode=TwoWay,ElementName=cboName}" ></TextBox> </StackPanel> ---------------------------MainPage.xaml.cs----------------------------------------------- using System; using System.Collections.Generic; using System.Linq; using System.Net; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; using System.Collections.ObjectModel; using System.Collections.Specialized; using System.ComponentModel; namespace MasterDetailsUpdate { public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); Loaded += new RoutedEventHandler(MainPage_Loaded); } void MainPage_Loaded(object sender, RoutedEventArgs e) { ObservableCollection<Person> persons = new ObservableCollection<Person>(); persons.Add(new Person { city = "c1", name = "n1" }); persons.Add(new Person { city = "c2", name = "n2" }); persons.Add(new Person { city = "c3", name = "" }); persons.Add(new Person { city = "c4", name = "" }); persons.Add(new Person { city = "c5", name = "n1" }); cboName.ItemsSource = persons; cboName.DisplayMemberPath = "name"; } } public class Person : INotifyPropertyChanged { private string _name; private string _city; public string name { set { _name = value; OnPropertyChanged("name"); } get { return _name; } } public string city { set { _city = value; OnPropertyChanged("city"); } get { return _city; } } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; private void OnPropertyChanged(string propertyName) { if (PropertyChanged != null) { this.PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } } Thank You

    Read the article

  • jquery buttons icons for dialog

    - by khinester
    I have this code: $(function() { var mainButtons = [ {text: "Invite" , 'class': 'invite-button' , click: function() { // get list of members alert('Invite was clicked...'); } } // end Invite button , {text: "Options" , 'class': 'options-button' , click: function() { alert('Options...'); } } // end Options button ] // end mainButtons , commentButtons = [ {text: "Clear" , 'class': 'clear-button' , click: function() { $('#comment').val('').focus().select(); } } // end Clear button , {text: "Post comment" , 'class': 'post-comment-button' , click: function() { alert('send comment...'); } } // end Post comment ] // end commentButtons $( "#form" ).dialog({ autoOpen: false , height: 465 , width: 700 , modal: true , position: ['center', 35] , buttons: mainButtons }); $( "#user-form" ) .button() .click(function() { $(this).effect("transfer",{ to: $("#form") }, 1500); $( "#form" ).dialog( "open" ); $( ".invite-button" ).button({ icons: {primary:'ui-icon-person',secondary:'ui-icon-triangle-1-s'} }); $( ".options-button" ).button({ icons: {primary:'ui-icon-gear'} }); }); // Add comment... $("#comment, .comment").click(function(){ $('#comment').focus().select(); $("#form").dialog({buttons: commentButtons}); $( ".post-comment-button" ).button({ icons: {primary:'ui-icon-comment'} }); $( ".clear-button" ).button({ icons: {primary:'ui-icon-refresh'} }); }); //Add comment // Bind back the Invite, Options buttons $(".files, .email, .event, .map").click(function(){ $("#form").dialog({buttons: mainButtons}); $( ".invite-button" ).button({ icons: {primary:'ui-icon-person',secondary:'ui-icon-triangle-1-s'} }); $( ".options-button" ).button({ icons: {primary:'ui-icon-gear'} }); }); // Tabs $( "#tabs" ).tabs(); $( ".tabs-bottom .ui-tabs-nav, .ui-tabs-nav > *" ) .removeClass( "ui-widget-header" ) .addClass( "ui-corner-bottom" ); }); ? What is the right way to add the button icons? As in my code I had to add it two times, once: $( "#user-form" ) .button() .click(function() { $(this).effect("transfer",{ to: $("#form") }, 1500); $( "#form" ).dialog( "open" ); ... and $(".files, .email, .event, .map").click(function(){ ... Could this code be improved further? I don't seem to be able to get the "transfer" effect to work correctly in a modal. I added: , close: function() { $(this).effect("transfer",{ to: $("#user-form") }, 1500); } to the $( "#form" ).dialog({ How would you go about in getting the "transfer" to work nicely when you open and close the dialog box?

    Read the article

  • Sandbox "Sorry — your last action could not be completed"

    - by aron
    My site was working fine with PayPal's sandbox, and then all of a sudden it stopped. Now I get the wonderful error Sandbox "Sorry — your last action could not be completed" This is my HTML: <body onload="document.Paypal.submit();"> <!-- item_number should get passed back --> <form name="Paypal" method="post" action="https://www.sandbox.paypal.com cgi-bin/webscr" id="Paypal"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKLTkyNTEyNzc0NGRk0LKGvSMTla6LgHpbOsdk7iC0iXE=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWCALKhatPArLPtrsEAreImG4CweeH+AkCgMPhowcC+NaM4gQC+Y2VqwoCouzSnwEVXI9UvQxqI2UcdQ4SmcSWqfEZNw==" /> </div> <input type="hidden" name="cmd" value="_cart" /> <input type="hidden" name="upload" value="1" /> <!-- The following is for itemized PayPal data instead of the aggregated version --> <input type="hidden" name="item_name_1" value="LEADING SKILLS 4/10/2012 6:00 PM Section: Members " /> <input type="hidden" name="amount_1" value="250.00" /> <input type="hidden" name="quantity_1" value="2" /> <input type="hidden" name="handling_cart" value="7.00" /> <input type="hidden" name="tax_cart" value="35.00" /> <!-- STANDARD DATA --> <input name="business" type="hidden" id="business" value="[email protected]" /> <input name="invoice" type="hidden" id="invoice" value="TS-1E8B59A0-B" /> <input type="hidden" name="no_note" value="0" /> <input name="currency_code" type="hidden" id="currency_code" value="USD" /> <input name="shipCountry" type="hidden" id="shipCountry" /> <input type="hidden" name="return" value="http://rockclimbing.venueblue.com/Gateway/paypal/Complete.aspx?id=db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="cancel_returnUrl" type="hidden" id="cancel_returnUrl" value="http://rockclimbing.venueblue.com/ShoppingCart.aspx" /> <input type="hidden" name="cn" value="How did you hear about us?" /> <input name="custom" type="hidden" id="custom" value="db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="notify_url" type="hidden" id="notify_url" value="http://rockclimbing.venueblue.com/Gateway/Paypal/IPN.aspx" /> <input type="submit" value="Submit Payment Info" style="display:none;" /> Processing Order.... </form> </body> Anyone have a clue what happened?

    Read the article

  • Objective-C Basic class related question, retaining the value of a specific object using a class fil

    - by von steiner
    Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • FluentNHibernate - AutoMappings producing incorrect one-to-many column key

    - by Alberto
    Hi I'm new to NHibernate and FNH and am trying to map these simple classes by using FluentNHibernate AutoMappings feature: public class TVShow : Entity { public virtual string Title { get; set;} public virtual ICollection<Season> Seasons { get; protected set; } public TVShow() { Seasons = new HashedSet<Season>(); } public virtual void AddSeason(Season season) { season.TVShow = this; Seasons.Add(season); } public virtual void RemoveSeason(Season season) { if (!Seasons.Contains(season)) { throw new InvalidOperationException("This TV Show does not contain the given season"); } season.TVShow = null; Seasons.Remove(season); } } public class Season : Entity { public virtual TVShow TVShow { get; set; } public virtual int Number { get; set; } public virtual IList<Episode> Episodes { get; set; } public Season() { Episodes = new List<Episode>(); } public virtual void AddEpisode(Episode episode) { episode.Season = this; Episodes.Add(episode); } public virtual void RemoveEpisode(Episode episode) { if (!Episodes.Contains(episode)) { throw new InvalidOperationException("Episode not found on this season"); } episode.Season = null; Episodes.Remove(episode); } } I'm also using a couple of conventions: public class MyForeignKeyConvention : IReferenceConvention { #region IConvention<IManyToOneInspector,IManyToOneInstance> Members public void Apply(FluentNHibernate.Conventions.Instances.IManyToOneInstance instance) { instance.Column("fk_" + instance.Property.Name); } #endregion } The problem is that FNH is generating the section below for the Seasons property mapping: <bag name="Seasons"> <key> <column name="TVShow_Id" /> </key> <one-to-many class="TVShowsManager.Domain.Season, TVShowsManager.Domain, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null" /> </bag> The column name above should be fk_TVShow rather than TVShow_Id. If amend the hbm files produced by FNH then the code works. Does anyone know what it's wrong? Thanks in advance.

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • c++ templates: problem with member specialization

    - by ChAoS
    I am attempting to create a template "AutoClass" that create an arbitrary class with an arbitrary set of members, such as: AutoClass<int,int,double,double> a; a.set(1,1); a.set(0,2); a.set(3,99.7); std::cout << "Hello world! " << a.get(0) << " " << a.get(1) << " " << a.get(3) << std::endl; By now I have an AutoClass with a working "set" member: class nothing {}; template < typename T1 = nothing, typename T2 = nothing, typename T3 = nothing, typename T4 = nothing, typename T5 = nothing, typename T6 = nothing> class AutoClass; template <> class AutoClass<nothing, nothing, nothing, nothing, nothing, nothing> { public: template <typename U> void set(int n,U v){} }; template < typename T1, typename T2, typename T3, typename T4, typename T5, typename T6> class AutoClass: AutoClass<T2,T3,T4,T5,T6> { public: T1 V; template <typename U> void set(int n,U v) { if (n <= 0) V = v; else AutoClass<T2,T3,T4,T5,T6>::set(n-1,v); } }; and I started to have problems implementing the corresponding "get". This approach doesn't compile: template < typename T1, typename T2, typename T3, typename T4, typename T5, typename T6> class AutoClass: AutoClass<T2,T3,T4,T5,T6> { public: T1 V; template <typename U> void set(int n,U v) { if (n <= 0) V = v; else AutoClass<T2,T3,T4,T5,T6>::set(n-1,v); } template <typename W> W get(int n) { if (n <= 0) return V; else return AutoClass<T2,T3,T4,T5,T6>::get(n-1); } template <> T1 get(int n) { if (n <= 0) return V; else return AutoClass<T2,T3,T4,T5,T6>::get(n-1); } }; Besides, it seems I need to implement get for the <nothing, nothing, nothing, nothing, nothing, nothing> specialization. Any Idea on how to solve this?

    Read the article

  • Having a Link Only Appear If a Logged-In User Appears on a Dynamic List

    - by John
    Hello, For the function below, I would like the link <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> to only appear if the logged in user currently appears on editorlist.php. (I. e. if the loginid in the function corresponds to any of the usernames that currently appear in editorlist.php.) Appearing on editorlist.php is something that is dynamic. How can I do this? Thanks in advance, John function show_userbox() { // retrieve the session information $u = $_SESSION['username']; $uid = $_SESSION['loginid']; // display the user box echo '<div id="userbox"> <div class="username">'.$u.'</div> <div class="submit"><a href="http://www...com/.../submit.php">Submit an item.</a></div> <div class="changepassword"><a href="http://www...com/.../changepassword.php">Change Password</a></div> <div class="logout"><a href="http://www...com/.../logout.php">Logout</a></div> <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> </div>'; } On editorlist.php: $sqlStr = "SELECT l.loginid, l.username, l.created, DATEDIFF(NOW(), l.created) AS days, COALESCE(s.total, 0) AS countSubmissions, COALESCE(c.total, 0) AS countComments, COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore, DATEDIFF(NOW(), l.created) + COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore2 FROM login l LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM submission GROUP BY loginid ) s ON l.loginid = s.loginid LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM comment GROUP BY loginid ) c ON l.loginid = c.loginid GROUP BY l.loginid ORDER BY totalScore2 DESC LIMIT 10"; $result = mysql_query($sqlStr); $arr = array(); echo "<table class=\"samplesrec1edit\">"; while ($row = mysql_fetch_array($result)) { echo '<tr>'; echo '<td class="sitename1edit1"><a href="http://www...com/.../members/index.php?profile='.$row["username"].'">'.stripslashes($row["username"]).'</a></td>'; echo '<td class="sitename1edit2">'.($row["countSubmissions"]).'</td>'; echo '<td class="sitename1edit2">'.($row["countComments"]).'</td>'; echo '<td class="sitename1edit2">'.($row["days"]).'</td>'; echo '<td class="sitename1edit2">'.($row["totalScore2"]).'</td>'; echo '</tr>'; } echo "</table>";

    Read the article

  • Remove never-run call to templated function, get allocation error on run-time

    - by Narfanator
    First off, I'm a bit at a loss as to how to ask this question. So I'm going to try throwing lots of information at the problem. Ok, so, I went to completely redesign my test project for my experimental core library thingy. I use a lot of template shenanigans in the library. When I removed the "user" code, the tests gave me a memory allocation error. After quite a bit of experimenting, I narrowed it down to this bit of code (out of a couple hundred lines): void VOODOO(components::switchBoard &board){ board.addComponent<using_allegro::keyInputs<'w'> >(); } Fundementally, what's weirding me out is that it appears that the act of compiling this function (and the template function it then uses, and the template functions those then use...), makes this bug not appear. This code is not being run. Similar code (the same, but for different key vals) occurs elsewhere, but is within Boost TDD code. I realize I certainly haven't given enough information for you to solve it for me; I tried, but it more-or-less spirals into most of the code base. I think I'm most looking for "here's what the problem could be", "here's where to look", etc. There's something that's happening during compile because of this line, but I don't know enough about that step to begin looking. Sooo, how can a (presumably) compilied, but never actually run, bit of templated code, when removed, cause another part of code to fail? Error: Unhandled exceptionat 0x6fe731ea (msvcr90d.dll) in Switchboard.exe: 0xC0000005: Access violation reading location 0xcdcdcdc1. Callstack: operator delete(void * pUser Data) allocator< class name related to key inputs callbacks ::deallocate vector< same class ::_Insert_n(...) vector< " " ::insert(...) vector<" "::push_back(...) It looks like maybe the vector isn't valid, because _MyFirst and similar data members are showing values of 0xcdcdcdcd in the debugger. But the vector is a member variable...

    Read the article

  • C# MultiThread Safe Class Design

    - by Robert
    I'm trying to designing a class and I'm having issues with accessing some of the nested fields and I have some concerns with how multithread safe the whole design is. I would like to know if anyone has a better idea of how this should be designed or if any changes that should be made? using System; using System.Collections; namespace SystemClass { public class Program { static void Main(string[] args) { System system = new System(); //Seems like an awkward way to access all the members dynamic deviceInstance = (((DeviceType)((DeviceGroup)system.deviceGroups[0]).deviceTypes[0]).deviceInstances[0]); Boolean checkLocked = deviceInstance.locked; //Seems like this method for accessing fields might have problems with multithreading foreach (DeviceGroup dg in system.deviceGroups) { foreach (DeviceType dt in dg.deviceTypes) { foreach (dynamic di in dt.deviceInstances) { checkLocked = di.locked; } } } } } public class System { public ArrayList deviceGroups = new ArrayList(); public System() { //API called to get names of all the DeviceGroups deviceGroups.Add(new DeviceGroup("Motherboard")); } } public class DeviceGroup { public ArrayList deviceTypes = new ArrayList(); public DeviceGroup() {} public DeviceGroup(string deviceGroupName) { //API called to get names of all the Devicetypes deviceTypes.Add(new DeviceType("Keyboard")); deviceTypes.Add(new DeviceType("Mouse")); } } public class DeviceType { public ArrayList deviceInstances = new ArrayList(); public bool deviceConnected; public DeviceType() {} public DeviceType(string DeviceType) { //API called to get hardwareIDs of all the device instances deviceInstances.Add(new Mouse("0001")); deviceInstances.Add(new Keyboard("0003")); deviceInstances.Add(new Keyboard("0004")); //Start thread CheckConnection that updates deviceConnected periodically } public void CheckConnection() { //API call to check connection and returns true this.deviceConnected = true; } } public class Keyboard { public string hardwareAddress; public bool keypress; public bool deviceConnected; public Keyboard() {} public Keyboard(string hardwareAddress) { this.hardwareAddress = hardwareAddress; //Start thread to update deviceConnected periodically } public void CheckKeyPress() { //if API returns true this.keypress = true; } } public class Mouse { public string hardwareAddress; public bool click; public Mouse() {} public Mouse(string hardwareAddress) { this.hardwareAddress = hardwareAddress; } public void CheckClick() { //if API returns true this.click = true; } } }

    Read the article

  • Implementing default constructors

    - by James
    Implement the default constructor, the constructors with one and two int parameters. The one-parameter constructor should initialize the first member of the pair, the second member of the pair is to be 0. Overload binary operator + to add the pairs as follows: (a, b) + (c, d) = (a + c, b + d); Overload the - analogously. Overload the * on pairs ant int as follows: (a, b) * c = (a * c, b * c). Write a program to test all the member functions and overloaded operators in your class definition. You will also need to write accessor (get) functions for each member. The definition of the class Pairs: class Pairs { public: Pairs(); Pairs(int first, int second); Pairs(int first); // other members and friends friend istream& operator>> (istream&, Pair&); friend ostream& operator<< (ostream&, const Pair&); private: int f; int s; }; Self-Test Exercise #17: istream& operator (istream& ins, Pair& second) { char ch; ins ch; // discard init '(' ins second.f; ins ch; // discard comma ',' ins second.s; ins ch; // discard final '(' return ins; } ostream& operator<< (ostream& outs, const Pair& second) { outs << '('; outs << second.f; outs << ", " ;// I followed the Author's suggestion here. outs << second.s; outs << ")"; return outs; }

    Read the article

  • X264 encoding using Opencv

    - by user573193
    I am working with a high resolution camera: 4008x2672. I a writing a simple program which grabs frame from the camera and sends the frame to a avi file. For working with such a high resolution, I found only x264 codec that could do the trick (Suggestions welcome). I am using opencv for most of the image handling stuff. As mentioned in this post http://doom10.org/index.php?topic=1019.0 , I modified the AVCodecContext members as per ffmpeg presets for libx264 (Had to do this to avoid broken ffmpeg defaults settings error). This is output I am getting when I try to run the program [libx264 @ 0x992d040]non-strictly-monotonic PTS 1294846981.526675 1 0 //Timestamp camera_no frame_no 1294846981.621101 1 1 1294846981.715521 1 2 1294846981.809939 1 3 1294846981.904360 1 4 1294846981.998782 1 5 1294846982.093203 1 6 Last message repeated 7 times [avi @ 0x992beb0]st:0 error, non monotone timestamps -614891469123651720 = -614891469123651720 OpenCV Error: Unspecified error (Error while writing video frame) in icv_av_write_frame_FFMPEG, file /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp, line 1034 terminate called after throwing an instance of 'cv::Exception' what(): /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp:1034: error: (-2) Error while writing video frame in function icv_av_write_frame_FFMPEG Aborted Modifications to the AVCodecContext are: if(codec_id == CODEC_ID_H264) { //fprintf(stderr, "Trying to parse a preset file for libx264\n"); //Setting Values manually from medium preset c-me_method = 7; c-qcompress=0.6; c-qmin = 10; c-qmax = 51; c-max_qdiff = 4; c-i_quant_factor=0.71; c-max_b_frames=3; c-b_frame_strategy = 1; c-me_range = 16; c-me_subpel_quality=7; c-coder_type = 1; c-scenechange_threshold=40; c-partitions = X264_PART_I8X8 | X264_PART_I4X4 | X264_PART_P8X8 | X264_PART_B8X8; c-flags = CODEC_FLAG_LOOP_FILTER; c-flags2 = CODEC_FLAG2_BPYRAMID | CODEC_FLAG2_MIXED_REFS | CODEC_FLAG2_WPRED | CODEC_FLAG2_8X8DCT | CODEC_FLAG2_FASTPSKIP; c-keyint_min = 25; c-refs = 3; c-trellis=1; c-directpred = 1; c-weighted_p_pred=2; } I am probably not setting the dts and pts values which I believed ffmpeg should be setting it for me. Any sugggestions welcome. Thanks in advance

    Read the article

  • Multiset container appears to stop sorting

    - by Sarah
    I would appreciate help debugging some strange behavior by a multiset container. Occasionally, the container appears to stop sorting. This is an infrequent error, apparent in only some simulations after a long time, and I'm short on ideas. (I'm an amateur programmer--suggestions of all kinds are welcome.) My container is a std::multiset that holds Event structs: typedef std::multiset< Event, std::less< Event > > EventPQ; with the Event structs sorted by their double time members: struct Event { public: explicit Event(double t) : time(t), eventID(), hostID(), s() {} Event(double t, int eid, int hid, int stype) : time(t), eventID( eid ), hostID( hid ), s(stype) {} bool operator < ( const Event & rhs ) const { return ( time < rhs.time ); } double time; ... }; The program iterates through periods of adding events with unordered times to EventPQ currentEvents and then pulling off events in order. Rarely, after some events have been added (with perfectly 'legal' times), events start getting executed out of order. What could make the events ever not get ordered properly? (Or what could mess up the iterator?) I have checked that all the added event times are legitimate (i.e., all exceed the current simulation time), and I have also confirmed that the error does not occur because two events happen to get scheduled for the same time. I'd love suggestions on how to work through this. The code for executing and adding events is below for the curious: double t = 0.0; double nextTimeStep = t + EPID_DELTA_T; EventPQ::iterator eventIter = currentEvents.begin(); while ( t < EPID_SIM_LENGTH ) { // Add some events to currentEvents while ( ( *eventIter ).time < nextTimeStep ) { Event thisEvent = *eventIter; t = thisEvent.time; executeEvent( thisEvent ); eventCtr++; currentEvents.erase( eventIter ); eventIter = currentEvents.begin(); } t = nextTimeStep; nextTimeStep += EPID_DELTA_T; } void Simulation::addEvent( double et, int eid, int hid, int s ) { assert( currentEvents.find( Event(et) ) == currentEvents.end() ); Event thisEvent( et, eid, hid, s ); currentEvents.insert( thisEvent ); }

    Read the article

  • Technical non-terminating condition in a loop

    - by Snarfblam
    Most of us know that a loop should not have a non-terminating condition. For example, this C# loop has a non-terminating condition: any even value of i. This is an obvious logic error. void CountByTwosStartingAt(byte i) { // If i is even, it never exceeds 254 for(; i < 255; i += 2) { Console.WriteLine(i); } } Sometimes there are edge cases that are extremely unlikeley, but technically constitute non-exiting conditions (stack overflows and out-of-memory errors aside). Suppose you have a function that counts the number of sequential zeros in a stream: int CountZeros(Stream s) { int total = 0; while(s.ReadByte() == 0) total++; return total; } Now, suppose you feed it this thing: class InfiniteEmptyStream:Stream { // ... Other members ... public override int Read(byte[] buffer, int offset, int count) { Array.Clear(buffer, offset, count); // Output zeros return count; // Never returns -1 (end of stream) } } Or more realistically, maybe a stream that returns data from external hardware, which in certain cases might return lots of zeros (such as a game controller sitting on your desk). Either way we have an infinite loop. This particular non-terminating condition stands out, but sometimes they don't. A completely real-world example as in an app I'm writing. An endless stream of zeros will be deserialized into infinite "empty" objects (until the collection class or GC throws an exception because I've exceeded two billion items). But this would be a completely unexpected circumstance (considering my data source). How important is it to have absolutely no non-terminating conditions? How much does this affect "robustness?" Does it matter if they are only "theoretically" non-terminating (is it okay if an exception represents an implicit terminating condition)? Does it matter whether the app is commercial? If it is publicly distributed? Does it matter if the problematic code is in no way accessible through a public interface/API? Edit: One of the primary concerns I have is unforseen logic errors that can create the non-terminating condition. If, as a rule, you ensure there are no non-terminating conditions, you can identify or handle these logic errors more gracefully, but is it worth it? And when? This is a concern orthogonal to trust.

    Read the article

< Previous Page | 529 530 531 532 533 534 535 536 537 538 539 540  | Next Page >