Search Results

Search found 37844 results on 1514 pages for 'function composition'.

Page 541/1514 | < Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >

  • Returning JSON from JavaScript to Python

    - by Chris Lacy
    I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • Reading from an write-only(OUT) parameter in pl/sql

    - by sqlgrasshopper5
    When I tried writing to an read-only parameter(IN) of a function, Oracle complains with an error. But that is not the case when reading from an write-only(OUT) parameter of a function. Oracle silently allows this without any error. What is the reason for this behaviour?. The following code executes without any assignment happening to "so" variable: create or replace function foo(a OUT number) return number is so number; begin so := a; --no assignment happens here a := 42; dbms_output.put_line('HiYA there'); dbms_output.put_line('VAlue:' || so); return 5; end; / declare somevar number; a number := 6; begin dbms_output.put_line('Before a:'|| a); somevar := foo(a); dbms_output.put_line('After a:' || a); end; / Here's the output I got: Before a:6 HiYA there VAlue: After a:42

    Read the article

  • HREF link that targets nothing, does not want to use hash or void(0)

    - by Mattis
    I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • Optimizing a "set in a string list" to a "set as a matrix" operation

    - by Eric Fournier
    I have a set of strings which contain space-separated elements. I want to build a matrix which will tell me which elements were part of which strings. For example: "" "A B C" "D" "B D" Should give something like: A B C D 1 2 1 1 1 3 1 4 1 1 Now I've got a solution, but it runs slow as molasse, and I've run out of ideas on how to make it faster: reverseIn <- function(vector, value) { return(value %in% vector) } buildCategoryMatrix <- function(valueVector) { allClasses <- c() for(classVec in unique(valueVector)) { allClasses <- unique(c(allClasses, strsplit(classVec, " ", fixed=TRUE)[[1]])) } resMatrix <- matrix(ncol=0, nrow=length(valueVector)) splitValues <- strsplit(valueVector, " ", fixed=TRUE) for(cat in allClasses) { if(cat=="") { catIsPart <- (valueVector == "") } else { catIsPart <- sapply(splitValues, reverseIn, cat) } resMatrix <- cbind(resMatrix, catIsPart) } colnames(resMatrix) <- allClasses return(resMatrix) } Profiling the function gives me this: $by.self self.time self.pct total.time total.pct "match" 31.20 34.74 31.24 34.79 "FUN" 30.26 33.70 74.30 82.74 "lapply" 13.56 15.10 87.86 97.84 "%in%" 12.92 14.39 44.10 49.11 So my actual questions would be: - Where are the 33% spent in "FUN" coming from? - Would there be any way to speed up the %in% call? I tried turning the strings into factors prior to going into the loop so that I'd be matching numbers instead of strings, but that actually makes R crash. I've also tried going for partial matrix assignment (IE, resMatrix[i,x] <- 1) where i is the number of the string and x is the vector of factors. No dice there either, as it seems to keep on running infinitely.

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • How do I avoid killing the native controls on a html5-video when i've started it programmaticly?

    - by Nils
    OK, so the deal is I've started making a little videoplayer, that works by clicking a div with an image, expanding the div and the image, and then exchanges the image with a html5-videotag. the code is as below. (It's very early on, so i know theres a lot that need improving, as in not using javascript to set styles and so on, but nevertheless, any insigts and tips are welcome, besides the answer to the main question) /*Begin Expander*/ var $videoplayer = $('<video width="640" height="360" preload="none" controls="" tabindex="0" style="position: relative;"><source type="video/mp4" src="/restalive/movies/big_buck_bunny.mp4"></source><source type="video/ogg" src="/restalive/movies/big_buck_bunny.ogv"></source></video>').appendTo('body'); $videoplayer.hide(); $(".ExpandVideo").each(function(i){ var $trigger = $(this); var $image = $trigger.find("img"); $image.css({ "width" : "100%" ,"height" : "auto" }) $trigger.css({ "display" : "block" ,"overflow" : "hidden" ,"width" : "200px" ,"float" : "left" }); $trigger.bind("click", function(e){ $trigger.animate({"width" : "640px"}, "fast", function(){ $image.replaceWith($videoplayer); $videoplayer.show(); $videoplayer.attr("id", "video" + i); var video = document.getElementById("video" + i); video.play(); }) }) }); However, the main problem is that when i've fired of the video like this (video.play()), the native controls stop working, i can no longer pause the video, even though the controls are there, and clickable, the video just starts playing immidiatley again when i trie to pause it. Which is a shame, because i want to use the native controls for simplicity.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • password-check directive in angularjs

    - by mpm
    I'm writing a password verify directive : Directives.directive("passwordVerify",function(){ return { require:"ngModel", link: function(scope,element,attrs,ctrl){ ctrl.$parsers.unshift(function(viewValue){ var origin = scope.$eval(attrs["passwordVerify"]); if(origin!==viewValue){ ctrl.$setValidity("passwordVerify",false); return undefined; }else{ ctrl.$setValidity("passwordVerify",true); return viewValue; } }); } }; }); html : <input data-ng-model='user.password' type="password" name='password' placeholder='password' required> <input data-ng-model='user.password_verify' type="password" name='confirm_password' placeholder='confirm password' required data-password-verify="user.password"> Given 2 password fields in a form, if both password values are equal then the field affected by the directive is valid. The issue is that it works one way (i.e. when I type a password in the password-verify field). However, when the original password field is updated, the password-verify doesn't become valid. Any idea how I could have a "two way binding verify?"

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • Cannot redeclare class on a copy of a site

    - by Polity
    I've developed a small SMS utility for a customer in PHP. The details are of non-importance. This project is hosted in: http://project.example.com/customer1 Now a second customer requests almost the same functionality, one cheap way of providing this is to copy the project from the first customer and modify it slightly. So i made a direct copy of the project for customer1 to another folder for customer 2. This project is hosted in: http://project.example.com/customer2 Now when i try and run the project for customer2 (calling a single page), i get the error message: Fatal error: Cannot redeclare class SmsService in /var/www/html/project/customer1/application/service.class.php on line 3 Here, service.class.php is a simple interface with 3 methods: interface SmsService { public function SendSms($mobile, $customerId, $customerName, $message); public function QueryIncomingResponse(); public function CleanExpiredConfirmations($maxConfirmationDays); } printing the backtrace in service.class.php reveals something interresting: #0 require_once() called at [/var/www/html/project/customer2/endpoint/queryIncomingResponse.php:2] Fatal error: Cannot redeclare class SmsService in /var/www/html/project/customer1/application/service.class.php on line 3 Line 2 in queryIncomingResponses is the very first require line there is. Line 3 in service.class.php is the first statement there is in the file (Line 2 is an empty line and line 1 is the php file opening tag). Naturally, I only work with relative requires (double checked this) so there is no way one include/require from customer2 actually refers to a file for customer1. It seems to me that in some way SmsService and other classes gets cached by PHP. (I have little control over the server environment). One solution to this would be namespaces. Unfortunatly, we work with PHP 5.1.7 where namespaces are not a part of the language feature just yet. Another way would be to mimic namespaces by prefixing all classes but this approach just feels dirty. Does anyone have more information on this problem and possibly solutions? Many thanks in advance!

    Read the article

  • JS: Object itteration fails

    - by Newbie
    Hello! In my JS, I have an object called box_object. It looks like this: ({ id:"3", text:"this is a box object", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top"}, 1:{id:"2", linepoint:"top"}} }) Now, I want to add some position values to box_object.connectiondata_parent. Using jQuery I can use the .each() method. So I tried it, but it failed. In my function I do the following: $(box_object.connectiondata_parent).each(function(it, obj){ if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "top"){ var point_position_top = new Object(); point_position_top.left = startingpoint_left; point_position_top.top = startingpoint_top; obj[it].position = point_position_top; }else if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "bottom"){ var point_position_bottom = new Object(); point_position_bottom.left = startingpoint_left; point_position_bottom.top = startingpoint_bottom; obj[it].position = point_position_bottom; }else{} }); After the function my box_object looks like this: ({ id:"3", text:"this is third box", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top", position:{left:500, top:104}}, 1:{id:"2", linepoint:"top"}} }) It seems it only writes the values to the first "value". Any Ideas why?

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Manipulating original elements with qTip

    - by pjotr
    I have a bunch of divs on my page and each of them has only the class attribute. In the divs there are some spans, which are set up to display a tooltip with the help of qTip. The tooltip should contain three items: Up: anchor, which should move the OuterDiv up (probably something like this: move up/down in jquery) Down: anchor, which should move the OuterDiv down Delete: anchor, which should remove the calling OuterDiv My code so far: <body> <div class="OuterDiv"> <div class="InnerDiv"> <span class="Position">Position 1</span> </div> </div> <div class="OuterDiv"> <div class="InnerDiv"> <span class="Position">Position 2</span> </div> </div> </body> And scripts: $(document).ready(function () { var qTipContent = '<a href="javascript:void(0)" onclick="">&uarr;</a>&nbsp;&nbsp;&nbsp;'; qTipContent = qTipContent + '<a href="javascript:void(0)" onclick="">&darr;</a>&nbsp;&nbsp;&nbsp;'; qTipContent = qTipContent + '<a href="javascript:void(0)" onclick="">X</a>'; $('.Position').each(function () { $(this).qtip({ content: qTipContent, hide: { fixed: true } }) }); }); How should the onclick function in the qTip content look like?

    Read the article

  • using empty on inaccessible object with __isset and __get

    - by David
    <?php class Magic_Methods { protected $meta; public function __construct() { $this->meta = (object) array( 'test' => 1 ); } public function __isset($name) { echo "pass isset {$name} \n"; return isset($this->$name); } public function __get($name) { echo "pass get {$name} \n"; return $this->$name; } } $mm = new Magic_Methods(); $meta = empty($mm->meta->notExisting); var_dump($meta); echo "||\n"; $meta = empty($mm->meta); var_dump($meta); The snippet above does not work as expected for me. Why would the first empty() ommit the __isset? I get this: pass get meta bool(true) || pass isset meta pass get meta bool(false) I would expected identical results or another pass at the __isset, but not a direct call to __get. Or am I missing something here?

    Read the article

  • c# template member functions

    - by user3730583
    How can I define a template member function in C# For instance I will fill any collection which supports an Add(...) member function, please check out the sample code below public class CInternalCollection { public static void ExternalCollectionTryOne<T<int>>(ref T<int> ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } public static void ExternalCollectionTryTwo<T>(ref T ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; } The ExternalCollectionTryOne<...(...) would be the preferred kind, because the int type can be explicit defined, but results in an error: Type parameter declaration must be an identifier not a type The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) The ExternalCollectionTryTwo<...(...) results in an error: 'T' does not contain a definition for 'Add' and no extension method 'Add' accepting a first argument of type 'T' could be found (are you missing a using directive or an assembly reference?)... I hope the problem is clear – any suggestions? ----------------------------- edit -------------------------- The answers with the interface ICollection<.. without a template member works fine and thanks all for this hint, but I still cannot define successfully a member template(generic) function So a more simpler example ... how can I define this public class CAddCollectionValues { public static void AddInt<T>(ref T number, int selection) { T new_T = new T(); //this line is just an easy demonstration to get a compile error with type T foreach (int i_value in m_int_col) { if (i_value > selection) number += i_value; //again the type T cannot be used } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; }

    Read the article

  • CSS class not working as expected [closed]

    - by user1050619
    My HTML codes not implement the CSS styling..The border in the CSS file is not being implemented. I tried both in Firefox & IE. Please provide your inputs. Please find the code below: HTML <html> <head> <link href="file://c:/jquery/chapter-1/begin/styles/my_style.css" rel="stylesheet"> </head> <body> <div id="header" class="no_hover"><h1>Header</h1></div> <button type="button" id="btn1">Click to Add</button> <button type="button" id="btn2">Click to Remove</button> <script src="file://c:/jquery/chapter-1/begin/scripts/jquery.js" type="text/javascript"></script> <script src="file://c:/jquery/chapter-1/begin/scripts/test4.js" type="text/javascript"></script> </body> </html> jS FILE $(document).ready(function() { $("#btn1").click( function(){ $("#header").addClass("hover"); $("#header").removeClass("no_hover"); }); $("#btn2").click( function(){ $("#header").removeClass("hover"); $("#header").addClass("no_hover"); }); }); CSS FILE .hover{ border: solid #f00 3px; } .no_hover{ border: solid #000 3px; }

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • Crystal Reports Cross Tab Conditional Formatting

    - by ltran
    I would like to achieve a simplified result similar to the "Color Scale" function in Excel i.e. gradient colouring based on the lowest value (red) to highest value (green), except in my cross tab using Crystal Reports 2008. My cross tab looks a little like this: HOURS L1 L2 L3 L4 Total 1 hours | 5 | 0 | 1 | 16 | 22 | 2 hours | 0 | 1 | 0 | 10 | 11 | 3 hours | 8 | 2 | 6 | 12 | 28 | TOTAL |13 | 3 | 7 | 38 | 61 | The principle of my function is find the maximum value in the cross table then use 20%, 40%, 60%, 80% values to colour the background. Function is as follows (in the format background section): if currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.2) then color(255,0,0) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.2) and currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.4)) then color(255,192,0) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.4) and currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.6)) then color(255,255,0) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.6) and currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.8)) then color(146,208,80) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.8)) then color(0,176,80) It's not elegant, nor does it work properly, any assistance/suggestions would be much appreciated. I wasn't expecting it to be so complicated as originally I was working with the below assuming it would work, except it tells me that "CurrentFieldValue" is not a field. if CurrentFieldValue < ((Maximum (CurrentFieldValue))*0.2) then color(255,0,0) else if ... etc.

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

< Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >