Search Results

Search found 37844 results on 1514 pages for 'function composition'.

Page 541/1514 | < Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • How do I avoid killing the native controls on a html5-video when i've started it programmaticly?

    - by Nils
    OK, so the deal is I've started making a little videoplayer, that works by clicking a div with an image, expanding the div and the image, and then exchanges the image with a html5-videotag. the code is as below. (It's very early on, so i know theres a lot that need improving, as in not using javascript to set styles and so on, but nevertheless, any insigts and tips are welcome, besides the answer to the main question) /*Begin Expander*/ var $videoplayer = $('<video width="640" height="360" preload="none" controls="" tabindex="0" style="position: relative;"><source type="video/mp4" src="/restalive/movies/big_buck_bunny.mp4"></source><source type="video/ogg" src="/restalive/movies/big_buck_bunny.ogv"></source></video>').appendTo('body'); $videoplayer.hide(); $(".ExpandVideo").each(function(i){ var $trigger = $(this); var $image = $trigger.find("img"); $image.css({ "width" : "100%" ,"height" : "auto" }) $trigger.css({ "display" : "block" ,"overflow" : "hidden" ,"width" : "200px" ,"float" : "left" }); $trigger.bind("click", function(e){ $trigger.animate({"width" : "640px"}, "fast", function(){ $image.replaceWith($videoplayer); $videoplayer.show(); $videoplayer.attr("id", "video" + i); var video = document.getElementById("video" + i); video.play(); }) }) }); However, the main problem is that when i've fired of the video like this (video.play()), the native controls stop working, i can no longer pause the video, even though the controls are there, and clickable, the video just starts playing immidiatley again when i trie to pause it. Which is a shame, because i want to use the native controls for simplicity.

    Read the article

  • Returning JSON from JavaScript to Python

    - by Chris Lacy
    I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

    Read the article

  • JSON Array Created in PHP/MySQL incorrectly decoded using JQuery

    - by Zak
    I am attempting to make an AJAX call to a very small PHP script that should return me an array that could be echo'd and decoded using JQuery. Here is what I have: My PHP page called to by AJAX: $web_q=mysql_query("select * from sec_u_g where uid='$id' "); $rs = array(); while($rs[] = mysql_fetch_assoc($web_q)) { } print_r(json_encode($rs)); This outputs: [{"id":"3","uid":"39","gid":"16"},{"id":"4","uid":"39","gid":"4"},{"id":"5","uid":"39","gid":"5"},{"id":"6","uid":"39","gid":"6"},{"id":"7","uid":"39","gid":"7"},{"id":"8","uid":"39","gid":"8"},{"id":"9","uid":"39","gid":"9"},false] I don't understand the "false" at the end for one .. But then I send to to JQuery and use: $.each(json.result, function(i, object) { $.each(object, function(property, value) { alert(property + "=" + value); }); }); This just fails. I try to alert "result" by itself which is set by: $.post("get_ug.php",{id:txt},function(result){ }); My output alerts are as follows: 1) The key is '0' and the value is '[' 2) The key is '1' and the value is 'f' 3) The key is '2' and the value is 'a' 4) The key is '3' and the value is 'l' 5) The key is '4' and the value is 's' 6) The key is '5' and the value is 'e' 7) The key is '6' and the value is ']' 8) The key is '7' and the value is ' ' (<-- Yes the line break is there in the alert) I am exhausted from trying different ideas and scripts. Other than setting a delimiter myself and concatenating my own array and decoding it with a custom script, does anyone have any ideas?? Thank you!!

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • Ajax return string links not working

    - by Andreas Lympouras
    I have this ajax function: function getSearchResults(e) { var searchString = e.value; /*var x = e.keyCode; var searchString = String.fromCharCode(x);*/ if (searchString == "") { document.getElementById("results").innerHTML = ""; return; } var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp = new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange = function () { if (xmlhttp.readyState == 4 && xmlhttp.status == 200) { document.getElementById("results").innerHTML = xmlhttp.responseText; } } xmlhttp.open("GET", "<%=Page.ResolveUrl("~/template/searchHelper.aspx?searchString=")%>"+searchString, true); xmlhttp.setRequestHeader("If-Modified-Since", "Sat, 1 Jan 2000 00:00:00 GMT"); //solve any AJAX caching problem(not refreshing) xmlhttp.send(); } and here is when I call it: <input class="text-input" value="SEARCH" id="searchbox" onkeyup="javascript:getSearchResults(this);" maxlength="50" runat="server" /> and all my links in the searchHelper.aspx file(which retruns them as a string) are like this: <a class="item" href='../src/actors.aspx?id=77&name=dasdassss&type=a' > <span class="item">dasdassss</span></a> When I click this link I want my website to go to ../src/actors.aspx?id=77&name=dasdassss&type=a but nothing happens. When I hover over the link, it also shows me where the link is about to redirect! any help?

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • Javascript/Jquery pop-up window in Asp.Net MVC4

    - by Mark
    Below I have a "button" (just a span with an icon) that creates a pop-up view of a div in my application to allow users to compare information in seperate windows. However, I get and Asp.Net Error as follows: **Server Error in '/' Application. The resource cannot be found. Requested URL: /Home/[object Object]** Does anyone have an Idea of why this is happending? Below is my code: <div class="module_actions"> <div class="actions"> <span class="icon-expand2 pop-out"></span> </div> </div> <script> $(document).ajaxSuccess(function () { var Clone = $(".pop-out").click(function () { $(this).parents(".module").clone().appendTo("#NewWindow"); }); $(".pop-out").click(function popitup(url) { LeftPosition = (screen.width) ? (screen.width - 400) / 1 : 0; TopPosition = (screen.height) ? (screen.height - 700) / 1 : 0; var sheight = (screen.height) * 0.5; var swidth = (screen.width) * 0.5; settings = 'height=' + sheight + ',width=' + swidth + ',top=' + TopPosition + ',left=' + LeftPosition + ',scrollbars=yes,resizable=yes,toolbar=no,status=no,menu=no, directories=no,titlebar=no,location=no,addressbar=no' newwindow = window.open(url, '/Index', settings); if (window.focus) { newwindow.focus() } return false; }); });

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • Getting Response From Jquery JSON

    - by Howdy_McGee
    I'm having trouble getting a response from my php jquery / json / ajax. I keep combining all these different tutorials together but I still can't seem to pull it all together since no one tutorial follow what I'm trying to do. Right now I'm trying to pass two arrays (since there's no easy way to pass associative arrays) to my jquery ajax function and just alert it out. Here's my code: PHP $names = array('john doe', 'jane doe'); $ids = array('123', '223'); $data['names'] = $names; $data['ids'] = $ids; echo json_encode($data); Jquery function getList(){ $.ajax({ type: "GET", url: 'test.php', data: "", complete: function(data){ var test = jQuery.parseJSON(data); alert(test.names[0]); alert("here"); } }, "json"); } getList(); In my html file all I'm really calling is my javascript file for debugging purposes. I know i'm returning an object but I'm getting an error with null values in my names section, and i'm not sure why. What am I missing? My PHP file returns {"names":["john doe","jane doe"],"ids":["123","223"]} It seems to be just ending here Uncaught TypeError: Cannot read property '0' of undefined so my sub0 is killing me.

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Fitting Text into an Image

    - by Abs
    Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

    Read the article

  • Javascript FAQ drop down

    - by kdipaolo
    Im trying to create a simple FAQ drop down but for some reason it is not working. Would you mind taking a look? Thanks guys! CSS #faqs h3 { cursor:pointer; } #faqs h3.active { color:#d74646; } #faqs div { height:0; overflow:hidden; position:relative; } #faqs div p { padding:0; margin-bottom:15px; } JavaScript: $(document).ready(function() { $('#faqs h3').each(function() { var tis = $(this), state = false, answer = tis.next('div') .hide() .css('height','auto') .slideUp(); tis.click(function() { state = !state; answer.slideToggle(state); tis.toggleClass('active',state); }); }); }); HTML <div id="faqs"> <h3>This is question 1?</h3> <div> <p>This is the answer to question #1.</p> </div> <h3>This is question 2?</h3> <div> <p>This is the answer to question #2.</p> </div> </div>

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

  • Two Objects created with the same Address in Flex

    - by James
    Hi, I have an issue in flex which is causing a bit of a headache! I am adding objects to an ArrayCollection but in doing so, another ArrayCollection is also picking up these changes even though there is no binding occurring. I can see from the debug that the two ACs have the same address but for the life of me can't figure out why. I have two Array Collections: model.index.rows //The main array collection model.index.holdRows //The array collection that imitates the above This phantom data binding occurs only for the first iteration in the loop and for all others it will just write it the once. The reason this is proving troublesome is that it creates duplicate entries in my datagrid. public override function handleMessage(message:IMessage):void { super.handleMessage(message); if (message is IndexResponse) { var response:IndexResponse = message as IndexResponse; model.index.rows.removeAll(); model.index.indexIsEmpty = response.nullIndex; if (model.index.indexIsEmpty !== true) { //Update the index model from the response. Note: each property of the row object will be shown in the UI as a column in the grid response.index.forEach(function(entry:EntryData, i:int, a:Array):void { var row:Object = { fileID: entry.fileID, dadName: entry.dadName }; entry.tags.forEach(function(tag:Tag, i:int, a:Array):void { row[tag.name] = tag.value; }); model.index.rows.addItem(row); }); if(model.index.indexForNetworkView == true){ model.index.holdRows.source = model.index.holdRows.source.concat(model.index.rows.source); model.index.indexCounter++; model.index.indexForNetworkView = false; controller.indexController.showNetwork(model.index.indexCounter); } model.index.rows.refresh(); controller.networkController.show(); } } Has anyone else who has encountered something simillar propose a solution?

    Read the article

  • Division of text follow the cursor via Javascript/Jquery

    - by webzide
    Dear experts, I wanted have a dynamic division of content follow you with the cursor in the web browser space. I am not a pro at JS so I spent 2 hours to finally debugged a very stupid way to accomplish this. $(document).ready(function () { function func(evt) { var evt = (evt) ? evt : event; var div = document.createElement('div'); div.style.position = "absolute"; div.style.left = evt.clientX + "px"; div.style.top = evt.clientY + "px"; $(div).attr("id", "current") div.innerHTML = "CURSOR FOLLOW TEXT"; $(this).append($(div)); $(this).unbind() $(this).bind('mousemove', function () { $('div').remove("#current"); }); $(this).bind('mousemove', func); } $("body").bind('mousemove', func) }); As you can see this is pretty much Brute force and it slows down the browser quite a bit. I often experience a lag on the browser as a drag my mouse from one place to another. Is there a way to accomplish this easier and faster and more intuitive. I know you can use the cursor image technique but thats something I'm looking to avoid. Thanks in advance.

    Read the article

  • Drupal - Search box not working - custom theme template

    - by vr3690
    Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

    Read the article

< Previous Page | 537 538 539 540 541 542 543 544 545 546 547 548  | Next Page >