Search Results

Search found 2945 results on 118 pages for 'a grad student at a university'.

Page 56/118 | < Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >

  • C# ATM Bank coding help needed please

    - by user1735692
    if anyone can help with with I would be grateful. I am trying to make a program in c# that acts like an ATM with withdrawing, depositing money, displayed in Program.cs that is connected to Account.cs linked class programs. At the moment it works if I manually input the data and tell it what to display, but I what to do is - Allow users to enter amounts to deposit and withdraw using overloaded implementations of the methods makeDeposit and makeWithdrawal. I have tried many things, and can not get it to work, if anyone can help, I would be grateful if anyone can, thanks again Program.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace Tut9 { class Program { static void Main(string[] args) { Account myAcc = new Account(); myAcc.makeDeposit(10000); myAcc.showBalance(); Console.WriteLine("Attempting to withdraw £" + 90); myAcc.makeWithdrawal(90); myAcc.showBalance(); myAcc.giveOverdraft(50); myAcc.showBalance(); Account student = new Account(30, -100); student.giveOverdraft(-500); } } } Account.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace Tut9 { class Account { ////Need to know the balance & ovedraft private int balance; private int overdraft; ////Constructor public Account() { balance = 0; overdraft = 0; } public Account(int initial) { balance = initial; } public Account(int intial, int over) { balance = intial; overdraft = over; } public void giveOverdraft(int amount) { overdraft = amount; } ////Method to display the balance & overdraft public void showBalance() { Console.WriteLine("The balance is now £" + balance); if (overdraft != 0) { Console.WriteLine("You have an overdraft of £" + overdraft); } } ////Method to make a withdrawl public void makeWithdrawal(int y) { balance = balance - y; Console.WriteLine("Withdrew £" + y); } ////Method to make deposit public void makeDeposit(int x) { balance = balance + x; Console.WriteLine("Desposited £" + x); } } }

    Read the article

  • GWT. Exclude shared domain objects to separate Maven module

    - by MyTitle
    I have some Domain classes such as Student, User etc which are used on server and client (gwt) sides. Can I exclude this domain classes to separate maven-module, so I can add this module as dependency to other maven-modules (i.e. add this module as dependency to maven-module which contains gwt related stuff, so this domain classes will be generated to JavaScript, and add this module as dependency to "normal" (not gwt) Java maven-modules, so this domain classes won’t be generated to JavaScript)?

    Read the article

  • HOw TO run a c programm in ubuntu 10.10

    - by Vinay Khandalkar
    Hello I want to run c programs in ubuntu 10.10 because in my college lab i gave the advice to change os they use replace xp to ubuntu and they did it by my request to them but in our college lab all student are doing daily practices on c programming and now there is problems to run the c programs in ubuntu 10.10 so please help me.please Is there is any one to give me solution on this topic please fast. Thank You !!!!!!!!!!!

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Acer Aspire One (mini) mfgd 9/03 locks up also when plugged in

    - by LAURIE ANN
    My problem is almost the same as the Toshiba user (Toshiba A205-5804 freezes when plugged in): Well I have a Toshiba A205-5804 and the problem is that the screen freezes anytime I plug the pc into the external power supply, not as most of the computers having the same issue, my computer DOES freeze in safe mode, and I really can't bear this problem for much longer... It's not an overheat problem, the computer is not getting hot or anything related, I've tried already to change the AC adapter, to boot only with AC and no battery, and also all of these suggestions: The only difference in my case is: I can be using the battery and when it runs down, I can just close the lid and the system goes into hibernation mode. I then plug it in and let it charge. When I think it's finally charged, I can UNPLUG it, open the lid and all is running fine on the battery again. Note: the system was NOT shut down and it still runs as long as I remove the power plug before opening the lid. I have ALL the same issues as the other Toshiba user, also. I was a tech for 9 yrs in my own business and this one has not only stumped me, but anyone I have asked has never heard of this problem. Every repair center wants to charge me for diagnosis, even is they cannot fix it. I would really like to run this system along side of my new Acer Aspire 17" laptop as I need it to finish my grad school work. Any ideas would be GREATLY appreciated. Thanx, Laurie Ann

    Read the article

  • Building vs buying a server for an academic lab [closed]

    - by Roy
    I'm looking for advice on the classic build vs buy question. We need a new linux server to run Matlab computation on in our lab (academic). Matlab parallel computing toolbox licence allows up to 12 local workers so we are aiming at a 12 core server with 4GB memory per core (total of 48gb). The system will have an SSD for the OS and a raid-5 (4x2tb) for data. I looked around and found a (relatively) cheap vendor, Silicon Mechanics, that offers a system to our liking (specs below) for $6732. However, buying the components from newegg cost only $4464! The difference is $2268 which is 50% of the base cost. If buying from a company can be thought of as a sort of insurance, basically my premiums are of 50% of the base cost which to me sounds like a lot. Of course any downtime is bad, but the work is not "mission critical", i.e. if it takes a few days to fix it when it breaks its no the end of the world. If it takes weeks to months then its a problem. If it breaks 2-3 times in 3 years, not too bad. If it breaks every month not good. In term of build experience, I set up a linux cluster in grad school (from existing computers) and I build my home pcs but I never built a server before. The server components I'm thinking about: 1 x SUPERMICRO SYS-7046T-6F 4U Tower Server Barebone Dual LGA 1366 Intel 5520 DDR3 1333/1066/800 ($1,050) 12 x Kingston 4GB 240-Pin DDR3 SDRAM DDR3 1333 (PC3 10600) ECC Unbuffered Server Memory ($420) 2 x Intel Xeon E5645 Westmere-EP 2.4GHz LGA 1366 80W Six-Core ($1,116) 4 x Seagate Constellation ES 2TB 7200 RPM SATA 6.0Gb/s 3.5" ($1,040) 1 x SAMSUNG Internal DVD Writer Black SATA ($20) 1 x Intel 520 Series 2.5" 180GB SATA III MLC SSD $300 1 x LSI LSI00281 PCI-Express 2.0 x8 MD2 Low profile SATA / SAS MegaRAID SAS 9260CV-4i Controller Card, $695

    Read the article

  • Configuring Novel iPrint client on ubuntu 13.10

    - by Mahdi Sadeghi
    Recently I have struggled a lot to make Novel iPrint client to work on my laptop. I need it to use Follow Me printers in our university(you can take your print form any printer). Using this tutorial from Novel, I tried to convert the rpm package and install it on Ubuntu 13.04 & 13.10. The post install script from installing generated deb package had a typo which I saw in post install messages and I fixed that. Now I have the client running. To see the client UI I installed cinnamon desktop(because unity does not have system tray and old solutions did'nt work to whitelist Novel clinet). I have iPrint plugin installed on firefox as well(I copied the shared object files to plugin directories). I try installing printers from provided ipp URL(which lists available printers on the server) with no success. After clicking the printer name I see this: I have various errors: Formerly firefox used to asked my network username/password for installing SSL printer but now it returns this: iPrint Printer - The printer is currently not available. However I can install non-SSL version but the printer location is either empty or points to: file:///dev/null even if I change it to the exact address which I see on working machines still it prints nothing. I have tried the novel command line tool, iprntcmd to print. It is being installed at: /opt/novell/iprint/bin/ msadeghi@werkstatt:/opt/novell/iprint/bin$ ./iprntcmd --addprinter ipp://iprint.rz.hs-offenburg.de/ipp/Follow-me\ -\ IPP iprntcmd v05.04.00 Adding printer ipp://iprint.rz.hs-offenburg.de/ipp/Follow-me - IPP. Added printer ipp://iprint.rz.hs-offenburg.de/ipp/Follow-me - IPP successfully. It adds the printer with empty location and again no print. What I found interesting is the log file at ~/.iprint/errors.txt with strange errors which I hope somebody here can understand. When I try to install the SSL printer I receive these logs(note that HP is my local printer and has nothing to do with iprint): Thu Oct 31 11:02:03 2013 Trace Info: iprint.c, line 6690 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for file:///dev/null - Unknown Port Type - file Thu Oct 31 11:02:03 2013 Trace Info: iprint.c, line 6800 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for hp:/usb/HP_LaserJet_1018?serial=KP103A1 - No Port type specified Thu Oct 31 11:02:05 2013 Trace Info: iprint.c, line 6690 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for file:///dev/null - Unknown Port Type - file Thu Oct 31 11:02:05 2013 Trace Info: iprint.c, line 6800 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for hp:/usb/HP_LaserJet_1018?serial=KP103A1 - No Port type specified Thu Oct 31 11:02:06 2013 Trace Info: mydoreq.c, line 676 Group Info: CLIB Error Code: 0 (0x0) User ID: 1000 Error Msg: Success Debug Msg: MyCupsDoFileRequest - httpReconnect failed (0) Thu Oct 31 11:02:06 2013 Trace Info: mydoreq.c, line 1293 Group Info: CUPS-IPP Error Code: 1282 (0x502) User ID: 1000 Error Msg: iPrint Printer - The printer is currently not available. Debug Msg: MyCupsDoFileRequest - IPP SERVICE UNAVAILABLE Thu Oct 31 11:02:06 2013 Trace Info: iprint.c, line 6690 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for file:///dev/null - Unknown Port Type - file Thu Oct 31 11:02:06 2013 Trace Info: iprint.c, line 6800 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for hp:/usb/HP_LaserJet_1018?serial=KP103A1 - No Port type specified Thu Oct 31 11:02:08 2013 Trace Info: iprint.c, line 6690 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for file:///dev/null - Unknown Port Type - file Thu Oct 31 11:02:08 2013 Trace Info: iprint.c, line 6800 Group Info: IPRINT-lib Error Code: 4096 (0x1000) User ID: 1000 Error Msg: iPrint Lib - Bad URI type supplied (not IPP:, HTTP:, or HTTPS:). Debug Msg: IPRINTInterpretURI for hp:/usb/HP_LaserJet_1018?serial=KP103A1 - No Port type specified I should say that my friend can print using the same instructions on CrunchBang easily and another guy on 12.04 LTS but with more struggling. It worked for me on linux mint maya with my old laptop as well. Is there anybody out there who can help me to solve these problems? I am really disappointed with Novell and our university support. PS. I had the same problemwith 13.04. No matter if I am within the network or I connect with VPN, I have the same issues.

    Read the article

  • SQL SERVER – Developer Training Resources and Summary Roundup

    - by pinaldave
    It is always pleasure for any author when other renowned authors in the industry write about you. Earlier I wrote a five part blog series on Developer Training and I have received a phenomenal response to the series. I have received plenty of comments, questions and feedback. I thought it would be nice to sum up the whole series as well answer a few of the questions received. Quick Recap Developer Training - Importance and Significance - Part 1 In this part we discussed the importance of training in the real world. The most important and valuable resource any company is its employee. Employees who have been well-trained will be better at their jobs and produce a better product.  An employee who is well trained obviously knows more about their job and all the technical aspects. I have a very high opinion about training employees and it is the most important task. Developer Training – Employee Morals and Ethics – Part 2 In this part we discussed the most crucial components of training. Often employees are expecting the company to pay for their training and the company expresses no interest in training the employee. Quite often training expenses are the real issue for both the employee and employer. There are companies that pay for 100% of the expenses and there are employees who opt for training on their own expense during their personal time. Training is often looked at as vacation by employee and employers and we need to change this mind-set. One of the ways is to report back the learning to your manager and implement newly learned knowledge in day-to-day work. Developer Training – Difficult Questions and Alternative Perspective - Part 3 This part was the most difficult to write as I tried to address a few difficult questions and answers. Training is such a sensitive issue that many developers when not receiving chance for training think about leaving the organization. The manager often feels pressure to accommodate every single employee for training even though his training budget is limited. It is indeed the responsibility of the developer to get maximum advantage from the training. Training immediately helps organizations but stays as a part of an employee’s knowledge forever. Developer Training – Various Options for Developer Training – Part 4 In this part I tried to explore a few methods and options for training. The generic feedback I received on this blog post was short and I should have explored each of the subject of the training in details. I believe there are two big buckets of training 1) Instructor Lead Training and 2) Self Lead Training. The common element between both the methods is “learning material”. Learning material can be of any format – videos, books, paper notes or just a plain black board. Instructor-led training is a very effective mode but not possible every single time. During the course of the developer’s career, one has to learn lots of new technology and it is almost impossible to have a quality trainer available on that subject at that time. Books are most effective and proven methods, however, it always helps if someone explains the concepts of the book with a demonstration. In recent times I have started to believe in online trainings which leads to a hybrid experience. Online trainings take the best part of the books and the best part of the instructor-led training and gives effective training in a matter of hours. Developer Training – A Conclusive Summary- Part 5 In this part, I shared what I was continuously thinking about developer training. There is no better teacher than oneself. There is no better motivation than a personal desire to learn new technology. Honestly there is nothing more personal learning. That “change is the only constant” and “adapt & overcome” are the essential lessons of life. One cannot stop the learning and resist the change. In the IT industry “ego of knowing all” and the “resistance to change” are the most challenging issues. Once someone overcomes them, life is much easier. I believe that proper and appropriate high quality training can help to address the burning issues. Opinion of Friends I invited a few of my friends to express their opinion about developer training and here are their opinions. I am listing them here in the order of the blog post publishing date. Nakul Vachhrajani - Developer Trainings-Importance, Benefits, Tips and follow-up Nakul’s sums of many of the concepts which are complementary to my blog posts. Nakul addresses the burning question of developer training with different angles. I am personally very impressed by his following statement - “Being skilled does not mean having just a stack of certifications, but it also means having an understanding about the internals of the products that you are working on – and using that knowledge to improve the efficiency & productivity at the workplace in turn resulting in better products, better consulting abilities and a happier self.” Nakul also suggests the online training options of Pluralsight. Vinod Kumar - Training–a necessity or bonus Vinod Kumar comes up with excellent follow up on developer training. Vinod is known for his inspirational writing about SQL Server. Vinod starts with a story of a student who is extremely eager to learn the wisdom of life from a monk but the monk does not accept him as a disciple for a long time. The conversation between student and monk is indeed an essence of all learning. We all want to learn quickly and be successful but the most important thing in life is to have the right attitude towards learning and more so towards life. The blog post end with a very important thought about how to avoid the famous excuse – “I don’t have enough time.” Ritesh Shah - Training – useful or useless? Ritesh brings up very important concept related to training. Ritesh in his meticulous style explains why training is an important and lifelong process. Training must not stop at any age but should continue forever. The moment training stops, progress stops along with. Paras Doshi - Professional Development Resource Paras is known for his to–the-point writing, and has summarized the five part series very precisely. He read the five part series and created a digest summary of the blog post. If you are in a rush and have no time to read my five series – I suggest you read his blog post. Training Resources I am often asked what the best resources for learning new technology are. This is the most difficult question EVER. There are plenty of good training resources available. When it is about training our needs are different, our preference of learning is different and we all have an opinion. Additionally, we all are located in different geographic locations worldwide and there is no way one solution will fit all. However, let me list a few of the training resources which I have built so far and you can consume them if you find it relevant to your need. SQL Server Books SQL Server Interview Questions and Answers SQL Wait Stats SQL Programming Joes 2 Pros SQL Server Video Tutorials SQL Server Questions and Answers SQL Server Performance: Indexing Basics SQL Server Performance: Introduction to Query Tuning SQL in Sixty Seconds Series of Sixty Seconds Learning Video on YouTube Trust me worldwide web is very big and there are plenty of high quality learning materials available worldwide – trainer-led as well online. I suggest you explore various options and make the best choice for yourself. Remember, training is your personal journey and it should never stop. Are you ready? Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Developer Training, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • The Numerical ‘Magic’ of Cyclic Numbers

    - by Akemi Iwaya
    If you love crunching numbers or are just a fan of awesome number ‘tricks’ to impress your friends with, then you will definitely want to have a look at cyclic numbers. Dr Tony Padilla from the University of Nottingham shows how these awesome numbers work in Numberphile’s latest video. Cyclic Numbers – Numberphile [YouTube] Want to learn more about cyclic numbers? Then make sure to visit the Wikipedia page linked below! Cyclic number [Wikipedia]     

    Read the article

  • Real Life Pixar Lamp Can’t Get Enough Of Human Interaction

    - by Jason Fitzpatrick
    This curious lamp, powered by an Arduino board and servo motors, is just as playful as the on-screen counterpart that inspired its creation. The New Zealand Herald reports on the creation of the lamp, seen in action in the video above: The project is a collaborative effort by Victoria University students Shanshan Zhou, Adam Ben-Gur and Joss Doggett, who met in a Physical Computing class. The lamp’s movements are informed by a webcam with an algorithm working behind it. Robotics and facial recognition technology enable the lamp to search for faces in the images from its webcam. When it spots a face, it follows as if trying to maintain eye contact. How to Access Your Router If You Forget the Password Secure Yourself by Using Two-Step Verification on These 16 Web Services How to Fix a Stuck Pixel on an LCD Monitor

    Read the article

  • Information Indepth Newsletter - Linux Edition

    - by Paulo Folgado
    INFORMATION INDEPTH NEWSLETTERLinux Edition February 2011 Stay Connected:  NEWS Now Available: Oracle Linux 6 Get the latest release of Oracle Linux 6, which includes Unbreakable Enterprise Kernel.Download Oracle Linux 6 Read More Customers Succeed by Using Oracle Exadata with Oracle Linux Watch IT executives from Bank of America, Linkshare, and Johns Hopkins as they talk about the business challenges they faced and why they chose to use Oracle Linux along with Oracle Exadata as the solution. Watch Now Video Interview: Oracle Senior Vice President Wim Coekaerts Watch Wim Coekaerts, senior vice president, Linux and Virtualization Engineering, as he talks about use cases for Oracle VM Templates as well as the Unbreakable Enterprise Kernel for Linux.Watch Now Hot Off the Press: Migrate Your IBM AIX Environment to Oracle Linux This new white paper provides recommendations for planning and implementing the migration of applications from an IBM Power System running AIX to Oracle's Sun Fire X4800 Server with Intel Xeon 7560 Processor running Oracle Linux 5.5.Read More  Back to Top BLOGOSPHERE Just Launched: The Oracle Linux Blog Follow our new Oracle Linux blog  to hear the latest updates, product news, upcoming events, and all the latest happenings, directly from the Linux team at Oracle. Back to Top TECH DIVE NEW: Linux/Oracle Solaris CommandComparo Site from Oracle Technology NetworkThis site gives equivalent command syntax in Oracle Solaris 10 and Oracle Enterprise Linux 5 for common administrative tasks--focusing particularly on tasks that have tricky syntax or that you frequently need to double check. It acts as a quick reference for administrators who operate in these two OS environments. Free Download: Oracle Linux Release 5.6Did you know that by using Oracle Linux 5.5 or 5.6 along with the Unbreakable Enterprise Kernel, you can get all the benefits of Linux mainline kernel 2.6.32 and more, right now, without the need to reinstall or migrate to a new operating system such as RHEL6?Read Release NotesDownload Oracle Linux 5.6 LSB 4.0 Certification Completed for Oracle Linux 5.5Oracle Linux 5.5 with Unbreakable Enterprise Kernel successfully completed the LSB 4.0 certification.  Back to Top WEBCASTS Boost Your Linux Performance with Oracle's Enhancements in Infiniband and RDSRegister to hear Director of Kernel Engineering Chris Mason cover scalability and performance improvements in Linux environment. Get the Facts Oracle's Unbreakable Enterprise KernelSVP Wim Coekaerts and Senior Director Monica Kumar cover the facts about and benefits of using Unbreakable Enterprise Kernel.  View Other Webcasts on Demand   Back to Top EVENTS Collaborate 2011April 10-14 Orlando, Florida Cloud Summit Events, WorldwideVarious dates (check the city for date/time of event) Datacenter Efficiency Events WorldwideThese events include Linux and Oracle VM sessions.Various dates (check the city for date/time of event) Virtualization Events in North America Find an Oracle Event  Back to Top EDUCATION Get Oracle Linux Certified from Oracle University Oracle University offers courses in both Oracle Linux and the administration of Oracle Database on Linux.  Back to Top CUSTOMER SPOTLIGHT Pella Corporation Improves IT Performance and Efficiency with Oracle Linux and Oracle VM To improve IT performance and efficiency and lower operational costs, Pella Corporation, has standardized on Oracle VM and Oracle Linux. Read More Disney Store Deploys POS in 330 Stores and 7 Countries on Oracle Linux Disney Store is running 1,500 registers worldwide on a broad Oracle technology software stack including Oracle Database 11g, Oracle Fusion Middleware, and Oracle Linux. Read More Back to Top PARTNER SPOTLIGHT Emulex and Oracle Announce Data Integrity Features The Unbreakable Enterprise Kernel provides data integrity checking between Oracle Database applications and Emulex 8Gb/s LightPulse Fibre Channel Host Bus Adapters. Read More Dell Inc. Dell Inc. tested and validated configurations support Oracle Linux. Back to Top STAY IN TOUCH Follow @ORCL_Linux on Twitter for the latest penguin tweets Bookmark Oracle.com/Linux Read the Oracle Linux blog Back to Top  Oracle Information InDepth newsletters bring targeted news, articles, customer stories, and special offers to business people who want to find out how to streamline enterprise information management, measure results, improve business processes, and communicate a single truth to their constituents. Please send questions or comments to [email protected]. For answers to questions about subscribing, unsubscribing, and managing your Oracle e-mail communications preferences, please see the Oracle E-Mail Communications page. Copyright © 2011, Oracle Corporation and/or its affiliates. All rights reserved. Oracle is a registered trademark of Oracle Corporation and/or its affiliates. Other names may be trademarks of their respective owners. This document is provided for information purposes only, and the contents hereof are subject to change without notice. This document is not warranted to be error-free, nor is it subject to any other warranties or conditions, whether expressed orally or implied in law, including implied warranties and conditions of merchantability or fitness for a particular purpose. We specifically disclaim any liability with respect to this document, and no contractual obligations are formed either directly or indirectly by this document. This document may not be reproduced or transmitted in any form or by any means, electronic or mechanical, for any purpose, without our prior written permission. 

    Read the article

  • &ldquo;My life at Oracle&rdquo;

    - by cristian.condurache(at)oracle.com
    Hello everybody! My name is Eva and I currently work in Oracle Italy as Sales Programs Manager for the Technology Sales organization. Since 2009, I also proudly represent the Oracle Education Foundation within my country as the Ambassador for Italy. My career path in this amazing company began 5 years ago as a fresh graduate: after various years studying abroad, in Germany and Ireland mainly, I was looking for a valuable and concrete opportunity which could fulfill my energetic spirit. I wanted to develop myself inside a stimulating and “fast” business environment.. and here came Oracle and I really couldn’t ask for anything better!  THE PARTNER EXPERIENCE The first department I had the chance to work into was the Alliances and Channels organization, where I had the opportunity to join a brilliant team of great and visionary guys. I began having the responsibility to analyze and rationalize the portfolio of Oracle business partners and to identify potential cross-area solutions, which had to be highlighted both on the local market and internationally: this ended up with the implementation of the “Partner Community” model, a business environment of selected Oracle partners, specialized on the different technology focus areas. This new concept was then recognized as an EMEA Best Practice and replicated internationally. Having the opportunity to strengthen day after day strategic relationships with several business partners and study the market positioning of their technology solutions, I was given the role to develop the “Oracle Partner Network Innovation Award” in Italy: the EMEA competition encouraging and rewarding proven and successful technology innovations, creating high value for our common customers and generating new business potential. Several Italian partner solutions won different prizes and I decided that it was worth collecting all those valuable projects, winners and short-listed, inside two specific books in order also to provide them an international market visibility: OPN Innovation Award Booklet 2007 and OPN Innovation Award Booklet 2008 Inside the Alliances and Channels department I really had the opportunity to do    amazing things, like for example working side-by-side with one of the most exceptional teams in Oracle I have ever worked with: the EMEA Recruitment Team. Together, in fact, we conceived a brand new business initiative for our partners, called “Oracle Campus Joint Program”. This program was awarded as an EMEA Best Practice and acknowledged by both Italian public institutions and press media. Italy   is currently running its 5th edition.   Briefly, the “Oracle Campus Joint Program” aims at facing the growing issue of lack of  technology competences and skills on the market. By identifying a specific technology area and developing an intensive 4-6 week Oracle University training course and by collaborating with important academic institutes, international “gurus” and professionals, our business partners are able to benefit from a pool of brilliant top talented young consultants and offer them a significant career opportunity. BUSINESS BUT NOT ONLY: THE NO-PROFIT EXPERIENCE OF ORACLE Currently my mission in Oracle is to continue driving the implementation of strategic business development and sales programs for the entire Oracle Technology stack, involving both partners and the end-customers. But as a completely distinguished role from the day-today business, I’m also honored to represent in Italy the charity global organization founded by Oracle - the Oracle Education Foundation - and drive its corporate citizenship and marketing programs. Oracle Education Foundation is an independent charitable organization funded by Oracle and is dedicated to helping students develop 21st century skills through project learning and the use of technology. It provides “ThinkQuest” as a free program to primary and secondary (K12) schools. Just some significant numbers: today 548,000 students/teachers in 47 countries use ThinkQuest and the Oracle Education Foundation partners with 40+ no-profit or government organizations globally. ABOUT MYSELF AND MY INTERESTS About myself…I’m very enthusiastic and positive, trying always to transform difficult issues in challenging opportunities. My day usually begins very early in the morning with running, swimming or when I need to collect some “zen” energies with a yoga session or better with a long walk with my dog. I definitely love animals and generally speaking I’m very keen on environmental issues and try, as much as I can, to carry out a healthy and “planet respectful” lifestyle. My thirst for knowledge pushed me some time ago to begin a new personal challenge: I decided to enroll, dedicating a good part of my free time, for a second university degree: I chose “Neuroeconomics”, an innovative academic path which combines psychology, economics, and neuroscience and studies how people make decisions and the role of the brain when people evaluate these decisions, categorizing risks and rewards and generally interacting with each other. I’ve been very glad to talk about my experience in this article, as working for Oracle is something very stimulating. This company ensures you the opportunity to face new challenges, work with highly talented people and be professionally highlighted also globally. Motivation, good results and innovation is always pursued, recognized and fully supported. Thanks and wish you all an amazing career! If you have any question please contact [email protected]. For our job opportunities, please look at http://campus.oracle.com.   Technorati Tags: EMEA,Oracle Partners,Oracle Campus,Oracle Education,experience,EMEA Recruitment Team

    Read the article

  • what, why, when, should I learn computer science?

    - by dramasea
    I'm 16 years old and really an enthusiast on web programming. I know (X)HTML, css, javascript and php. And i heard about computer science. Below are my question: What is computer science? Should a web programmer learn computer science? If the answer of question 2 is yes, then what programming language(s) should I learn before I get into computer science (I saw the video of 'Introduction to computer science' which is one of the MIT opencourse and it started to use python without teaching you from scratch.) Can I learn computer science now? (Without a university degree, I can watch open courseware.)

    Read the article

  • SQL SERVER – Extending SQL Azure with Azure worker role – Guest Post by Paras Doshi

    - by pinaldave
    This is guest post by Paras Doshi. Paras Doshi is a research Intern at SolidQ.com and a Microsoft student partner. He is currently working in the domain of SQL Azure. SQL Azure is nothing but a SQL server in the cloud. SQL Azure provides benefits such as on demand rapid provisioning, cost-effective scalability, high availability and reduced management overhead. To see an introduction on SQL Azure, check out the post by Pinal here In this article, we are going to discuss how to extend SQL Azure with the Azure worker role. In other words, we will attempt to write a custom code and host it in the Azure worker role; the aim is to add some features that are not available with SQL Azure currently or features that need to be customized for flexibility. This way we extend the SQL Azure capability by building some solutions that run on Azure as worker roles. To understand Azure worker role, think of it as a windows service in cloud. Azure worker role can perform background processes, and to handle processes such as synchronization and backup, it becomes our ideal tool. First, we will focus on writing a worker role code that synchronizes SQL Azure databases. Before we do so, let’s see some scenarios in which synchronization between SQL Azure databases is beneficial: scaling out access over multiple databases enables us to handle workload efficiently As of now, SQL Azure database can be hosted in one of any six datacenters. By synchronizing databases located in different data centers, one can extend the data by enabling access to geographically distributed data Let us see some scenarios in which SQL server to SQL Azure database synchronization is beneficial To backup SQL Azure database on local infrastructure Rather than investing in local infrastructure for increased workloads, such workloads could be handled by cloud Ability to extend data to different datacenters located across the world to enable efficient data access from remote locations Now, let us develop cloud-based app that synchronizes SQL Azure databases. For an Introduction to developing cloud based apps, click here Now, in this article, I aim to provide a bird’s eye view of how a code that synchronizes SQL Azure databases look like and then list resources that can help you develop the solution from scratch. Now, if you newly add a worker role to the cloud-based project, this is how the code will look like. (Note: I have added comments to the skeleton code to point out the modifications that will be required in the code to carry out the SQL Azure synchronization. Note the placement of Setup() and Sync() function.) Click here (http://parasdoshi1989.files.wordpress.com/2011/06/code-snippet-1-for-extending-sql-azure-with-azure-worker-role1.pdf ) Enabling SQL Azure databases synchronization through sync framework is a two-step process. In the first step, the database is provisioned and sync framework creates tracking tables, stored procedures, triggers, and tables to store metadata to enable synchronization. This is one time step. The code for the same is put in the setup() function which is called once when the worker role starts. Now, the second step is continuous (or on demand) synchronization of SQL Azure databases by propagating changes between databases. This is done on a continuous basis by calling the sync() function in the while loop. The code logic to synchronize changes between SQL Azure databases should be put in the sync() function. Discussing the coding part step by step is out of the scope of this article. Therefore, let me suggest you a resource, which is given here. Also, note that before you start developing the code, you will need to install SYNC framework 2.1 SDK (download here). Further, you will reference some libraries before you start coding. Details regarding the same are available in the article that I just pointed to. You will be charged for data transfers if the databases are not in the same datacenter. For pricing information, go here Currently, a tool named DATA SYNC, which is built on top of sync framework, is available in CTP that allows SQL Azure <-> SQL server and SQL Azure <-> SQL Azure synchronization (without writing single line of code); however, in some cases, the custom code shown in this blogpost provides flexibility that is not available with Data SYNC. For instance, filtering is not supported in the SQL Azure DATA SYNC CTP2; if you wish to have such a functionality now, then you have the option of developing a custom code using SYNC Framework. Now, this code can be easily extended to synchronize at some schedule. Let us say we want the databases to get synchronized every day at 10:00 pm. This is what the code will look like now: (http://parasdoshi1989.files.wordpress.com/2011/06/code-snippet-2-for-extending-sql-azure-with-azure-worker-role.pdf) Don’t you think that by writing such a code, we are imitating the functionality provided by the SQL server agent for a SQL server? Think about it. We are scheduling our administrative task by writing custom code – in other words, we have developed a “Light weight SQL server agent for SQL Azure!” Since the SQL server agent is not currently available in cloud, we have developed a solution that enables us to schedule tasks, and thus we have extended SQL Azure with the Azure worker role! Now if you wish to track jobs, you can do so by storing this data in SQL Azure (or Azure tables). The reason is that Windows Azure is a stateless platform, and we will need to store the state of the job ourselves and the choice that you have is SQL Azure or Azure tables. Note that this solution requires custom code and also it is not UI driven; however, for now, it can act as a temporary solution until SQL server agent is made available in the cloud. Moreover, this solution does not encompass functionalities that a SQL server agent provides, but it does open up an interesting avenue to schedule some of the tasks such as backup and synchronization of SQL Azure databases by writing some custom code in the Azure worker role. Now, let us see one more possibility – i.e., running BCP through a worker role in Azure-hosted services and then uploading the backup files either locally or on blobs. If you upload it locally, then consider the data transfer cost. If you upload it to blobs residing in the same datacenter, then no transfer cost applies but the cost on blob size applies. So, before choosing the option, you need to evaluate your preferences keeping the cost associated with each option in mind. In this article, I have shown that Azure worker role solution could be developed to synchronize SQL Azure databases. Moreover, a light-weight SQL server agent for SQL Azure can be developed. Also we discussed the possibility of running BCP through a worker role in Azure-hosted services for backing up our precious SQL Azure data. Thus, we can extend SQL Azure with the Azure worker role. But remember: you will be charged for running Azure worker roles. So at the end of the day, you need to ask – am I willing to build a custom code and pay money to achieve this functionality? I hope you found this blog post interesting. If you have any questions/feedback, you can comment below or you can mail me at Paras[at]student-partners[dot]com Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: Pinal Dave, PostADay, SQL, SQL Authority, SQL Azure, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Donald Farmer comes to SQLBits

    What do medieval archaeology, fish farming, Southwestern University of Chongqing and Microsoft Business Intelligence have in common? If you know, you should tell Donald Farmer, because he has been deeply involved in all of them at various times. Donald has worked in the Microsoft Business Intelligence team for 8 years covering many subject areas: data integration, information quality, metadata intelligence, master data management, OLAP, predictive analytics and self-service BI. He is a well-known speaker at Microsoft and other industry events, and the author of several books and articles.   Great news from SQLBits! We can now confirm that Donald Farmer has agreed to do a pre-conference training day and the key note for our SQL Server 2008 and SQL Server 2008 R2 day. As Program Manager for Project Gemini, no-one is better placed to tell you what is going to be in R2 and what is not! More information about the Pre-conference Training Day and SQL 2008 and R2 Friday will be released soon.

    Read the article

  • I’m 99% confident that where you are matters

    - by ktegels
    It really has been a long time since I posted anything ofvalue here. Yes, a lot of that is by my own choice and some of you might bewondering if I’ve given up on SQL Server. No, haven’t, it remains a vital toolfor me. But I have become more of user of the product in last couple of yearsrather than somebody who is “internals guru.” To be frank, going from technicaltrainer to University professor has had a lot to do with that. I tend to caremuch less now about squeezing cycles out of execution times...(read more)

    Read the article

  • BI&EPM in Focus June 2014

    - by Mike.Hallett(at)Oracle-BI&EPM
    Applications Webcast Centre – A Library of Discussion and Research for Best Practice: Achieving Reliable Planning, Budgeting and Forecasting Talent Analytics and Big Data – Is HR ready for the challenge Enterprise Data – The cost of non-quality Customers Josephine Niemiec from ADP talks about Oracle Hyperion Workforce Planning at Collaborate 2014 (link) Video Chris Nelms from Ameren talks about Oracle BI Spend and Procurement Analytics at Collaborate 2014 (link) Video Leggett & Platt Leverages Oracle Hyperion EPM and Demantra (link) Video Pella Corporation Accelerates Close Cycle by Cutting Time for Financial Consolidation from Three Days to Less Than One Day (link) Secretaría General de Administración de Justicia en España Enhances Citizen Services with Near-Real-Time Business Intelligence Gleaned from 500 Databases  (link) Bellco Credit Union Speeds Budget Development by 30%—Gains Insight into Specific Branch and Financial Product Profitability  (link)  Video QDQ media Speeds up Financial Reporting by 24x, Gains Business Agility, and Integrates Seamlessly into Corporate Accounting System  (link) Westfield Group Maximizes Shopping Mall Revenue, Shortens Year-End Financial Consolidation by 75%  (link)  IL&FS Transportation Networks Shortens Financial Consolidation and Reporting Cycle by Eight Days, Gains In-Depth Insight into Business Performance   (link) Angel Trains Optimizes Rail Operations for Purchasing, Sourcing, and Project Management to Meet Challenges of Evolving Rail Industry  (link) Enterprise Performance Management June 11, at Oracle Utrecht, NL: Morning session: Explore Planning and Budgeting in the Cloud (link) June 12, London: PureApps Presents: Best Practice Financial Consolidation and Reporting Workshop (link) July 3, Koln: Oracle Hyperion Business Analytics Roundtable (link) Blog: What's Your Tax Strategy? Automate the Operational Transfer Pricing Process (link) YouTube Video: Automate Tax Reporting with Oracle Hyperion Tax Provision (link) YouTube Video: Introducing Oracle Hyperion Planning’s Tablet Optimized Interface (link) OracleEPMWebcasts @ YouTube (link) Partner webcasts: Wednesday, 4 June, 5.00 GMT - Case Study:  Lessons Learned from Edgewater Ranzal's Internal Implementation of Oracle Planning & Budgeting Cloud Service (PBCS) - Learn more and register here! Thursday, 5 June, 4.00 GMT - Achieving Accountable Care Using Oracle Technology - Learn more and register here! Tuesday, 17 June, 4.00 GMT - Optimizing Performance for Oracle EPM Systems - Learn more and register here! Oracle University Blog: The Coolest Features Available with Oracle Hyperion 11.1.2.3 – Training from OU to help you to best use them (link) Support: Proactive Support: EPM Hyperion Planning 11.1.2.3.500 Using RMI Service [Blog] Proactive Support: Planning and Budgeting Cloud Service Videos (link) Planning and Budgeting Cloud Service (PBCS) 11.1.2.3.410 Patch Bundle [Doc ID 1670981.1] Hyperion Analytic Provider Services 11.1.2.2.106 Patch Set Update [Doc ID 1667350.1] Hyperion Essbase 11.1.2.2.106 Patch Set Update [Doc ID 1667346.1] Hyperion Essbase Administration Services 11.1.2.2.106 Patch Set Update [Doc ID 1667348.1] Hyperion Essbase Studio 11.1.2.2.106 Patch Set Update [Doc ID 1667329.1] Hyperion Smart View 11.1.2.5.210 Patch Set Update [Doc ID 1669427.1] Using HPCM, HSF or DRM Communities (link) Business Intelligence June 12, Birmingham, UK: Oracle Big Data at Work - Use Cases and Architecture (link) June 17, London: Oracle at Cloud & Big Data World Forums (link) June 17, Partner Webcast: Transform your Planning Capabilities with Peloton's CloudAccelerator for Oracle PBCS (link) June 19, London: Oracle at the Whitehall Media Big Data Analytics Conference and Exhibition (link) June 19, London: Partner Event - Agile BI Conference by Peak Indicators [link] June 25, Munich: Oracle Special Day auf der TDWI 2014 Konferenz (link) July 15, London: Oracle Endeca Information Discovery Workshop (link) July 16, London: BI Applications Workshop – Financial Analytics & Procurement Analytics (link) July 17, London: BI Applications Workshop – HR Analytics (link) Milan, Italy: L’Osservatorio Big Data Analytics & Business Intelligence with Politecnico di Milano (link) OBIA 11.1.1.8.1 - Now Available [Blog] What’s New in OBIA 11.1.1.8.1 [Blog] BI Blog: A closer look at Oracle BI Applications 11.1.1.8.1 release (link) Press Release: BI Applications Deliver Greater Insight into Talent and Procurement (link) Support Blog: OBIA 11.1.1.8.1 Upgrade Guide & Documentation (link) YouTube Video: Glenn Hoormann of Ludus talks to us about Oracle Business Intelligence and ERP at Collaborate 2014 (Link) YouTube Video: Performance Architects talks about key BI and Mobile trends, including Endeca at Collaborate 2014 (link) Big Data Blog: 3 Keys for Using Big Data Effectively for Enhanced Customer Experience (link) Big Data Lite Demo VM 3.0 Now Available on OTN BI Blog: Data Relationship Governance - Workflow in a Bottle (link) MDM Blog: Register for Product Data Management Weekly Cloudcasts (link) MDM Blog: Improve your Customer Experience with High Quality Information (link) MDM Blog: Big Data Challenges & Considerations (link) Oracle University: Oracle BI Applications 11g: Implementation using ODI (link) Proactive Support: Monthly Index [Blog] My Oracle Support: Partner Accreditation for Business Analytics Support [Blog] OBIEE 11g Test-to-Production (T2P) / Clone Procedures Guide [Blog] Normal 0 false false false EN-GB X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • what, why, when, should I learn computer science?

    - by dramasea
    I'm 16 years old and really an enthusiast on web programming. I know (X)HTML, css, javascript and php. And i heard about computer science. Below are my question: What is computer science is? Should a web programmer learn computer science? If the answer of question 2 is yes, then what programming language should i learn before i get into computer science(I saw the video of 'Introduction to computer science' which is one of the MIT opencourse and it started to use python without teaching u from scratch) Can I learn computer science now?(Without a university degree, i can watch opencourseware)

    Read the article

  • How to test a 3D rendering engine?

    - by YoYo
    Me and some friends developing simple 3D rendering engine as practice for the university. We used Ogre 3d as prototype and now we are developing it from base The engine is wrapped up in simple game that asks the user to select shape (circle, triangle, square...), color and dimensions and renders the image to the screen. It also enables to move and rotate the shape on screen using mouse. We would like to test automate the view rendering. I could not find any test framework for this issue and I would like to know how 3D test is done in non manual matter

    Read the article

  • Trying to find video of a talk on the impact of memory access latency

    - by user12889
    Some months ago I stumbled across a video on the internet of somebody giving a very good talk on the impact of memory access latency on the execution of programs. I'm trying to find the video again; maybe you know what video I mean and were I can find it. This is what I remember about the talk/video: I don't remember the title and it may have been broader, but the talk was a lot about impact of memory access latency in modern processors on program execution. The talk was in English and most likely the location was in America. The speaker was very knowledgeable about the topic, but the talk was in an informal setting (not a conference presentation or university lecture). I think the speaker was known to the audience and may even have been famous (I don't remember) The audience may have been a computer club / group of a local community or company (but I don't remember for sure)

    Read the article

  • Best practices when creating/modeling databases?

    - by Oscar Mederos
    I learned at the University some steps to model a database: Model the problem using the Extended Entity-Relationship Model. Extract the functional dependencies Apply some algorithms to normalize the database (3NF or Boyce-Codd) Create the database I'm studying Computer Science and since I received that course I'm wondering if I always need to do those steps when creating a complex database for an specified problem. For example, do PHP / .NET / .. programmers always do that? or there are some tools to simplify that process, maybe using another way of represent the problem instead of the EERM?

    Read the article

  • How one does qualify as a Web UI Developer?

    - by Duralumin
    I have about 20 years of experience with programming, most of that on the job, and right now, I define myself as a Web Developer, because I think about half my expertise lies in the all too extended "web" field, both server side and client side, and because in the last years I'm mostly doing web development. I know my javascript, jQuery, jQueryUI, HTML4-5, css2-3 and some frameworks like backbone.js and angularJS Since university I've always been interested in Man-Machine Interaction, UI and UX. Recently, I saw the label "Web UI Developer" tossed around, and I thought that would be something I would like to qualify for. And I'd really like to qualify with confidence. I didn't find any certificate or similar, and I don't think there are any. Is the only way to qualify as a Web UI Developer having a job as one? What are the skills I need to have, and the resources I can use to acquire them?

    Read the article

  • Software jobs after dropping out of masters degree

    - by Bampesh
    I am right now doing my masters in EE in the US, and have previously worked for a couple years in the telecom industry back home in India. I came here wanting to transfer to CS, but at my current university, with my GPA, that seems not very possible. I am not very interested in EE, so I am thinking of dropping out of the program. If I could demonstrate my abilities and experience, would software companies be willing to hire me in the US for my previous experience (with a half completed masters degree). Or would lack of the degree be a huge hindrance? Any suggestions? Thanks

    Read the article

  • Podcast interview with Michael Kane

    - by mhornick
    In this podcast interview with Michael Kane, Data Scientist and Associate Researcher at Yale University, Michael discusses the R statistical programming language, computational challenges associated with big data, and two projects involving data analysis he conducted on the stock market "flash crash" of May 6, 2010, and the tracking of transportation routes bird flu H5N1. Michael also worked with Oracle on Oracle R Enterprise, a component of the Advanced Analytics option to Oracle Database Enterprise Edition. In the closing segment of the interview, Michael comments on the relationship between the data analyst and the database administrator and how Oracle R Enterprise provides secure data management, transparent access to data, and improved performance to facilitate this relationship. Listen now...

    Read the article

  • Sun2Oracle: Hub City Media Webcast Reminder - Thursday, September 13, 2012

    - by Darin Pendergraft
    Our Sun2Oracle webcast featuring Steve Giovanetti from Hub City Media is this Thursday, September 13th at 10:00 am PST.  If you haven't registered yet, there is still time: Register Here. Scott Bonell, Sr. Director of Product Management will be talking to Steve about their recent project to upgrade a large University from Sun DSEE Directory to Oracle Unified Directory.  Scott and Steve will talk through details of the project, from planning through implementation. In addition to this webcast, Steve Giovanetti will also be participating in two sessions at Oracle OpenWorld 2012: CON9465 - Next-Generation Directory: Oracle Unified Directory  Etienne Remillon, Principal Product Manager, Oracle  Steve Giovanetti, CTO Hub City Media  Warren Leung, Sr. Architect, UCLA  Tuesday, Oct 2, 5:00 PM – 6:00 PM  Moscone West – 3008 CON5749 - Solutions for Migration of Oracle Waveset to Oracle Identity Manager Steve Giovanetti, CTO Hub City Media Kevin Moulton, Senior Sales Consulting  Manager, Oracle Thursday, Oct 4, 11:15 AM - 12:15 PM Moscone West - 3008

    Read the article

< Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >