Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 565/2372 | < Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >

  • Learning Objective-C 2.0 and ASP.NET 4.0 simultaneously?

    - by Sahat
    (HOBBY) I own a Macbook Pro and iPod Touch so developing iPhone/iPod/iPad apps seems like a logical thing to do in order to get some experience in the programming field. Besides I want to write a new application similar to the Capsuleer (Character skills monitor app for EVE Online MMO) but with more features. It's something I'd love to have on my own iPod Touch and I am sure other people will welcome a new EVE Online app for their iPhone or iPod Touch. (CAREER) I want to learn ASP.NET (and possibly Silverlight later on) for my potential future job. I plan to work in the .NET field, so it's a good idea for me to start learning C# and ASP.NET ASAP. Is it a good idea to learn completely unrelated technologies at the same time? Or would it be better to learn one thing at a time? Objective-C first, and ASP.NET second. Or vice versa. Thanks, Sahat

    Read the article

  • expand a varchar column very slowly , why?

    - by francs
    Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

    Read the article

  • Mac OS X 10.5+ and POSIX

    - by Phil
    Hello, I need to program an authentication module that has to work with Mac OS X 10.6 Snow Leopard and at the same time needs to be POSIX-compliant. I read here: developer.apple.com/leopard/overview/osfoundations.html that since Mac OS X 10.5 Leopard, Mac OS X is POSIX-compliant (to POSIX 1003.1), but working under MAC OS X 10.5 Leopard myself, I can't find any trace of my user name neither in /etc/passwd nor in its successor /etc/master.passwd, which is mentioned here: developer.apple.com/mac/library/DOCUMENTATION/Darwin/Reference/ManPages/man5/passwd.5.html Instead it says in both files OpenDirectory Service is used, which should be OpenLDAP according to the OpenDirectoryService man-page. Is this still POSIX-compliant ? I guess not. I wonder how Mac OS X would handle my 100% POSIX-compliant code which depends on /etc/passwd ? I would be gratefull if someone could explain the way this works to me. Thank you for your time and trouble. Best regards Phil.

    Read the article

  • Does this Maven plugin really have an invalid descriptor?

    - by ovr
    COMMAND: mvn org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-4:generate -DarchetypeGroupId=org.beardedgeeks -DarchetypeArtifactId =gae-eclipse-maven-archetype -DarchetypeVersion=1.1.2 -DarchetypeRepository=http://beardedgeeks.googlecode.com/svn/repository/release s OUTPUT: [INFO] Scanning for projects... [INFO] ------------------------------------------------------------------------ [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] Internal error in the plugin manager getting plugin 'org.apache.maven.plugins:maven-archetype-plugin': Plugin 'org.apache.maven .plugins:maven-archetype-plugin:2.0-alpha-4' has an invalid descriptor: 1) Plugin's descriptor contains the wrong group ID: net.kindleit 2) Plugin's descriptor contains the wrong artifact ID: maven-gae-plugin 3) Plugin's descriptor contains the wrong version: 0.5.9 [INFO] ------------------------------------------------------------------------ [INFO] For more information, run Maven with the -e switch [INFO] ------------------------------------------------------------------------ [INFO] Total time: < 1 second [INFO] Finished at: Wed Jun 09 20:48:35 CEST 2010 [INFO] Final Memory: 3M/15M [INFO] ------------------------------------------------------------------------ I have a hard time believing this Maven plugin has an invalid descriptor since other people seem to be using it with no problem. Am I doing something wrong?

    Read the article

  • Which has been the most reliable, fastest Windows C++ profiler that you have used?

    - by carleeto
    I need to profile a real time C++ app on Windows. Most of the available profilers are either terribly expensive, total overkill, or both. I don't need any .NET stuff. Since it is a real time app, I need the profiler to be as fast as possible. It would be excellent if it integrated in some way with Visual Studio 2005/2008, but that's not necessary. If this description reminds you of a profiler that you have used, I would really like to know about it. I am hoping to draw from people's use of C++ profilers on Windows to pinpoint one that will do the job. Thanks.

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Remove items from SWT tables

    - by Dima
    This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

    Read the article

  • Understanding the passing of data/life of a script in web development/CodeIgniter

    - by Pete Jodo
    I hope I worded the title accurately enough but I typically use Java and don't have much experience in Web Development/PHP/CodeIgniter. I have a difficult time understanding the life cycle of a script as I found out trying to implement a certain feature to a website I am developing (as a means of learning how to). I'll first describe the feature I tried implementing and then the problem I ran into that made me question my fundamental understanding of how scripts work since I'm used to typical OOP. Ok so here goes... I have a webpage that has 2 basic tasks a user can do, create and delete an entry. What I attempted to implement was a way to time a user how long it takes them to complete a certain task. The way I did this was have a homepage where there would be a list of tasks a user to choose from (in this case 2, create and delete). A user would click a task which would link to the 'true' homepage where the user then would be expected to complete the task. My script looks like this: <?php class Site extends CI_Controller { var $task1; var $tasks = array( "task1" => NULL, "date1" => 0, "date2" => 0, "diff" => 0); function __construct() { parent::__construct(); include 'timetask.php'; $this->task1 = new TimeTask("create"); } function index() { $this->tasks['task1'] = $this->task1->getTask(); $this->tasks['diff'] = $this->task1->getTimeDiff(); if($this->tasks['diff'] == NULL) { $this->tasks['diff'] = 0; } $this->load->view('usability_test', $this->tasks); } function origIndex() { $this->task1->setDate1(new DateTime()); $this->tasks['date1'] = $this->task1->getDate1()->getTimestamp(); $data = array(); if($q = $this->site_model->get_records()) { $data['records'] = $q; } $this->load->view('options_view', $data); } function create() { $this->task1->setDate2(new DateTime()); $this->tasks['date2'] = $this->task1->getDate2()->getTimestamp(); $data = array( 'author' => $this->input->post('author'), 'title' => $this->input->post('title'), 'contents' => $this->input->post('contents') ); $this->site_model->add_record($data); $this->index(); } I only included create to keep it short. Then I also have the TimeTask class, that actually another StackOverflow so kindly helped me with: <?php class TimeTask { private $task; /** * @var DateTime */ private $date1, $date2; function __construct($currTask) { $this->task = $currTask; } public function getTimeDiff() { $hasDiff = $this->date1 && $this->date2; if ($hasDiff) { return $this->date2->getTimestamp() - $this->date1->getTimestamp(); } else { return NULL; } } public function __toString() { return (string) $this->getTimeDiff(); } /** * @return \DateTime */ public function getDate1() { return $this->date1; } /** * @param \DateTime $date1 */ public function setDate1(DateTime $date1) { $this->date1 = $date1; } /** * @return \DateTime */ public function getDate2() { return $this->date2; } /** * @param \DateTime $date2 */ public function setDate2(DateTime $date2) { $this->date2 = $date2; } /** * @return get current task */ public function getTask() { return $this->task; } } ?> I don't think posting the views is necessary for the question but here is atleast how the links are made. ...and... id", $row-title); ? Now there's no error in the code but it doesn't do what I expect of it and the reason I assume why is because that each time a function of the script is called via a new page it is NOT the same instance of the script called previously so any previously created objects are no longer there. This confuses me and leaves me quite unsure of how to implement this gracefully. Some ways I would guess of how to do this is by passing the necessary data through the URL or have data saved in a database and retrieve it later to compare the times. What would be a recommended way to do, not just this, but anything that needs previously created data? Also, am I correct to think that a script is only 'alive' for one webpage at a time? Thanks!

    Read the article

  • Implementing a multi-state planner

    - by MoominTroll
    I've been asked to develop a system wherein employees can mark on a form their availability on a given day of the week - for instance an employee could mark themselves as available on a given time on a given week, and unavailable on some other time. It looks a little like this: Currently this works by rendering checkboxes within the table, picking up click events in each cell and marking the checkbox and hence the cell appropriately. I'm using the JQuery "click n drag checkbox" plugin from here. However, I've been informed that there could well be more than two states for a given cell (for instance available, unavailable, available in a given circumstance), in which case binding to a checkboxes checked value isnt going to be a lot of help. I've never used javascript or asp.net before and am unsure as to the best way to approach this problem. Ideally I could stick a data structure behind each cell which I could update to a certain state and then get my cell colour by binding to this - however I'm at something as a loss as how to best achieve this.

    Read the article

  • Windows Service suddenly doing nothing

    - by TB
    Hi, My windows service is using a Thread (not a timer) which is always looping and sleeps for 1 second every loop using : evet.WaitOne(interval); When I start the service it works fine and I can see in the task manager that it is running, consuming and releasing memory, consuming processor ... etc that is all normal, but after a while (random amount of time) the service simply stops!! it is still there in the task manager but it is not consuming any processor work now and its consumption to the memory is not changing. it simply (died but still there in the task manager like a Zombie). I know that many exceptions might have happened during running the service (it is really doing many things) but all those exceptions are handled in Try catch blocks, so why is my "always looping" thread stops ??? This thread also logs every time he loops, when he is freezig in this way he is not logging anything (of course)

    Read the article

  • Is ReaderWriterLockSlim.EnterUpgradeableReadLock() essentially the same as Monitor.Enter()?

    - by Neil Barnwell
    So I have a situation where I may have many, many reads and only the occasional write to a resource shared between multiple threads. A long time ago I read about ReaderWriterLock, and have read about ReaderWriterGate which attempts to mitigate the issue where many writes coming in trump reads and hurt performance. However, now I've become aware of ReaderWriterLockSlim... From the docs, I believe that there can only be one thread in "upgradeable mode" at any one time. In a situation where the only access I'm using is EnterUpgradeableReadLock() (which is appropriate for my scenario) then is there much difference to just sticking with lock(){}? Here's the excerpt: A thread that tries to enter upgradeable mode blocks if there is already a thread in upgradeable mode, if there are threads waiting to enter write mode, or if there is a single thread in write mode. Or, does the recursion policy make any difference to this?

    Read the article

  • CALayer: callback when animation ends?

    - by carloe
    Hi All, I have been running into some issues with animating multiple CALayers at the same time, and was hoping someone could point me in the right direction. My app contains an array of CALayer. The position of each layer is set to (previousLayer.position.y + previousLayer.bounds.height), which basically lays them out similar to a table. I then have a method that, every-time it is called, adds a new layer to the stack and sets its Y position is set to 0. The Y positions of all other layers in the array are then offset by the height of the new layer (essentially pushing all old layers down). What I am having problems with is preventing the adding of new layers until the previous animation has completed. Is there a way to tell when an implicit animation has finished? Or alternatively, if I use CABasicAnimation and animationDidFinish, is there a way to tell which object finished animating when animationDidFinish is called?

    Read the article

  • Keeping DB Table sorted using multi-field formula (Microsoft SQL)

    - by user298167
    Hello Everybody. I have a Job Table which has two interesting columns: Creation Date and Importance (high - 3, medium 2, low - 1). Job's priority calculated like this: Priority = Importance * (time passed since creation). The problem is, Every time I would like to pick 200 jobs with highest priority, I dont want to resort the table. Is there a way to keep rows sorted? I was also thinking about having three tables one for High, Medium and Low and then sort those by Creation Date. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • The case against Maven?

    - by Asgeir S. Nilsen
    Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

    Read the article

  • prevent race condition without using locks C++

    - by Hristo
    How do I prevent a race condition with locking or using mutexes/semaphors in C++? I'm dealing with a nested for loop in which I will be setting a value in an array: for (int i = 0; i < m; ++i) for (int j = 0; j < n; ++j) for (int k = 0; k < o; ++k) array[k] += foo(...); More or less, I want to deal with this so that I can ensure different threads running at the same time don't write to array[k] at the same time. Any suggestions on how to approach this? Thanks, Hristo

    Read the article

  • Python json memory bloat

    - by Anoop
    import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

    Read the article

  • How to Create VBA Add-In with Shared Codes for All Excels?

    - by StanFish
    I'm writing VBA codes for multiple Excel spreadsheets, which will be shared with others from time to time. At some point I find there are lots of duplications in my works. So I want to find a way to share codes in a sort of Excel add-in, like the .xla file. But when I tried to save the Excel file containing shared codes as .xla file, I got some problems: The file cannot be edit anymore after I save it in the default add-in folder If I move the .xls file to a folder other than the add-in folder, and open it directly - I cannot use its classes - which creates problems for sharing the codes Any ideas to create add-ins in a flexible and powerful way please? Thanks a lot for the help

    Read the article

  • How to solve High Load average issue in Linux systems?

    - by RoCkStUnNeRs
    The following is the different load with cpu time in different time limit . The below output has parsed from the top command. TIME LOAD US SY NICE ID WA HI SI ST 12:02:27 208.28 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:23:22 195.48 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:34:55 199.15 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 13:41:50 203.66 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st 13:42:58 278.63 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st Following is the additional Information of the system? cat /proc/cpuinfo processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 0 cpu cores : 4 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4658.69 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 1 cpu cores : 4 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 2 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 2 cpu cores : 4 apicid : 2 initial apicid : 2 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 3 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 3 cpu cores : 4 apicid : 3 initial apicid : 3 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4654.99 clflush size : 64 power management: Memory: total used free shared buffers cached Mem: 2 1 1 0 0 0 Swap: 5 0 5 let me know why the system is getting abnormally this much high load?

    Read the article

  • Marker on Google Map added only once.

    - by Vafello
    I have the following code: function clicked(overlay, latlng) { var icon3 = new GIcon(); icon3.image = "marker.png"; icon3.iconAnchor = new GPoint(15, 40); var marker2 = new GMarker(latlng, { icon: icon3, draggable: true, title: 'Drag me' }); map.addOverlay(marker2); } Each time I click on the map a new marker is placed on the map. The problem is that I need only one marker and if I click several times, each time a new marker is added. How to change the code so only one marker is placed and when the map is clicked again it just changes its location?

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • ASP.NET MVC: Is is possible to set a global variable?

    - by Sergio
    Hello, I have a process within my MVC 2 application that takes a large amount of time and alters many rows in the database in the process. There is a chance that two or more users could attempt to perform this action at the same time, which would lead to undesirable effects. Is there a way to set a global flag somewhere within asp.net that I can check against all requests to see if the action in question is currently being executed? (a bit that I flip prior to running query, and then then flip back on completition) Or is there a better way of handling this situation? Thanks

    Read the article

  • Can I Import an updated structure into a MySQL table without losing its current content?

    - by Udi Wertheimer
    We use MySQL tables to which we add new fields from time to time as our product evolves. I'm looking for a way to export the structure of the table from one copy of the db, to another, without erasing the contents of the table I'm importing to. For example say I have copies A and B of a table, and I add fields X,Y,Z to table A. Is there a way to copy the changed structure (fields X,Y,Z) to table B while keeping its content intact? I tried to use mysqldump, but it seems I can only copy the whole table with its content, overriding the old one, or I can use the "-d" flag to avoid copying data (dumping structure only), but this will create an empty table when imported, again overriding old data. Is there any way to do what I need with mysqldump, or some other tool?

    Read the article

< Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >