Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 565/2372 | < Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >

• How to handle environment-specific application configuration organization-wide?

  - by Stuart Lange

  Problem Your organization has many separate applications, some of which interact with each other (to form "systems"). You need to deploy these applications to separate environments to facilitate staged testing (for example, DEV, QA, UAT, PROD). A given application needs to be configured slightly differently in each environment (each environment has a separate database, for example). You want this re-configuration to be handled by some sort of automated mechanism so that your release managers don't have to manually configure each application every time it is deployed to a different environment. Desired Features I would like to design an organization-wide configuration solution with the following properties (ideally): Supports "one click" deployments (only the environment needs to be specified, and no manual re-configuration during/after deployment should be necessary). There should be a single "system of record" where a shared environment-dependent property is specified (such as a database connection string that is shared by many applications). Supports re-configuration of deployed applications (in the event that an environment-specific property needs to change), ideally without requiring a re-deployment of the application. Allows an application to be run on the same machine, but in different environments (run a PROD instance and a DEV instance simultaneously). Possible Solutions I see two basic directions in which a solution could go: Make all applications "environment aware". You would pass the environment name (DEV, QA, etc) at the command line to the app, and then the app is "smart" enough to figure out the environment-specific configuration values at run-time. The app could fetch the values from flat files deployed along with the app, or from a central configuration service. Applications are not "smart" as they are in #1, and simply fetch configuration by property name from config files deployed with the app. The values of these properties are injected into the config files at deploy-time by the install program/script. That install script takes the environment name and fetches all relevant configuration values from a central configuration service. Question How would/have you achieved a configuration solution that solves these problems and supports these desired features? Am I on target with the two possible solutions? Do you have a preference between those solutions? Also, please feel free to tell me that I'm thinking about the problem all wrong. Any feedback would be greatly appreciated.

  Read the article

• Mac OS X 10.5+ and POSIX

  - by Phil

  Hello, I need to program an authentication module that has to work with Mac OS X 10.6 Snow Leopard and at the same time needs to be POSIX-compliant. I read here: developer.apple.com/leopard/overview/osfoundations.html that since Mac OS X 10.5 Leopard, Mac OS X is POSIX-compliant (to POSIX 1003.1), but working under MAC OS X 10.5 Leopard myself, I can't find any trace of my user name neither in /etc/passwd nor in its successor /etc/master.passwd, which is mentioned here: developer.apple.com/mac/library/DOCUMENTATION/Darwin/Reference/ManPages/man5/passwd.5.html Instead it says in both files OpenDirectory Service is used, which should be OpenLDAP according to the OpenDirectoryService man-page. Is this still POSIX-compliant ? I guess not. I wonder how Mac OS X would handle my 100% POSIX-compliant code which depends on /etc/passwd ? I would be gratefull if someone could explain the way this works to me. Thank you for your time and trouble. Best regards Phil.

  Read the article

• How do i stop the android garbage collector? Is it possible?

  - by Sponge

  Is there any way to stop the garbage collector for some time?

  Read the article

• How do I make a class whose interface matches double, but upon which templates can be specialized?

  - by Neil G

  How do I make a class whose interface matches double, but whose templated types do not dynamic cast to double? The reason is that I have a run-time type system, and I want to be able to have a type that works just like double: template<int min_value, int max_value> class BoundedDouble: public double {}; And then inherit use template specialization to get run-time information about that type: template<typename T> class Type { etc. } template<int min_value, int max_value> class Type<BoundedDouble<min_value, max_value>> { int min() const { return min_value; } etc. } But, you can't inherit from double...

  Read the article

• prevent race condition without using locks C++

  - by Hristo

  How do I prevent a race condition with locking or using mutexes/semaphors in C++? I'm dealing with a nested for loop in which I will be setting a value in an array: for (int i = 0; i < m; ++i) for (int j = 0; j < n; ++j) for (int k = 0; k < o; ++k) array[k] += foo(...); More or less, I want to deal with this so that I can ensure different threads running at the same time don't write to array[k] at the same time. Any suggestions on how to approach this? Thanks, Hristo

  Read the article

• Parallel Task In C#.net

  - by Test123

  I have C#.net application. I wanted to run my application In Thread. But because of third party dll it dont allow to use application in multiThread. There is one object in thrid party dll ,which only allow to create instance at one time only. When i manually run application exe instnace multiple time & process my data it process successfully..(might because of each exe run with its application domain) Same thing i require to implement from C# code. for that i have created dll which can accessible by Type.GetTypeFromProgID()..but multiple dll instnace creating same problem. Is there any way i could achive manual parallelism through code to process same exe code in multiple application domain?

  Read the article

• The case against Maven?

  - by Asgeir S. Nilsen

  Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

  Read the article

• Is ReaderWriterLockSlim.EnterUpgradeableReadLock() essentially the same as Monitor.Enter()?

  - by Neil Barnwell

  So I have a situation where I may have many, many reads and only the occasional write to a resource shared between multiple threads. A long time ago I read about ReaderWriterLock, and have read about ReaderWriterGate which attempts to mitigate the issue where many writes coming in trump reads and hurt performance. However, now I've become aware of ReaderWriterLockSlim... From the docs, I believe that there can only be one thread in "upgradeable mode" at any one time. In a situation where the only access I'm using is EnterUpgradeableReadLock() (which is appropriate for my scenario) then is there much difference to just sticking with lock(){}? Here's the excerpt: A thread that tries to enter upgradeable mode blocks if there is already a thread in upgradeable mode, if there are threads waiting to enter write mode, or if there is a single thread in write mode. Or, does the recursion policy make any difference to this?

  Read the article

• Implementing a multi-state planner

  - by MoominTroll

  I've been asked to develop a system wherein employees can mark on a form their availability on a given day of the week - for instance an employee could mark themselves as available on a given time on a given week, and unavailable on some other time. It looks a little like this: Currently this works by rendering checkboxes within the table, picking up click events in each cell and marking the checkbox and hence the cell appropriately. I'm using the JQuery "click n drag checkbox" plugin from here. However, I've been informed that there could well be more than two states for a given cell (for instance available, unavailable, available in a given circumstance), in which case binding to a checkboxes checked value isnt going to be a lot of help. I've never used javascript or asp.net before and am unsure as to the best way to approach this problem. Ideally I could stick a data structure behind each cell which I could update to a certain state and then get my cell colour by binding to this - however I'm at something as a loss as how to best achieve this.

  Read the article

• Windows Service suddenly doing nothing

  - by TB

  Hi, My windows service is using a Thread (not a timer) which is always looping and sleeps for 1 second every loop using : evet.WaitOne(interval); When I start the service it works fine and I can see in the task manager that it is running, consuming and releasing memory, consuming processor ... etc that is all normal, but after a while (random amount of time) the service simply stops!! it is still there in the task manager but it is not consuming any processor work now and its consumption to the memory is not changing. it simply (died but still there in the task manager like a Zombie). I know that many exceptions might have happened during running the service (it is really doing many things) but all those exceptions are handled in Try catch blocks, so why is my "always looping" thread stops ??? This thread also logs every time he loops, when he is freezig in this way he is not logging anything (of course)

  Read the article

• Learning Objective-C 2.0 and ASP.NET 4.0 simultaneously?

  - by Sahat

  (HOBBY) I own a Macbook Pro and iPod Touch so developing iPhone/iPod/iPad apps seems like a logical thing to do in order to get some experience in the programming field. Besides I want to write a new application similar to the Capsuleer (Character skills monitor app for EVE Online MMO) but with more features. It's something I'd love to have on my own iPod Touch and I am sure other people will welcome a new EVE Online app for their iPhone or iPod Touch. (CAREER) I want to learn ASP.NET (and possibly Silverlight later on) for my potential future job. I plan to work in the .NET field, so it's a good idea for me to start learning C# and ASP.NET ASAP. Is it a good idea to learn completely unrelated technologies at the same time? Or would it be better to learn one thing at a time? Objective-C first, and ASP.NET second. Or vice versa. Thanks, Sahat

  Read the article

• Marker on Google Map added only once.

  - by Vafello

  I have the following code: function clicked(overlay, latlng) { var icon3 = new GIcon(); icon3.image = "marker.png"; icon3.iconAnchor = new GPoint(15, 40); var marker2 = new GMarker(latlng, { icon: icon3, draggable: true, title: 'Drag me' }); map.addOverlay(marker2); } Each time I click on the map a new marker is placed on the map. The problem is that I need only one marker and if I click several times, each time a new marker is added. How to change the code so only one marker is placed and when the map is clicked again it just changes its location?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• php database session handling problem in IE8!

  - by psyb0rg

  I've got an html page from where Im making this call periodically: function logon(id) { $.get("data.php", { action: 'online', userID: id}, function(data){ $("#msg").html(data); }); } What this does is it calls this SQL script in data.php: $sql = "update user_sessions set expires=(expires + 2) where userID = $userID"; mysql_query($sql, $conn) or die(mysql_error()); echo $sql; I can see by the echo that the sql syntax and values are correct, but THE CHANGES TO THE expires FIELD ARE NOT DONE, ONLY IN IE8!! It works fine in other ff, safari, chrome, ie6 and 7. There is nothing browser specific about making this sql call, but the user_sessions table is used to store PHP's sessions. Im only increasing the session expiry time when the call is made. What in IE8's session handling is preventing the session time from changing? Is there any caching or cookie problem that needs to be changed?

  Read the article

• Keeping DB Table sorted using multi-field formula (Microsoft SQL)

  - by user298167

  Hello Everybody. I have a Job Table which has two interesting columns: Creation Date and Importance (high - 3, medium 2, low - 1). Job's priority calculated like this: Priority = Importance * (time passed since creation). The problem is, Every time I would like to pick 200 jobs with highest priority, I dont want to resort the table. Is there a way to keep rows sorted? I was also thinking about having three tables one for High, Medium and Low and then sort those by Creation Date. Thanks

  Read the article

• How can I try a new language or framework without installing it?

  - by flamingLogos

  With so many languages and frameworks that exist, and with new ones appearing all the time, I don't have the time to download, install, and configure each one to evaluate it. In the past I've run across webapps that allow one to write or paste code into a window, and see the results in realtime in the browser, usually in a tutorial setting. What are your favorite sandbox sites for a given technology? Edit: @fretj provided the link to the excellent Google Code Playground (+1 upvote), but I thought that it was just for experimenting with Google's own apps (Search, Maps, Earth, Language, etc). But it turns out that it contains a few hidden gems: In addition to their apps, you can try out the many Javascript libraries that they host including jQuery, jQuery UI, MooTools, Dojo, and Prototype Scriptaculous. They're all hidden under the Libraries category in the "Pick an API" box. I overlooked the category because I thought it was for an app called Google Libraries. There's also a Javascript category for Javascript itself.

  Read the article

• Do invisible controls and their children on an ASP.NET page contribute to viewstate?

  - by Mr. Jefferson

  I have an ASP.NET page that has about 40 custom controls embedded in it. The controls vary in size; in their .ascx files, the biggest is about 1,500 lines and the smaller ones are between 100 and 200 lines (markup, script, etc). Each control is contained in a Panel. Only one of these panels is ever visible at any one time, which means only one control is ever visible at one time. My question is this: do the controls that are invisible still send ViewState for themselves and all their children to the client? It makes sense that they might have to serialize the fact that they're invisible, but not all the state info for their children...

  Read the article

• Can I Import an updated structure into a MySQL table without losing its current content?

  - by Udi Wertheimer

  We use MySQL tables to which we add new fields from time to time as our product evolves. I'm looking for a way to export the structure of the table from one copy of the db, to another, without erasing the contents of the table I'm importing to. For example say I have copies A and B of a table, and I add fields X,Y,Z to table A. Is there a way to copy the changed structure (fields X,Y,Z) to table B while keeping its content intact? I tried to use mysqldump, but it seems I can only copy the whole table with its content, overriding the old one, or I can use the "-d" flag to avoid copying data (dumping structure only), but this will create an empty table when imported, again overriding old data. Is there any way to do what I need with mysqldump, or some other tool?

  Read the article

• Hbase schema design -- to make sorting easy?

  - by chen

  I have 1M words in my dictionary. Whenever a user issue a query on my website, I will see if the query contains the words in my dictionary and increment the counter corresponding to them individually. Here is the example, say if a user type in "Obama is a president" and "Obama" and "president" are in my dictionary, then I should increment the counter by 1 for "Obama" and "president". And from time to time, I want to see the top 100 words (most queried words). If I use Hbase to store the counter, what schema should I use? -- I have not come up an efficient one yet. If I use word in my dictionary as row key, and "counter" as column key, then updating counter(increment) is very efficient. But it's very hard to sort and return the top 100. Anyone can give a good advice? Thanks.

  Read the article

• String, StringBuffer, and StringBuilder

  - by JavaUser

  Please tell me a real time situation to compare String, StringBuffer, and StringBuilder?

  Read the article

• ASP.NET MVC: Is is possible to set a global variable?

  - by Sergio

  Hello, I have a process within my MVC 2 application that takes a large amount of time and alters many rows in the database in the process. There is a chance that two or more users could attempt to perform this action at the same time, which would lead to undesirable effects. Is there a way to set a global flag somewhere within asp.net that I can check against all requests to see if the action in question is currently being executed? (a bit that I flip prior to running query, and then then flip back on completition) Or is there a better way of handling this situation? Thanks

  Read the article

• Python json memory bloat

  - by Anoop

  import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

  Read the article

• SQL query root parent child records

  - by Vish

  Hi, We have nested folders with parent-child relationship. We use MySQL MyISAM DB. The data is stored in the DB in the following manner. Every time a child folder is created in the nested structure, the previous parentID is added. I want to get the RootFolderID of a folder which is added in the hierarchy as tabulated below. FoldID ParentID |RootFolderID -----------------|------------------- 1 0 | 0 2 1 | 1 3 2 | 1 4 3 | 1 5 4 | 1 Please let me know how to get the root folderID and populate it in the RootFolderID column after a folder is created each time. Thanks.

  Read the article

• read the windows event log by particular Source

  - by Sathish

  How can i read the windows event log by particular Source, Date time and category?? Please help me with the code

  Read the article

• Remove items from SWT tables

  - by Dima

  This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

  Read the article

< Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >