Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 565/2372 | < Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >

• SQL Server: Mitigating schema changes/upgrades

  - by bradhe

  I haven't spent a ton of time researching this yet, mostly looking for best practices on upgrading/changing DB schemas. We're actively developing a new product and as such we often have additions or changes to our DB schema. We also have many copies of the DB -- one for the test environment, one for the prod environment, dev environments, you name it. We don't really want to have to blow away test data every time we want to make a change to the DB. Are there good ways of automating this or handling this? None of us have really ever had to deal with this so...

  Read the article

• Parallel Task In C#.net

  - by Test123

  I have C#.net application. I wanted to run my application In Thread. But because of third party dll it dont allow to use application in multiThread. There is one object in thrid party dll ,which only allow to create instance at one time only. When i manually run application exe instnace multiple time & process my data it process successfully..(might because of each exe run with its application domain) Same thing i require to implement from C# code. for that i have created dll which can accessible by Type.GetTypeFromProgID()..but multiple dll instnace creating same problem. Is there any way i could achive manual parallelism through code to process same exe code in multiple application domain?

  Read the article

• expand a varchar column very slowly , why?

  - by francs

  Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

  Read the article

• How do I make a class whose interface matches double, but upon which templates can be specialized?

  - by Neil G

  How do I make a class whose interface matches double, but whose templated types do not dynamic cast to double? The reason is that I have a run-time type system, and I want to be able to have a type that works just like double: template<int min_value, int max_value> class BoundedDouble: public double {}; And then inherit use template specialization to get run-time information about that type: template<typename T> class Type { etc. } template<int min_value, int max_value> class Type<BoundedDouble<min_value, max_value>> { int min() const { return min_value; } etc. } But, you can't inherit from double...

  Read the article

• I want to use VI-like commands in Web Browser?

  - by Frank

  I love VI and I'm looking for a plugin of some sort that would allow me to input text in my browser (preferably Firefox or Chrome) using VI commands. It would save me an immense amount of time and at the same time when writing long emails. Can anyone think of any plugins that would allow me to do this? I was hopeful with Vimperator (https://addons.mozilla.org/en-US/firefox/addon/4891) but after installing it, I realized that it didn't do the one VI think I wanted to do: create or edit a text box with VI commands. It just allowed me to do Browser commands and scrolling in VI-style.

  Read the article

• How to Create VBA Add-In with Shared Codes for All Excels?

  - by StanFish

  I'm writing VBA codes for multiple Excel spreadsheets, which will be shared with others from time to time. At some point I find there are lots of duplications in my works. So I want to find a way to share codes in a sort of Excel add-in, like the .xla file. But when I tried to save the Excel file containing shared codes as .xla file, I got some problems: The file cannot be edit anymore after I save it in the default add-in folder If I move the .xls file to a folder other than the add-in folder, and open it directly - I cannot use its classes - which creates problems for sharing the codes Any ideas to create add-ins in a flexible and powerful way please? Thanks a lot for the help

  Read the article

• Python json memory bloat

  - by Anoop

  import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

  Read the article

• Remove items from SWT tables

  - by Dima

  This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

  Read the article

• Windows Service suddenly doing nothing

  - by TB

  Hi, My windows service is using a Thread (not a timer) which is always looping and sleeps for 1 second every loop using : evet.WaitOne(interval); When I start the service it works fine and I can see in the task manager that it is running, consuming and releasing memory, consuming processor ... etc that is all normal, but after a while (random amount of time) the service simply stops!! it is still there in the task manager but it is not consuming any processor work now and its consumption to the memory is not changing. it simply (died but still there in the task manager like a Zombie). I know that many exceptions might have happened during running the service (it is really doing many things) but all those exceptions are handled in Try catch blocks, so why is my "always looping" thread stops ??? This thread also logs every time he loops, when he is freezig in this way he is not logging anything (of course)

  Read the article

• Where are the function literals in c++?

  - by academicRobot

  First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

  Read the article

• Which has been the most reliable, fastest Windows C++ profiler that you have used?

  - by carleeto

  I need to profile a real time C++ app on Windows. Most of the available profilers are either terribly expensive, total overkill, or both. I don't need any .NET stuff. Since it is a real time app, I need the profiler to be as fast as possible. It would be excellent if it integrated in some way with Visual Studio 2005/2008, but that's not necessary. If this description reminds you of a profiler that you have used, I would really like to know about it. I am hoping to draw from people's use of C++ profilers on Windows to pinpoint one that will do the job. Thanks.

  Read the article

• The case against Maven?

  - by Asgeir S. Nilsen

  Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

  Read the article

• Is there an optimal way to render images in cocoa? Im using setNeedsDisplay

  - by Edward An

  Currently, any time I manually move a UIImage (via handling the touchesMoved event) the last thing I call in that event is [self setNeedsDisplay], which effectively redraws the entire view. My images are also being animated, so every time a frame of animation changes, i have to call setNeedsDisplay. I find this to be horrific since I don't expect iphone/cocoa to be able to perform such frequent screen redraws very quickly. Is there an optimal, more efficient way that I could be doing this? Perhaps somehow telling cocoa to update only a particular region of the screen (the rect region of the image)?

  Read the article

• Where is the best place to run initialization code for a UITabBarController?

  - by bobobobo

  I have a UITabBarController in my application. I have to perform some customization to the NIB file using code the first time a view embedded in that UITabBarController gets loaded. When applicationDidFinishLaunching occurs, the UITabBarController's views apparently are not loaded -- if I try to modify the view controllers inside a tab bar that the tab bar is to load in applicationDidFinishLaunching, then those changes are ignored. I'm assuming this is because the tab bar didn't finish loading yet. So, I need a good place to put code that will run immediately after a tabbar is fully ready -- i.e. after it has loaded all the views from their respective nib files. I'm finding the only place I can do this is to track the first time viewDidAppear on each individual view controller. Note I can't use viewWillAppear because I need the value of tabBarController.selectedIndex to be accurate, and it is only actually updated after viewDidAppear gets fired, not when viewWillAppear gets fired.

  Read the article

• Mac OS X 10.5+ and POSIX

  - by Phil

  Hello, I need to program an authentication module that has to work with Mac OS X 10.6 Snow Leopard and at the same time needs to be POSIX-compliant. I read here: developer.apple.com/leopard/overview/osfoundations.html that since Mac OS X 10.5 Leopard, Mac OS X is POSIX-compliant (to POSIX 1003.1), but working under MAC OS X 10.5 Leopard myself, I can't find any trace of my user name neither in /etc/passwd nor in its successor /etc/master.passwd, which is mentioned here: developer.apple.com/mac/library/DOCUMENTATION/Darwin/Reference/ManPages/man5/passwd.5.html Instead it says in both files OpenDirectory Service is used, which should be OpenLDAP according to the OpenDirectoryService man-page. Is this still POSIX-compliant ? I guess not. I wonder how Mac OS X would handle my 100% POSIX-compliant code which depends on /etc/passwd ? I would be gratefull if someone could explain the way this works to me. Thank you for your time and trouble. Best regards Phil.

  Read the article

• Is ReaderWriterLockSlim.EnterUpgradeableReadLock() essentially the same as Monitor.Enter()?

  - by Neil Barnwell

  So I have a situation where I may have many, many reads and only the occasional write to a resource shared between multiple threads. A long time ago I read about ReaderWriterLock, and have read about ReaderWriterGate which attempts to mitigate the issue where many writes coming in trump reads and hurt performance. However, now I've become aware of ReaderWriterLockSlim... From the docs, I believe that there can only be one thread in "upgradeable mode" at any one time. In a situation where the only access I'm using is EnterUpgradeableReadLock() (which is appropriate for my scenario) then is there much difference to just sticking with lock(){}? Here's the excerpt: A thread that tries to enter upgradeable mode blocks if there is already a thread in upgradeable mode, if there are threads waiting to enter write mode, or if there is a single thread in write mode. Or, does the recursion policy make any difference to this?

  Read the article

• How to solve High Load average issue in Linux systems?

  - by RoCkStUnNeRs

  The following is the different load with cpu time in different time limit . The below output has parsed from the top command. TIME LOAD US SY NICE ID WA HI SI ST 12:02:27 208.28 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:23:22 195.48 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:34:55 199.15 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 13:41:50 203.66 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st 13:42:58 278.63 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st Following is the additional Information of the system? cat /proc/cpuinfo processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 0 cpu cores : 4 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4658.69 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 1 cpu cores : 4 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 2 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 2 cpu cores : 4 apicid : 2 initial apicid : 2 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 3 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 3 cpu cores : 4 apicid : 3 initial apicid : 3 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4654.99 clflush size : 64 power management: Memory: total used free shared buffers cached Mem: 2 1 1 0 0 0 Swap: 5 0 5 let me know why the system is getting abnormally this much high load?

  Read the article

• String, StringBuffer, and StringBuilder

  - by JavaUser

  Please tell me a real time situation to compare String, StringBuffer, and StringBuilder?

  Read the article

• How do i stop the android garbage collector? Is it possible?

  - by Sponge

  Is there any way to stop the garbage collector for some time?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Apache 2.2 / Win7 - slow or not responsive

  - by joey

  My configuration - Windows 7 x64, Php 5.3, Apache 2.2.15, latest Mysql. When loading pages from localhost, the response time shown by firebug is more 530ms for the main 'index.php' file, sometimes the connection is reset. It's painfully slow. I googled the problem and found a workaround - switch off and on again a win service called BFE - base filtering engine. Then everything works like a lightning but xdebug doesn't work in netbeans. Why is this response time so long? Can you think of any other solution than BFE toggling? joey33

  Read the article

• Marker on Google Map added only once.

  - by Vafello

  I have the following code: function clicked(overlay, latlng) { var icon3 = new GIcon(); icon3.image = "marker.png"; icon3.iconAnchor = new GPoint(15, 40); var marker2 = new GMarker(latlng, { icon: icon3, draggable: true, title: 'Drag me' }); map.addOverlay(marker2); } Each time I click on the map a new marker is placed on the map. The problem is that I need only one marker and if I click several times, each time a new marker is added. How to change the code so only one marker is placed and when the map is clicked again it just changes its location?

  Read the article

• Can I Import an updated structure into a MySQL table without losing its current content?

  - by Udi Wertheimer

  We use MySQL tables to which we add new fields from time to time as our product evolves. I'm looking for a way to export the structure of the table from one copy of the db, to another, without erasing the contents of the table I'm importing to. For example say I have copies A and B of a table, and I add fields X,Y,Z to table A. Is there a way to copy the changed structure (fields X,Y,Z) to table B while keeping its content intact? I tried to use mysqldump, but it seems I can only copy the whole table with its content, overriding the old one, or I can use the "-d" flag to avoid copying data (dumping structure only), but this will create an empty table when imported, again overriding old data. Is there any way to do what I need with mysqldump, or some other tool?

  Read the article

• Scoping in embedded groovy scripts

  - by Aaron Digulla

  In my app, I use Groovy as a scripting language. To make things easier for my customers, I have a global scope where I define helper classes and constants. Currently, I need to run the script (which builds the global scope) every time a user script is executed: context = setupGroovy(); runScript( context, "global.groovy" ); // Can I avoid doing this step every time? runScript( context, "user.groovy" ); Is there a way to setup this global scope once and just tell the embedded script interpreter: "Look here if you can't find a variable"? That way, I could run the global script once. Note: Security is not an issue here but if you know a way to make sure the user can't modify the global scope, that's an additional plus.

  Read the article

• Build Interactive Floor With Projection !?

  - by Synxmax

  Dear Guys I am somehow newbie and sometimes guru , but at this moment i don't have enough time to research My nightmare is , my boss ask me to create an interactive floor ( he just saw in an exhibition ) , he ask me to create one of them instead of buying , i am an actionscript crawler and developer with some skills in java and c# programming , i just made some track motion with a simple web cam , and this idea came to my mind if i can use an infrared or thermographic camera instead of simple camera so i can get better positioning if camera place at top of floor ! Now i just came here to ask you guys is there any resource , tip , help i can know before getting into this deal !? is there any lib or api out to deal with this ?! EVEN, if there is any resource , article from another language c++ , c , .... could help i just didn't have enough time to test lot of ways If you search interactive floors , or interactive floor projection you can find some companies who provide such a thing Thanks in advance ( and sorry for my damn poor english , français could be better :D )

  Read the article

< Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >