Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 565/2372 | < Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >

  • Why does SQLAlchemy with psycopg2 use_native_unicode have poor performance?

    - by Bob Dover
    I'm having a difficult time figuring out why a simple SELECT query is taking such a long time with sqlalchemy using raw SQL (I'm getting 14600 rows/sec, but when running the same query through psycopg2 without sqlalchemy, I'm getting 38421 rows/sec). After some poking around, I realized that toggling sqlalchemy's use_native_unicode parameter in the create_engine call actually makes a huge difference. This query takes 0.5secs to retrieve 7300 rows: from sqlalchemy import create_engine engine = create_engine("postgresql+psycopg2://localhost...", use_native_unicode=True) r = engine.execute("SELECT * FROM logtable") fetched_results = r.fetchall() This query takes 0.19secs to retrieve the same 7300 rows: engine = create_engine("postgresql+psycopg2://localhost...", use_native_unicode=False) r = engine.execute("SELECT * FROM logtable") fetched_results = r.fetchall() The only difference between the 2 queries is use_native_unicode. But sqlalchemy's own docs state that it is better to keep use_native_unicode=True (http://docs.sqlalchemy.org/en/latest/dialects/postgresql.html). Does anyone know why use_native_unicode is making such a big performance difference? And what are the ramifications of turning off use_native_unicode?

    Read the article

  • Facing problem in VB6.0 Activex Controls design.

    - by Dharmaraju
    Hi, This is dharmaraju, I am facing some problem in Activex Controls design. Kindly help me to resolve the issue. Problem Description: I have created a property mentioned below for a textbox. Public Property Let DataControl_Value(ByVal Value As Variant) Public Property Get DataControl_Value() As Variant This property is editable at design time if i use it VB6.0 Applications. Same thing is read only in case if i use it in vc++ MFC applications. I have defined one more property like below. Public Property Let DataControl_DataItemDef(ByVal Value As DTMDATACONTROLLib.IXMLDOMNode) Public Property Get DataControl_DataItemDef() As DTMDATACONTROLLib.IXMLDOMNode In this case the "DataControl_DataItemDef" property will not be available at design time.[not displaying in control's property window.] Kindly help me to resolve the issue.

    Read the article

  • Implementing a multi-state planner

    - by MoominTroll
    I've been asked to develop a system wherein employees can mark on a form their availability on a given day of the week - for instance an employee could mark themselves as available on a given time on a given week, and unavailable on some other time. It looks a little like this: Currently this works by rendering checkboxes within the table, picking up click events in each cell and marking the checkbox and hence the cell appropriately. I'm using the JQuery "click n drag checkbox" plugin from here. However, I've been informed that there could well be more than two states for a given cell (for instance available, unavailable, available in a given circumstance), in which case binding to a checkboxes checked value isnt going to be a lot of help. I've never used javascript or asp.net before and am unsure as to the best way to approach this problem. Ideally I could stick a data structure behind each cell which I could update to a certain state and then get my cell colour by binding to this - however I'm at something as a loss as how to best achieve this.

    Read the article

  • Remove items from SWT tables

    - by Dima
    This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

    Read the article

  • Is there an optimal way to render images in cocoa? Im using setNeedsDisplay

    - by Edward An
    Currently, any time I manually move a UIImage (via handling the touchesMoved event) the last thing I call in that event is [self setNeedsDisplay], which effectively redraws the entire view. My images are also being animated, so every time a frame of animation changes, i have to call setNeedsDisplay. I find this to be horrific since I don't expect iphone/cocoa to be able to perform such frequent screen redraws very quickly. Is there an optimal, more efficient way that I could be doing this? Perhaps somehow telling cocoa to update only a particular region of the screen (the rect region of the image)?

    Read the article

  • JQuery cookie access has stopped working for GAE app

    - by Greg
    I have a google app engine app that has been running for some time, and some javascript code that checks for a login cookie has suddenly stopped working. As far as I can tell, NO code has changed. The relevant code uses the jquery cookies plugin (jquery.cookies.2.2.0.min.js)... // control the default screen depending // if someone is logged in if( $.cookies.get('dev_appserver_login') != null || $.cookies.get('ACSID') != null ) { alert("valid cookie!") $("#inventory-container").show(); } else { alert("INvalid cookie!") $("#welcome-container").show(); } The reason for the two checks is that in the GAE SDK, the cookies are named differently. The production system uses 'ACSID'. This if statement works in the SDK and now fails 100% of the time in production. I have verified that the cookie is, in fact, present when I inspect the page. Thoughts?

    Read the article

  • Where to maintain common information, that could be accessed by all forms

    - by The King
    Hi All, This is my first winform app in .NET... I have made a couple of ASP.NET app... In this app, I have some common variables, like current user name, his selected process etc.. etc.. This should be made accessible from all forms in the app at any time... How could I do this... Is there any place like "Session" in ASP.NET here... Further How do coders generally pass information from one form to another... Here I want to pass on the info I acquired in the first form to the subsequent forms... I use constructor overloading and pass the values as parameters... I'm pretty sure there has to be a better way to do it... Thanks for your time...

    Read the article

  • What is the best approach to write test cases using sentestinkit in iPhone / iPad ?

    - by Madhup
    I am developing an application for iPad application. I need to perform unit testing in the application, but I am not sure why I should do unit testing in this application. Edit: And since the iPhone SenTestingKit is not well documented, the implementation and writing test cases is so time consuming. So why should we waste time with this? Also if we have to what would be the best approach to write the test cases? My focus is on the second question. So please answer more for the second part, I would be very pleased.

    Read the article

  • Sending bulk notification emails without blocking

    - by FreshCode
    For my client's custom-built CRM, I want users (technicians) to be notified of changes to marked cases via email. This warrants a simple subscription mapping table between users and cases and automated emails to be sent every time a change is made to a case from within the logging method. How do I send 10-100 emails to subscribed users without bogging down my logging method? My SMTP server is on a peer on my LAN, so sends should be quick, but ideally this should be handled by an external queuing process. I can have a cron job send any outstanding emails every 10 minutes, but for this specific client cases are quite time-sensitive and instant notification (as instant as email can be) would be great. How can I send bulk notification emails from within ASP.NET MVC without bogging down my logging method?

    Read the article

  • I want to use VI-like commands in Web Browser?

    - by Frank
    I love VI and I'm looking for a plugin of some sort that would allow me to input text in my browser (preferably Firefox or Chrome) using VI commands. It would save me an immense amount of time and at the same time when writing long emails. Can anyone think of any plugins that would allow me to do this? I was hopeful with Vimperator (https://addons.mozilla.org/en-US/firefox/addon/4891) but after installing it, I realized that it didn't do the one VI think I wanted to do: create or edit a text box with VI commands. It just allowed me to do Browser commands and scrolling in VI-style.

    Read the article

  • expand a varchar column very slowly , why?

    - by francs
    Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

    Read the article

  • Publish failed in Web Application Project (MVC)

    - by Stuck
    I usually use the "Publish" feature in VS 2008 to get the correct files and so on that I can publish to my website. But from time to time publish fails without any good error message at all. I know that it can be a couple of different reasons but I am starting to grow really tired with this now. Can anyone teach me how to build the website from the command line? As I said it is a MVC project. Can I use the aspnet_compiler for this? What parameters should I use to simulate the same behavior as a "Publish"?

    Read the article

  • What's the proper way of importing option lists into an Android app?

    - by Scott
    I have been storing option lists for my Android app in a cloud table. For example, categories like "historical fiction","biography","science fiction", etc. I see the following pros and cons: Pro: I can make changes to the list without sending an app update to Google Play Not normalized - I can use the text in my other data tables instead of a reference ID Con: App needs to take time to download from the web each time (or at least check for changes) English only I believe the "proper" way to do this is the use the XML resource files. But I need to make sure the selection references correctly with my data. That is, my app needs to understand that "Poetry" and "Poesía" are the same thing. Is the correct thing to do: Forget about it since I'll never get to the point where I'm translating my app anyway Use a string-array and use the index (0...x) to know what the selection is Use a 2-dimensional string-array with a reference ID in the first column and the text in the second?

    Read the article

  • Marker on Google Map added only once.

    - by Vafello
    I have the following code: function clicked(overlay, latlng) { var icon3 = new GIcon(); icon3.image = "marker.png"; icon3.iconAnchor = new GPoint(15, 40); var marker2 = new GMarker(latlng, { icon: icon3, draggable: true, title: 'Drag me' }); map.addOverlay(marker2); } Each time I click on the map a new marker is placed on the map. The problem is that I need only one marker and if I click several times, each time a new marker is added. How to change the code so only one marker is placed and when the map is clicked again it just changes its location?

    Read the article

  • two HashMap iteration

    - by user431276
    I have two HashMaps and I can iterate both hashmaps with following code Iterator it = mp.entrySet().iterator(); while (it.hasNext()) { Map.Entry pairs = (Map.Entry)it.next(); String firstVal = pairs.getValue(); } Iterator it2 = mp2.entrySet().iterator(); while (it2.hasNext()) { Map.Entry pairs2 = (Map.Entry)it.next(); String SecondVal = pairs2.getValue(); } myFunction(firstVal, SecondVal) Is there anyway to iterate two hashmaps at the same time without using two loops? Currently, I have a method that accepts two parameters and each parameter value is stored in first and second hashmap. I have to iterate first hash then second to get values. I think there must be a good way to do it but I don't know :( P.S: there could be some errors in above code as this is just an example to explain my problem. Each iterator is a method in original program and accept one parameter. I couldn't copy past real time functions as they are HUGE !

    Read the article

  • SQL query root parent child records

    - by Vish
    Hi, We have nested folders with parent-child relationship. We use MySQL MyISAM DB. The data is stored in the DB in the following manner. Every time a child folder is created in the nested structure, the previous parentID is added. I want to get the RootFolderID of a folder which is added in the hierarchy as tabulated below. FoldID ParentID |RootFolderID -----------------|------------------- 1 0 | 0 2 1 | 1 3 2 | 1 4 3 | 1 5 4 | 1 Please let me know how to get the root folderID and populate it in the RootFolderID column after a folder is created each time. Thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • The case against Maven?

    - by Asgeir S. Nilsen
    Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

    Read the article

  • Python json memory bloat

    - by Anoop
    import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

    Read the article

  • What is the Software Development Lifecycle?

    - by j-t-s
    Our investor wants a SDLC. I've never written one before, and I don't have enough time to go and buy a book, or spend much time learning about them. From what I've been told about them, they consist of requirements (what needs to be done), and a list is done. Is this correct? Update: I have found this article which really helps to explain things in simple terms and very quickly. Not that I think an SDLC should be done quickly. In my case, I have no other option.

    Read the article

  • How and when to log account access login with PHP?

    - by Nazgulled
    I want to implement a basic login system in some PHP app where no cookies will be involved. I mean, the user closes the browser and the login expires, it will remain active during the browser session (or if the user explicitly logs out) otherwise. I want to log all this activity and I'm thinking that every time the user refreshes the page, opens a different link or logs out, I record that time as the last access made by that user, overwriting the previous access log. But my problem is when and how should I insert another record into the database instead of overwriting the last one? Should I just define a timeout and if the last access was made above that timeout, another log should be inserted into the database? Should the session expire too after that timeout? Or is there a better way? Ideally, I would like to log the "log out action" when the browser was closed, but I don't think there's a way to detect that is there? Suggestions?

    Read the article

  • How can I try a new language or framework without installing it?

    - by flamingLogos
    With so many languages and frameworks that exist, and with new ones appearing all the time, I don't have the time to download, install, and configure each one to evaluate it. In the past I've run across webapps that allow one to write or paste code into a window, and see the results in realtime in the browser, usually in a tutorial setting. What are your favorite sandbox sites for a given technology? Edit: @fretj provided the link to the excellent Google Code Playground (+1 upvote), but I thought that it was just for experimenting with Google's own apps (Search, Maps, Earth, Language, etc). But it turns out that it contains a few hidden gems: In addition to their apps, you can try out the many Javascript libraries that they host including jQuery, jQuery UI, MooTools, Dojo, and Prototype Scriptaculous. They're all hidden under the Libraries category in the "Pick an API" box. I overlooked the category because I thought it was for an app called Google Libraries. There's also a Javascript category for Javascript itself.

    Read the article

  • How do I safely destroy a dialog window of a wxPython application?

    - by Akira
    I created a wxPython application which shows some messages on a dialog window. The dialog window is needed to be force-destroyed by the application before I click the dialog OK button. I used wx.lib.delayedresult to make the destroy call. My code is: import wx dlg=wx.MessageDialog(somewindow,'somemessage') from wx.lib.delayedresult import startWorker def _c(d): dlg.EndModal(0) dlg.Destroy() def _w(): import time time.sleep(1.0) startWorker(_c,_w) dlg.ShowModal() This can do what I desire to do while I got a error message below: (python:15150): Gtk-CRITICAL **: gtk_widget_destroy: assertion `GTK_IS_WIDGET (widget)' failed How do I "safely" destroy a dialog without clicking the dialog button?

    Read the article

< Previous Page | 561 562 563 564 565 566 567 568 569 570 571 572  | Next Page >