Search Results

Search found 59278 results on 2372 pages for 'time estimation'.

Page 567/2372 | < Previous Page | 563 564 565 566 567 568 569 570 571 572 573 574  | Next Page >

  • expand a varchar column very slowly , why?

    - by francs
    Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

    Read the article

  • .submit() changes post data

    - by ajbeaven
    I'm posting a form with javascript and it seems to be changing a value that I've entered in. Html: <% using (Html.BeginForm("ChangeTime", "Cart", new { cartItemId = cartItem.CartItemID }, FormMethod.Post, null)) { %> <%= Html.TextBox("startTime")%> <input type="submit" value="Update" /> <% } %> JQuery: <script type="text/javascript"> $('#startTime').change(function() { $(this).parent('form').submit(); }); </script> When I put a time in the textbox (05/05/2010 06:08 am), the form is submitted, however the string as it comes through, is 05/05/2010 - with the time part removed. I see this in fiddler. If get rid of the javascript and click the button above, it goes through how it should. Why is JQuery changing my text?

    Read the article

  • Speed up multiple JDBC SQL querys?

    - by paddydub
    I'm working on a shortest path a* algorithm in java with a mysql db. I'm executing the following SQL Query approx 300 times in the program to find route connections from a database of 10,000 bus connections. It takes approx 6-7 seconds to execute the query 300 times. Any suggestions on how I can speed this up or any ideas on a different method i can use ? Thanks ResultSet rs = stmt.executeQuery("select * from connections" + " where Connections.From_Station_stopID ="+StopID+";"); while (rs.next()) { int id = rs.getInt("To_Station_id"); String routeID = rs.getString("To_Station_routeID"); Double lat = rs.getDouble("To_Station_lat"); Double lng = rs.getDouble("To_Station_lng"); int time = rs.getInt("Time"); }

    Read the article

  • Can you safely rely upon Yahoo Pipes to offload ETL for your application?

    - by Daniel DiPaolo
    Yahoo Pipes are a very intriguing choice for sort of a poor-man's server-free ETL solution, but would it be a good idea to build an application around one or many Pipes? I've really only used them for toy things here and there, with the only thing I've used longer than a week or two being one amalgamated and filtered RSS feed that I've plugged into Google Reader (which has worked great, but if it goes out for a while I wouldn't notice). So, my question is, would building an application around Yahoo Pipes be reliable (available most of the time)? Ideally it'd be something I could rely on being up 99+% of the time. It looks like the Pipes Terms of Use permit building apps around it, but I am unfamiliar with anyone building anything significant using them.

    Read the article

  • Timer running while on home screen iPhone - Objective C

    - by Franky
    Hello, I am interested in building a Timer Based game such as mafia wars or soemthing like that. I'm stuck on one question. What would be the best way to retain a timer, even if the app is closed? Should I do this based on the Device Clock? or should I set a time to a server, and get the time when the device starts up? If any one knows a better way for this, let me know. Thanks. @lessfame

    Read the article

  • Learning Objective-C 2.0 and ASP.NET 4.0 simultaneously?

    - by Sahat
    (HOBBY) I own a Macbook Pro and iPod Touch so developing iPhone/iPod/iPad apps seems like a logical thing to do in order to get some experience in the programming field. Besides I want to write a new application similar to the Capsuleer (Character skills monitor app for EVE Online MMO) but with more features. It's something I'd love to have on my own iPod Touch and I am sure other people will welcome a new EVE Online app for their iPhone or iPod Touch. (CAREER) I want to learn ASP.NET (and possibly Silverlight later on) for my potential future job. I plan to work in the .NET field, so it's a good idea for me to start learning C# and ASP.NET ASAP. Is it a good idea to learn completely unrelated technologies at the same time? Or would it be better to learn one thing at a time? Objective-C first, and ASP.NET second. Or vice versa. Thanks, Sahat

    Read the article

  • Unix Sockets in Go

    - by marketer
    I'm trying to make a simple echo client and server that uses Unix sockets. In this example, the server can receive data from the client, but it can't send the data back. If I use tcp connections instead, it works great: Server package main import "net" import "fmt" func echoServer(c net.Conn) { for { buf := make([]byte, 512) nr, err := c.Read(buf) if err != nil { return } data := buf[0:nr] fmt.Printf("Received: %v", string(data)) _, err = c.Write(data) if err != nil { panic("Write: " + err.String()) } } } func main() { l, err := net.Listen("unix", "/tmp/echo.sock") if err != nil { println("listen error", err.String()) return } for { fd, err := l.Accept() if err != nil { println("accept error", err.String()) return } go echoServer(fd) } } Client package main import "net" import "time" func main() { c,err := net.Dial("unix","", "/tmp/echo.sock") if err != nil { panic(err.String()) } for { _,err := c.Write([]byte("hi\n")) if err != nil { println(err.String()) } time.Sleep(1e9) } }

    Read the article

  • Is there an optimal way to render images in cocoa? Im using setNeedsDisplay

    - by Edward An
    Currently, any time I manually move a UIImage (via handling the touchesMoved event) the last thing I call in that event is [self setNeedsDisplay], which effectively redraws the entire view. My images are also being animated, so every time a frame of animation changes, i have to call setNeedsDisplay. I find this to be horrific since I don't expect iphone/cocoa to be able to perform such frequent screen redraws very quickly. Is there an optimal, more efficient way that I could be doing this? Perhaps somehow telling cocoa to update only a particular region of the screen (the rect region of the image)?

    Read the article

  • Invalid ADTS sampling_frequency_index and channel_configuration why?

    - by Moto
    Hello all, I hope someone can direct me on the right path before I put a lot of time and effort on this. I'm currently trying to parse an AAC+ frame to get information such as number of channels and sample frequency. So it seems that we can simply get this information from the ADTS header but most of the time this information is inaccurate. So the question is: -Why is this data inaccurate? What is the meaning of the ADTS header channel and sample freq? Should I rely on it? -Should I parse further down the frame to get this information? FYI, the AAC+ raw data is coming from streaming servers... Thanks for the help! -Moto

    Read the article

  • Best ASP.NET Background Service Implementation

    - by Jason N. Gaylord
    What's the best implementation for more than one background service in an ASP.NET application? Timer Callback Timer timer = new Timer(new TimerCallback(MyWorkCallback), HttpContext, 5000, 5000); Thread or ThreadPool Thread thread = new Thread(Work); thread.IsBackground = true; thread.Start(); BackgroundWorker BackgroundWorker worker = new BackgroundWorker(); worker.DoWork += new DoWorkEventHandler(DoMyWork); worker.RunWorkerCompleted += new RunWorkerCompletedEventHandler(DoMyWork_Completed); worker.RunWorkerAsync(); Caching like http://www.codeproject.com/KB/aspnet/ASPNETService.aspx (located in Jeff Atwood's post here) I need to run multiple background "services" at a given time. One service may run every 5 minutes where another may be once a day. It will never be more than 10 services running at a time.

    Read the article

  • How can I require an attribute on a class definition?

    - by spoulson
    Is there a way to enforce a compile requirement for certain attributes on a class or interface implementation? For example, let's say my application uses a series of static classes that contain const int resource values. I'd like to decorate the class in a Description attribute to describe its contents. In concept, I'd like to apply this attribute requirement to an interface, then each static class would implement it with its required Description. I could write a run-time check or a unit test to check compliance. But really a compile-time check would be best. Is there such a thing?

    Read the article

  • iOS 5 - Coredata Sqlite DB losing data after killing app

    - by Brian Boyle
    I'm using coredata with a sqlite DB to persist data in my app. However, each time I kill my app I lose any data that was saved in the DB. I'm pretty sure its because the .sqlite file for my DB is just being replaced by a fresh one each time my app starts, but I can't seem to find any code that will just use the existing one thats there. It would be great if anyone could point me towards some code that could handle this for me. Cheers B - (NSPersistentStoreCoordinator *)persistentStoreCoordinator { if (__persistentStoreCoordinator != nil) { return __persistentStoreCoordinator; } NSDictionary *options = [NSDictionary dictionaryWithObjectsAndKeys:[NSNumber numberWithBool:YES], NSMigratePersistentStoresAutomaticallyOption, [NSNumber numberWithBool:YES], NSInferMappingModelAutomaticallyOption, nil]; NSURL *storeURL = [[self applicationDocumentsDirectory] URLByAppendingPathComponent:@"FlickrCoreData.sqlite"]; NSError *error = nil; __persistentStoreCoordinator = [[NSPersistentStoreCoordinator alloc] initWithManagedObjectModel:[self managedObjectModel]]; if (![__persistentStoreCoordinator addPersistentStoreWithType:NSSQLiteStoreType configuration:nil URL:storeURL options:options error:&error]) { NSLog(@"Unresolved error %@, %@", error, [error userInfo]); abort(); } return __persistentStoreCoordinator; }

    Read the article

  • Is there a standard format string in ASP.NET to convert 1/2/3/... to 1st/2nd/3rd...?

    - by Dr. Monkey
    I have an integer in an Access database, which is being displayed in ASP.NET. The integer represents the position achieved by a competitor in a sporting event (1st, 2nd, 3rd, etc.), and I'd like to display it with a standard suffix like 'st', 'nd', 'rd' as appropriate, rather than just a naked number. An important limitation is that this is for an assignment which specifies that no VB or C# code be written (in fact it instructs code behind files to be deleted entirely). Ideally I'd like to use a standard format string if available, otherwise perhaps a custom string (I haven't worked with format strings much, and this isn't high enough priority to dedicate significant time to*, but I am very curious about whether there's a standard string for this). (* The assignment is due tonight, and I've learned the hard way that I can't afford to spend time on things that don't get the marks, even if they irk me significantly.)

    Read the article

  • Understand ACTV mode and the PORT command

    - by Ramy
    Hello, I'm the part time FTP server administrator (with no real full-time admin). We currently only allow ACTV mode connections. Some of our clients have had issues with this but for the most part they've been ok using ACTV. For the few who aren't, we've been able to push the data over to their servers from ours. there is one client in particular however who is currently having trouble. He is using file-zilla and issuing a PORT command. First, does using the PORT command imply that you are in ACTV mode? Second is there a way in FileZilla to explicitly change to ACTV mode? Thanks for the help, _Ramy

    Read the article

  • urlopen error [errno 111] connection refused

    - by Ui-Gyun Jeong
    I am doing python exercise with a book 'headfirst python' and making android app by using python and sl4a my code is import android import json import time from urllib import urlencode from urllib2 import urlopen hello_msg = "Welcome to Coach Kelly's Timing App" list_title = 'Here is your list of athletes:' quit_msg = "Quitting Coach Kelly's App." web_server = 'http://127.0.0.1:8080' get_names_cgi = '/cgi-bin/generate_name.py' def send_to_server(url, post_data=None): if post_data: page = urlopen(url, urlencode(post_data)) else: page = urlopen(url) return(page.read().decode("utf8")) app = android.Android() def status_update(msg, how_long=2): app.makeToast(msg) time.sleep(how_long) status_update(hello_msg) athlete_names = sorted(json.loads(send_to_server(web_server + get_names_cgi))) app.dialogCreateAlert(list_title) app.dialogSetSingleChoiceItems(athlete_names) app.dialogSetPositiveButtonText('Select') app.dialogSetNegativeButtonText('Quit') app.dialogShow() resp = app.dialogGetResponse().result status_update(quit_msg) this is my code and the result is what is the problem??? I can not figure out what the problem is...

    Read the article

  • Affordable, Stable, ASP.NET MVC Hosting Exist?

    - by Chad
    I'm using webhost4life shared hosting right now. They have a 99.99% up-time guarantee, but it is definitely not. Their support has been good when I do contact them, but it's just not stable. The site will just go down at random times for 5-10 minutes at a time. I know I'm on shared hosting, but I was hoping it would be more stable than it is. My app isn't at the point where it would need dedicated hosting yet, if the shared was stable enough. Any affordable hosting that you can vouch for (that supports ASP.NET MVC)?

    Read the article

  • POST data disapearing on large file upload

    - by DfKimera
    I'm having issues with a file uploading utility in my PHP application. When sending large files (9MB+) over the form, I get a very odd behaviour: the POST data I've included in the form dissapears, including the file information. I've already increased all PHP limits I could (time limit, max input time, post max size, memory limit and upload max filesize) and I still can't get the proper behaviour. I've tried replacing the regular HTTP forms with a Flash-based solution (SWFUpload, www.swfupload.org), still the same behaviour. I've tried multiple files of similar sizes and its definitely not a particular file issue. I've debugged the POST vars sent using Firebug, and the correct variables are still there in the header, together with the file. What could be going on here?

    Read the article

  • iPhone SDK - keep data in modal view

    - by swalkner
    Hi all, I've got a modal view loaded the following way: ModalViewController *modalController = [[ModalViewController alloc] initWithNibName:@"ModalViewController" bundle:nil]; searchController.delegate = self; [self.navigationController presentModalViewController:modalController animated:YES]; [modalController release]; When the modal view appears, "viewDidLoad" is called. When I dismiss the modal view via [self.navigationController dismissModalViewControllerAnimated:YES]; the method "viewDidUnload" ISN'T called, but the next time I let the modal view appear, "viewDidLoad" is called again. My problem now is that I'm creating an NSArray in the modal view's "viewDidLoad" - and as I'm fetching the data from the web, I would like to do it only once. But this way, it's fetched every time... Any hints how I could achieve that the data is only fetched once? I would really like to do it in the modal view and not in the parent and provide the array as parameter to the modal view... Thanks!

    Read the article

  • log4net one file per run

    - by Diego Mijelshon
    I need my application to create a log file each time it runs. My preferred format would be App.log.yyyy-MM-dd_HH-mm-ss. If that's not possible, I'd settle for App.log.yyyy-MM-dd.counter This is my current appender configuration: <appender name="File" type="log4net.Appender.RollingFileAppender"> <file value="App.log"/> <rollingStyle value="Date"/> <datePattern value=".yyyy-MM-dd_HH-mm-ss"/> <staticLogFileName value="false"/> <lockingModel type="log4net.Appender.FileAppender+MinimalLock" /> </appender> But it creates a random number of files based on the date and time.

    Read the article

  • Convert date from access to SQL Server with SSIS

    - by Arne
    Hi, I want to convert a database from access to SQL Server using SSIS. I cannot convert the date/time columns of the access db. SSIS says something like: conversion between DT_Date and DT_DBTIMESTAMP is not supported. (Its translated from my German version, might be different in English version). In Access I have Date/Time column, in SQL Server I have datetime. In the dataflow chart of the SSIS I have a OLE DB source for the access db, an sql server target and a data conversion. In the data conversion I convert the columns to date[DT_DATE]. They are connected like this: AccessDB -> conversion -> SQL DB What am I doing wrong? How can I convert the Access date columns to SQL Server date columns?

    Read the article

  • Simple "Hello World!" console application crashes when run by windows TaskScheduler (1.0)

    - by user326627
    I have a batch file which starts multiple instances of simple console application (Hello World!). I work on Windows server 2008 64-bit. I configure it to run in TaskScheduler, at startup, and whether user is logged-in or not. The later configuration means that the instances will run without GUI (i.e. - no window). When I run this task, some of the instances just fail, after consuming 100& CPU. Application event-log shows the following error: "Faulting module KERNEL32.dll, version 6.0.6002.18005, time stamp 0x49e0421d, exception code 0xc0000142, fault offset 0x00000000000b8fb8, process id 0x29bc, application start time 0x01cae17d94a61895." Running the batch file directly works just fine. It seems to me that the OS has a problem loading too many instances of the application when no window is displayed. However - I can’t figure out why... Any idea??

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Eclipse Plugin: Enablement of an Action based on the current selection

    - by Itay
    I am using the org.eclipse.ui.popupMenus extension point for adding a sub-menu whose Action that is bounded to the following class: public class MyAction implements IObjectActionDelegate { private Logic logic = Logic.getInstance(); // Singleton public void setActivePart(IAction a, IWorkbenchPart targetPart) { // Nothing here } public void run(IAction a) { // Do something... } public void selectionChanged(IAction a, ISelection s) { a.setEnabled(logic.isEnabled(s)); } } This action is working correctly in most cases (including the call a.setEnabled() in selectionChanged()). My problem at the very first time my action is being invoked. The selectionChanged method is called only after the menu item has been displayed (and not when the user has made the selection) which means that the call to a.setEnabled() will have no affect. Any ideas on how to make my action receive selectionChanged() notifications even before the fist time it is being invoked?

    Read the article

  • Binning into timeslots - Is there a better way than using list comp?

    - by flyingcrab
    I have a dataset of events (tweets to be specific) that I am trying to bin / discretize. The following code seems to work fine so far (assuming 100 bins): HOUR = timedelta(hours=1) start = datetime.datetime(2009,01,01) z = [dt + x*HOUR for x in xrange(1, 100)] But then, I came across this fateful line at python docs 'This makes possible an idiom for clustering a data series into n-length groups using zip(*[iter(s)]*n)'. The zip idiom does indeed work - but I can't understand how (what is the * operator for instance?). How could I use to make my code prettier? I'm guessing this means I should make a generator / iterable for time that yields the time in graduations of an HOUR?

    Read the article

< Previous Page | 563 564 565 566 567 568 569 570 571 572 573 574  | Next Page >