Search Results

Search found 36892 results on 1476 pages for 'product line'.

Page 568/1476 | < Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >

  • passing parameters to javacsript using php

    - by ayush
    i have the following line of code - <a href="javascript:;" onClick="tweeet('myid')">My Tweets!</a> Now while this is working perfectly fine the following line is not - <a href="javascript:;" onClick="tweeet(<?php echo 'myid'; ?>)">My Tweets!</a> Can anyone help me out why it is not working and suggest any changes. The variable i want to pass to the javascript function is a php variable. also i have tried the php with single quotes and double quotes but it is not working.

    Read the article

  • Does .NET have a linker?

    - by Water Cooler v2
    From Jon Skeet's blog: What does the following comment mean? // The line below only works when linked rather than // referenced, as otherwise you need a cast. // The compiler treats it as if it both takes and // returns a dynamic value. string value = com.MakeMeDynamic(10); I understand what referencing an assembly is. You may reference it when compiling the program files either using the /ref: switch at the command line or you may add a statically reference to the assembly in Visual Studio. But how do you link to an assembly in .NET? Does he mean, load the assembly using Reflection (Assembly.LoadFile())? Or, the Win32 API LoadLibrary()? Or, does .NET have a linker that I have never heard of?

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • HASHREF in Perl

    - by Uri
    I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3-new( ... ); my $response = $s3-buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response-{buckets} } ) { print "bucket: " . $b-bucket . "\n"; } I'm buzzled by each operator on the first line. What type exactly are $response, $respone-{bucket}. Looks like the expression within the 'for' is an array, but I don't understand this syntax: @{ ... }?

    Read the article

  • How to set maxLines and ellipsesize of a TextView at the same time.

    - by michael
    I want to limit my text view to have maximum of 6 lines, so I did: <TextView android:id="@+id/toptext" android:layout_width="fill_parent" android:layout_height="wrap_content" android:maxLines="6"/> But when I try to configure it to add '...' when the text is truncated, I add android:ellipsize="end". I do see the ... but then my TextView only has a max line of 2, instead of 6. Can you please how can I make the text view of maximum line of 6 and add '...' when it get truncated? Thank you.

    Read the article

  • webscraper grabbing images, but not entering info into database

    - by Jason
    Hello, again. I'm having more issues with my script entering info into my database. The script below grabs a page, strips down the necessary info, then downloads the related image file. After that, it is supposed to enter the information gleaned from the URL into the database. For some reason, the script seems to iterate through the URLs, as I get downloaded images for each URL, but each URL's product is not entered into the database. The script will insert the first product's categories and product info, and then it just stops, and continues to download images. Any suggestions? <?php define('IN_PHPBB', true); $phpbb_root_path = (defined('PHPBB_ROOT_PATH')) ? PHPBB_ROOT_PATH : './'; $phpEx = substr(strrchr(__FILE__, '.'), 1); include($phpbb_root_path . 'common.' . $phpEx); include($phpbb_root_path . 'includes/simple_html_dom.' . $phpEx); // Start session management $user->session_begin(); $auth->acl($user->data); $user->setup(); set_time_limit(259200); function save($in, $out) { $ch = curl_init ($in); curl_setopt($ch, CURLOPT_HEADER, 0); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_BINARYTRANSFER,1); $rawdata=curl_exec($ch); curl_close ($ch); if(file_exists($out)) { unlink($out); } $fp = fopen($out,'x'); fwrite($fp, $rawdata); fclose($fp); } function scrape($i) { $url = 'http:/xxxxxxxx/index.php?main_page=product_info&products_id='.$i.'&zenid=e4b7dde8de02e1df005d4549e2e3e529'; echo "$url -- "; $exists = file_get_contents($url); if ($exists != false) { $html = file_get_html($url); foreach($html->find('body') as $html) { $test = $html->find('#productName', 0); if ($test) { $item['title'] = trim($html->find('#productName', 0)->plaintext); $item['price'] = trim($html->find('#productPrices', 0)->plaintext); $item['cat'] = $html->find('#navBreadCrumb', 0)->plaintext; list($home, $item['cat'], $item['subcat'], $title) = explode("::", $item['cat']); $item['cat'] = str_replace("&nbsp;", "", $item['cat']); $item['subcat'] = str_replace("\n", "", str_replace("&nbsp;", "", $item['subcat'])); $item['desc'] = trim($html->find('#productDescription', 0)->plaintext); $item['model'] = $html->find('ul#productDetailsList', 0)->find('li', 0)->plaintext; $item['model'] = explode(":", $item['model']); $item['model'] = trim($item['model'][1]); $item['manufacturer'] = $html->find('ul#productDetailsList', 0)->find('li', 1)->plaintext; $item['manufacturer'] = explode(":", $item['manufacturer']); $item['manufacturer'] = trim($item['manufacturer'][1]); foreach($html->find('img') as $img) { if($img->alt == $item['title']) { $item['img_sm'] = $img->src; } } $ret[] = $item; } } $html->clear(); unset($html); unset($item); return $ret; } else { echo "Could not find page<br />"; } unset($exists); } $i = 1; $end = 9999999; while($i < $end) { $ret = scrape($i); if(isset($ret)) { foreach($ret as $v) { $item['title'] = $v['title']; $item['price'] = $v['price']; $item['desc'] = $v['desc']; $item['model'] = $v['model']; $item['manufacturer'] = $v['manufacturer']; $item['image'] = $v['image']; $item['cat'] = $v['cat']; $item['subcat'] = $v['subcat']; $item['img_sm'] = $v['img_sm']; } unset($ret); unset($v); $sm_img_src = "http://xxxxxx/".$item['img_sm']; $ext = strrchr($item['img_sm'], '.'); $filename = $item['model'] . $ext; $lg_img_src = "http://xxxxx/images/STC/".$filename; $new_sm = "./rip_images/small/{$filename}"; $new_lg = "./rip_images/large/{$filename}"; $item['image'] = $filename; save($lg_img_src,$new_lg); save($sm_img_src,$new_sm); //see if parent cat exists $sql = 'SELECT cat_id FROM ' . SHOP_CAT_TABLE . ' WHERE cat_name = "'.$db->sql_escape($item['cat']).'"'; $result = $db->sql_query($sql); $parent = $db->sql_fetchrow($result); $db->sql_freeresult($result); // if not exists if($parent['cat_id'] == '') { //add the parent cat to the db $sql_ary = array( 'cat_name' => $item['cat'], 'cat_parent' => 0 ); $sql = 'INSERT INTO '.SHOP_CAT_TABLE.' '.$db->sql_build_array('INSERT', $sql_ary); $db->sql_query($sql); $cat_id = $db->sql_nextid(); //see if subcat exists $sql = 'SELECT cat_id FROM ' . SHOP_CAT_TABLE . ' WHERE cat_name = "'.$db->sql_escape($item['subcat']).'"'; $result = $db->sql_query($sql); $row = $db->sql_fetchrow($result); $db->sql_freeresult($result); // if not exists if($row['cat_id'] == '') { //add subcat to db $sql_ary = array( 'cat_name' => $db->sql_escape($item['subcat']), 'cat_parent' => $cat_id ); $sql = 'INSERT INTO '.SHOP_CAT_TABLE.' '.$db->sql_build_array('INSERT', $sql_ary); $db->sql_query($sql); $item_cat = $db->sql_nextid(); } else //if exists { $item_cat = $row['cat_id']; } } else //if parent cat exists { //see if subcat exists $sql = 'SELECT cat_id FROM ' . SHOP_CAT_TABLE . ' WHERE cat_name = "'.$db->sql_escape($item['subcat']).'"'; $result = $db->sql_query($sql); $row = $db->sql_fetchrow($result); $db->sql_freeresult($result); // if not exists if($row['cat_id'] == '') { //add the subcat to the db $sql_ary = array( 'cat_name' => $db->sql_escape($item['subcat']), 'cat_parent' => $parent['cat_id'] ); $sql = 'INSERT INTO '.SHOP_CAT_TABLE.' '.$db->sql_build_array('INSERT', $sql_ary); $db->sql_query($sql); $item_cat = $db->sql_nextid(); } else //if exists { $item_cat = $row['cat_id']; } } $sql_ary = array( 'item_title' => $db->sql_escape($item['title']), 'item_price' => $db->sql_escape($item['price']), 'item_desc' => $db->sql_escape($item['desc']), 'item_model' => $db->sql_escape($item['model']), 'item_manufacturer' => $db->sql_escape($item['manufacturer']), 'item_image' => $db->sql_escape($item['image']), 'item_cat' => $db->sql_escape($item_cat) ); $sql = 'INSERT INTO ' . SHOP_ITEM_TABLE . ' ' . $db->sql_build_array('INSERT', $sql_ary); $db->sql_query($sql); garbage_collection(); echo 'Done<br />'; } $i++; unset($item); } ?>

    Read the article

  • Template class implicit copy constructor issues

    - by Nate
    Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

    Read the article

  • Install over multiple UpgradeCodes with Visual Setup?

    - by tewha
    We have a product that has been installed with multiple UpgradeCodes in the past. There's a big red box in the documentation saying not to do that, but the developer somehow overlooked it. I'd like to move this installer to a Setup Project. How can I install over all of the previous UpgradeCodes installed by the various WIX installers?

    Read the article

  • Python Importing object that originates in one module from a different module into a third module

    - by adewinter
    I was reading the sourcode for a python project and came across the following line: from couchexport.export import Format (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/views.py#L1 ) I went over to couchexport/export.py to see what Format was (Class? Dict? something else?). Unfortunately Format isn't in that file. export.py does however import a Format from couchexport.models where there is a Format class (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/models.py#L11). When I open up the original file in my IDE and have it look up the declaration, in line I mentioned at the start of this question, it leads directly to models.py. What's going on? How can an import from one file (export.py) actually be an import from another file (models.py) without being explicitly stated?

    Read the article

  • sql "Group By" and "Having"

    - by Hans Rudel
    im trying to work through some questions and im not sure how to do the following Q:Find the hard drive sizes that are equal among two or more PCs. its q15 on this site http://www.sql-ex.ru/learn_exercises.php#answer_ref The database scheme consists of four tables: Product(maker, model, type) PC(code, model, speed, ram, hd, cd, price) Laptop(code, model, speed, ram, hd, screen, price) Printer(code, model, color, type, price) any pointers would be appreciated.

    Read the article

  • UIViewController is popped from view stack and NSURLConnection crashes the application

    - by rickharrison
    I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

    Read the article

  • Enabling ProGuard in Eclipse for Android

    - by Ted Hopp
    The new documentation on ProGuard for Android says to add a line to the default.properties file in the project home directory. However, on opening this file, I read at the top: # This file is automatically generated by Android Tools. # Do not modify this file -- YOUR CHANGES WILL BE ERASED! Am I missing something? Also, is there a way to enable ProGuard only for a production build from Eclipse (i.e., when exporting the finished product)?

    Read the article

  • Instead of buying VS 2010 what options will you use for .net development in the future?

    - by Eric Neunaber
    Given the recent release of VS 2010 I was shocked to see the pricing structure for the different versions of the product. I was lucky enough to receive free versions of VS 2005 and 2008 from attending various MS events. For the hacking I do at home I'm not sure I'm going to spend the money to purchase the IDE and wanted to see what others were using. Like SharpDevelop MonoDevelop Expess Editions

    Read the article

  • NSURLConnection shown as leaking in instruments

    - by Gyozo Kudor
    Hello another stupid question regarding leaks and also NSURLConnection. How do i release it? Is it enough if i release in the following 2 methods? (void)connection:(NSURLConnection *)connection didFailWithError:(NSError *)error (void)connectionDidFinishLoading:(NSURLConnection *)connection Because in instruments it shows me the line where I alloc my connection as the source of leaking. OK I don't get it. After the following code my urlConnection has a retain count of 2. WTF? NSURLConnection *urlConnection = [[NSURLConnection alloc] initWithRequest: urlRequest delegate: self]; This is the line that instruments points me to. I find this very weird.

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • What is this for an IP in my google app engine log file?

    - by Christian Harms
    I get many normal log lines in my google app engine application. But today I go these instead the 4-part number: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 What is this for an format? ipv6 are 6 numbers, mac address too... Normal logfile line: 187.14.44.208 - - [19/Mar/2010:14:31:35 -0700] "GET /geo_data.js HTTP/1.1" 200 776 "http://www.xxx.com.br/spl19/index.php?refid=gv_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 5.1; pt-BR; rv:1.9.2) Gecko/20100115 Firefox/3.6 (.NET CLR 3.5.30729),gzip(gfe)" This special logfile line: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 - - [18/Mar/2010:17:00:37 -0700] "GET /geo_data.js HTTP/1.1" 500 450 "http://www.xxx.com.br/spl19/index.php?refid=cm_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 6.1; pt-PT; rv:1.9.2) Gecko/20100115 Firefox/3.6,gzip(gfe)"

    Read the article

  • How to compare if string has a enter key in the end using jquery/javascript?

    - by user144842
    I have a string value from a user input box. I have to figure out if last char is a enter key (line feed). Thats the code. Here I am checking if last char has a whitespace. Now I also have to check if last char is enter key (carriage return or line feed). How can i do this? var txt = $get("<%= txtUserText.ClientID %>"); if (txt.value.substring(txt.value.length -1) !== ' ' || <checkifLastCharIsEnterKey>) //my code to take action **I don't think i need a keypress or keyup event because this above piece of code is not invoked at the time of user input.

    Read the article

  • update a column in input file by taking value from Database in perl.

    - by Rahul Singh
    input file: 1,a,USA,, 2,b,UK,, 3,c,USA,, i want to update the 4th column in the input file from taking values from one of the table. my code looks like this: my $customer_dbh = DBI-connect("DBI:Oracle:$INST", $USER, $PASS ) or die "Couldn't connect to datbase $INST"; my $cust_smh; print "connected \n "; open FILE , "+$input_file" or die "can't open the input file"; print "echo \n"; while(my $line=) { my @line_a=split(/\,/,$line); my $customer_id=$line_a[3]; print "$customer_id\n"; $cust_smh = $customer_dbh-prepare("SELECT phone_no from book where number = $line_a[0]"); $cust_smh-execute() or die "Couldn't execute stmt, error : $DBI::errstr"; my $number = $cust_smh-fetchrow_array(); $line_a[3]=$number; }

    Read the article

  • consts and other animals

    - by bks
    Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

    Read the article

  • Same-directory includes failing on a Fedora server with PHP.

    - by JimmySawczuk
    I have a couple files that look like this: index.php: <?php include('includes/header.php'); ... includes/header.php: <?php include('config.php'); ... The error I get is Warning: require(config.php) [function.require]: failed to open stream: No such file or directory in [dir]/includes/header.php on line 2 Fatal error: require() [function.require]: Failed opening required 'config.php' (include_path='.:/usr/share/pear:/usr/share/php') in [dir]/includes/header.php on line 2 I did some further debugging: when I add the call system('pwd'); to includes/header.php, it shows [dir], where it should say [dir]/includes. Adding the 'includes/' to the include path works, but isn't desirable because that would fail on the production server. The above code works on a production server, and worked fine on my development Fedora server, until I tried to change my development environment so that the Fedora server's document root is a mounted CIFS share. Any ideas? Thanks.

    Read the article

  • Flash AS3: automate property assignment to new instance from arguments in constructor

    - by matt lohkamp
    I like finding out about tricky new ways to do things. Let's say you've got a class with a property that gets set to the value of an argument in the constructor, like so: package{ public class SomeClass{ private var someProperty:*; public function SomeClass(_someProperty:*):void{ someProperty = _someProperty; } } } That's not exactly a hassle. But imagine you've got... I don't know, five properties. Ten properties, maybe. Rather then writing out each individual assignment, line by line, isn't there a way to loop through the constructor's arguments and set the value of each corresponding property on the new instance accordingly? I don't think that the ...rest or arguments objects will work, since they only keep an enumerated list of the arguments, not the argument names - I'm thinking something like this would be better: for(var propertyName:String in argsAsAssocArray){this[propertyName] = argsAsAssocArray[propertyName];} ... does something like this exist?

    Read the article

  • how to show the right word in my code, my code is : os.urandom(64)

    - by zjm1126
    My code is: print os.urandom(64) which outputs: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" \xd0\xc8=<\xdbD' \xdf\xf0\xb3>\xfc\xf2\x99\x93 =S\xb2\xcd'\xdbD\x8d\xd0\\xbc{&YkD[\xdd\x8b\xbd\x82\x9e\xad\xd5\x90\x90\xdcD9\xbf9.\xeb\x9b>\xef#n\x84 which isn't readable, so I tried this: print os.urandom(64).decode("utf-8") but then I get: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" Traceback (most recent call last): File "D:\zjm_code\a.py", line 17, in <module> print os.urandom(64).decode("utf-8") File "D:\Python25\lib\encodings\utf_8.py", line 16, in decode return codecs.utf_8_decode(input, errors, True) UnicodeDecodeError: 'utf8' codec can't decode bytes in position 0-3: invalid data What should I do to get human-readable output?

    Read the article

  • Estimate Shipping and Tax problem in magento

    - by Ela
    When i added a product and go into Shopping Cart page it does not displaying the standard shipping calculations and once i get into the checkout page and from there when i try to edit the shopping cart it shows the estimate price calculation. Please some one help me

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >