Search Results

Search found 28707 results on 1149 pages for 'writing your own'.

Page 583/1149 | < Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >

  • SWIG interface file questions

    - by morpheous
    I am writing a C/C++ extension module for other languages and I am using SWIG to generate the bindings. I have two questions Can I include more than 1 header file in the declaration part of the interface file e.g.: /* Declarations exposed to wrapper: */ > %{ > #define SWIG_FILE_WITH_INIT > #include "a.h" > #include "b.h" > #include "c.h" %} In all of the examples I have seen so far, after the header include declaration (as shown above), the functions declared in the header are then declared again in the interface file. Is this really necessary, as it means there are two copies of the function declarations that need to be maintained. Note: I can appreciate that some functions/methods declaration may need to be 'decorated' with the 'newobject' declaration so these obviously need to be in the interface file, to avoid memory leaks - however, I would have though that it would be sufficient to include the headers and then ONLY the declarations of the functions/methods that need to be declared with 'newobject' - is this recommended way of doing things?

    Read the article

  • How to trigger Mouse-Over on iPhone?

    - by Andrew
    This might seem like a really dumb question, but I am writing an application and I have come across where my mouse-over, mouse-click and mouse-hover need different events bound to them. Now on Internet Explorer, Firefox, and Safari. It all works as expected. However, on my iPhone the actions will not trigger. Now my question is are their any specific ways I can have the Mouse-Over essentially be fired when I hold my finger down and trigger an event? An example where this doesn't work is right on this website when you hover over a comment it is supposed to display the +1 or flag icon. I am using jquery.

    Read the article

  • C++ performance when accessing class members

    - by Dr. Acula
    I'm writing something performance-critical and wanted to know if it could make a difference if I use: int test( int a, int b, int c ) { // Do millions of calculations with a, b, c } or class myStorage { public: int a, b, c; }; int test( myStorage values ) { // Do millions of calculations with values.a, values.b, values.c } Does this basically result in similar code? Is there an extra overhead of accessing the class members? I'm sure that this is clear to an expert in C++ so I won't try and write an unrealistic benchmark for it right now

    Read the article

  • Facebook action and object submission

    - by tijanja
    Am new to Facebook sdk and i want to use it in my project (blackberry app) has the developer i tried writing to my timeline with the code blow through a web service and i was able to write to my timeline, my question is this must i create an action and object that must be submitted for approval before other users can use my app to write to their timeline? because permission are not granted when users try to write to their timeline. $ret_obj = $facebook->api('/me/feed', 'POST',array('link' => 'www.****.com','message' => $user_profile["name"].' just downloaded W1')); echo '<pre>Post ID: ' . $ret_obj['id'] . '</pre>';

    Read the article

  • What happens when I MPI_Send to a process that has finished?

    - by nieldw
    What happens when I MPI_Send to a process that has finished? I am learning MPI, and writing a small sugar distribution-simulation in C. When the factories stop producing, those processes end. When warehouses run empty, they end. Can I somehow tell if the shop's order to a warehouse did not succeed(because the warehouse process has ended) by looking at the return value of MPI_Send? The documentation doesn't mention a specific error code for this situation, but that no error is returned for success. Can I do: if (MPI_Send(...)) { ... /* destination has ended */ ... } And disregard the error code? Thanks

    Read the article

  • TDD, Unit Test and architectural changes

    - by Leandro
    I'm writing an RPC middleware in C++. I have a class named RPCClientProxy that contains a socket client inside: class RPCClientProxy { ... private: Socket* pSocket; ... } The constructor: RPCClientProxy::RPCClientProxy(host, port) { pSocket = new Socket(host, port); } As you can see, I don't need to tell the user that I have a socket inside. Although, to make unit tests for my proxies it would be necessary to create mocks for sockets and pass them to the proxies, and to do so I must use a setter or pass a factory to the sockets in the proxies's constructors. My question: According to TDD, is it acceptable to do it ONLY because the tests? As you can see, these changes would change the way the library is used by a programmer.

    Read the article

  • Is it a header file or library? in a makefile

    - by gccinac
    I already know the differences between a header file and a library. However, when I'm writing my makefile, I have some difficulties on deciding if I should put something as a dependency of the file or just at the linking rule. For example: I have 2 simple files: main.c: #include <stdio.h> main(){ printf("this is the sine or 90"); sinus(90); } and func.c: #include <math.h> sinus(int num){ return sin(num); } and my makefile is: main: main.o func.o gcc main.o func.o -lm -o main func.o: func.c main.o: main.c Well, my question is why this makefile works and this one doesn't: main: main.o func.o gcc main.o func.o -lm -o main func.o: func.c math.h main.o: main.c

    Read the article

  • How to explain to a developer that adding extra if - else if conditions is not a good way to "improv

    - by Lilit
    Recently I've bumped into the following C++ code: if (a) { f(); } else if (b) { f(); } else if (c) { f(); } Where a, b and c are all different conditions, and they are not very short. I tried to change the code to: if (a || b || c) { f(); } But the author opposed saying that my change will decrease readability of the code. I had two arguments: 1) You should not increase readability by replacing one branching statement with three (though I really doubt that it's possible to make code more readable by using else if instead of ||). 2) It's not the fastest code, and no compiler will optimize this. But my arguments did not convince him. What would you tell a programmer writing such a code? Do you think complex condition is an excuse for using else if instead of OR?

    Read the article

  • .NET Regular Expressions - Shorter match

    - by Xavier
    Hi Guys, I have a question regarding .NET regular expressions and how it defines matches. I am writing: var regex = new Regex("<tr><td>1</td><td>(.+)</td><td>(.+)</td>"); if (regex.IsMatch(str)) { var groups = regex.Match(str).Groups; var matches = new List<string>(); for (int i = 1; i < groups.Count; i++) matches.Add(groups[i].Value); return matches; } What I want is get the content of the two following tags. Instead it returns: [0]: Cell 1</td><td>Cell 2</td>... [1]: Last row of the table Why is the first match taking </td> and the rest of the string instead of stopping at </td>?

    Read the article

  • networkstream always empty!

    - by ALEX
    hey I'm writing on an Server-Client program but when my client sends something, it never reaches my server! I'm sending like this: public void Send(string s) { char[] chars = s.ToCharArray(); byte[] bytes = chars.CharToByte(); nstream.Write(bytes, 0, bytes.Length); nstream.Flush(); } and Receiving in a background thread like this void CheckIncoming(object dd) { RecievedDelegate d = (RecievedDelegate)dd; try { while (true) { List<byte> bytelist = new List<byte>(); System.Threading.Thread.Sleep(1000); int ssss; ssss = nstream.ReadByte(); if (ssss > 1) { System.Diagnostics.Debugger.Break(); } if (bytelist.Count != 0) { d.Invoke(bytelist.ToArray()); } } } catch (Exception exp) { MSGBOX("ERROR:\n" + exp.Message); } } the ssss int is never 1 whats happening here???

    Read the article

  • Android - Opening phone deletes app state

    - by Tom G
    Hey everyone, I'm writing an android application that maintains a lot of "state" data...some of it I can save in the form of onSaveInstanceState but some of it is just to complex to save in memory. My problem is that sliding the phone open destroys/recreates the app, and I lose all my application state in the process. The same thing happens with the "back" button, but I overloaded that function on my way. Is there any way to overload the phone opening to prevent it from happening? Thanks in advance.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Call a non member funcion on an instance before is constructed.

    - by Tom
    Hi everyone. I'm writing a class, and this doubt came up. Is this undef. behaviour? On the other hand, I'm not sure its recommended, or if its a good practice. Is it one if I ensure no exceptions to be thrown in the init function? //c.h class C{ float vx,vy; friend void init(C& c); public: C(); ~C(); }; //c.cpp C::C() { init(*this); } void init(C& c) //throws() to ensure no exceptions ? { c.vx = 0; c.vy = 0; } Thanks in advance

    Read the article

  • How to write a xpath to match all elements except a particular element

    - by Unmesh Kondolikar
    I am writing an XSL transformation. I want to write a template which matches all the child elements of the document except one particular node. My xml looks like this - <Document> <NodeA><\NodeA> <NodeB><\NodeB> <ServiceNode><\ServiceNode> <NodeX><\NodeX> </Document> I want to write a template that matches all nodes except ServiceNode i.e. NodeA to NodeX. How to write this Xpath to get - <xsl:template match="ALL Nodex Except ServiceNode">

    Read the article

  • How to track conversion rate (clicks to sales) from an internal advertising system?

    - by Ed Woodcock
    I am currently writing an interal advertising system for a company client's website, where the adverts will only be seen by internal users, and all transactions take place internally to the site (i.e. the adverts are for member-only content available on the site). Does anyone have any recommendations as to the best way to track the conversion rate of these adverts (i.e. views:clicks:sales)? EDIT I'm not looking for a 'Why don't you use google analystics'-type answer, I'm looking into possible architecture outlines, i.e. a 'why don't use store a guid in a cache temporarily and see if it ties to the advert' kind of answer. /EDIT In a previous job I did something based on an internal cache, which simply did view:click tracking, however the addition of the sales rate makes this task more complex, especially if we take into account the idea that someone may click through to an advert and not purchase immediately. Cheers, Ed (N.B. I'm leaving this purposely vague in order to (hopefully) get some answers that provide ideas I've yet to have thought of by coming at the problem from a different angle)

    Read the article

  • What is a good way to simulate O_NOFOLLOW on systems without this flag?

    - by Daniel Trebbien
    I would like to safely be able to simulate open with O_CREAT | O_WRONLY | O_TRUNC | O_NOFOLLOW and O_CREAT | O_WRONLY | O_APPEND | O_NOFOLLOW on systems that do not support O_NOFOLLOW. I can somewhat achieve what I am asking for with: struct stat lst; if (lstat(filename, &lst) != -1 && S_ISLNK(lst.st_mode)) { errno = ELOOP; return -1; } mode_t mode = S_IRUSR | S_IWUSR | S_IRGRP | S_IWGRP | S_IROTH | S_IWOTH; int fd = open(filename, O_CREAT | O_WRONLY | O_TRUNC | O_NOFOLLOW, mode); but then I introduce a race condition and possibly a security problem. I thought about maybe creating a dummy file with only the user being able to write, kind of like touching filename, doing the lstat check, and then using chmod after I finish writing (to correct the file mode bits), but I could be overlooking something major (e.g. if the file at filename exists, is not a regular file, or is already a symbolic link). What do you think?

    Read the article

  • How to properly design a simple favorites and blocked table?

    - by Nils Riedemann
    Hey, i am currently writing a webapp in rails where users can mark items as favorites and also block them. I came up two ways and wondered which one is more common/better way. 1. Separate join tables Would it be wise to have 2 tables for this? Like: users_favorites - user_id - item_id users_blocked - user_id - item_id 2. single table users_marks (or so) - users_id - item_id - type (["fav", "blk"]) Both ways seem to have advantages. Which one would you use and why?

    Read the article

  • In web project can we write core services layer without knowledge of UI ?

    - by Silent Warrior
    I am working on web project. We are using flex as UI layer. My question is often we are writing core service layer separately from web/UI layer so we can reuse same services for different UI layer/technology. So practically is it possible to reuse same core layer services without any changes/addition in API with different kind of UI technologies/layers. For e.g. same core service layer with UI technology which supports synchronized request response (e.g. jsp etc.) and non synchronize or event driven UI technology (e.g Ajax, Flex, GWT etc.) or with multiple devices like (computers, mobiles, pdas etc.). Personally I feel its very tough to write core service layer without any knowledge of UI. Looking for thoughts from other people.

    Read the article

  • PHP: How to begin testing large, existing codebase, and test for regression on production site?

    - by anonymous coward
    I'm in charge of at least one large body of existing PHP code, that desperately needs tests, and as well I need some method of checking the production site for errors. I've been working with PHP for many years, but am unfortunately new to testing. (Sorry!). While writing tests for code that has predictable outcomes seems easy enough, I'm having trouble wrapping my head around just how I can test the live site, to ensure proper output. I know that in a test environment, I could set up the database in a known state... but are there proper methods or techniques for testing a live site? Where should I begin? [I am aware of PHPUnit and SimpleTest, but haven't chosen one over the other yet]

    Read the article

  • How can I show my activity(screen) on top of in-calling screen?

    - by upright
    Hi, all! I'm writing an android application which listens the phone calling events. What I want to do is, if there is a call incomes or outgoes, an activity shows with my customized info. I want to this screen keeps showing during the calling period. However, if a call is coming, the system UI which shows the contact always appears on top of my activity. I've found some apps already realized this function, but mine can't. :( Is there any way that I can achieve my goal? Any help will be appreciated.

    Read the article

  • How do I compare vectors in C++?

    - by Sam Phelps
    I am trying to compare two vector objects, and return a single vector containing all the chars which appear in both vectors. How would I go about this without writing some horribly complex manual method which compares every char in the first vector to every char in the second vector and using an if to add it to a third vector (which would be returned) if they match. Maybe my lack of real experience with vectors is making me imagine this will be harder than it really is, but I suspect there is some simplier way which I have been unable to find through searching.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • Highlighting current and previous stars on mouseover

    - by mpet
    I'm trying to make simple five star rating system using Twitter Bootstrap 3 i jQuery. For now, I'm trying to set .hover() and .mouseout() events using counter by writing this code that doesn't work: var i; for (i = 1; i <= 5; i++) { $('#overall_rating_' + i).hover(function(){ $('#overall_rating_' + i).removeClass("glyphicon-star-empty").addClass("glyphicon-star"); }); $('#overall_rating_' + i).mouseout(function(){ $('#overall_rating_' + i).removeClass("glyphicon-star").addClass("glyphicon-star-empty"); }); } Trying to highlight current and previous stars on mouseover. The code is not complete, it would be accompanied by additional sub-counters, but this part doesn't work for now. Any better methods are welcome. What's broken here?

    Read the article

  • Reduce text length to fit cell width in a smart manner

    - by Andrei Ciobanu
    Hello, I am in project where we are building a simple web calendar using Java EE technologies. We define a table where every row is an employee, and every column represents an hour interval. The table width and column widths are adjustable. In every cell we have a text retrieved from a database, indicating what the employee is doing / should do in that time interval. The problem is that sometimes the text in cells is getting bigger than the actual cell. My task is to make the text more "readable" by reducing it's length in a "smart way" so that it can fit in the cell more "gracefully". For example if initially in a cell I have: "Writing documents", after the resize I should retrieve: "Wrtng. dcmnts" or "Writ. docum." so that the text can fit well. Is there a smart way to do it ? Or removing vocals / split the string in two is enough ?

    Read the article

  • How much RAM used by Python dict or list?

    - by Who8MyLunch
    My problem: I am writing a simple Python tool to help me visualize my data as a function of many parameters. Each change in parameters involves a non-trivial amount of time, so I would like to cache each step's resulting imagery and supporting data in a dictionary. But then I worry that this dictionary could grow too large over time. Most of my data is in the form of Numpy arrays. My question: How would one go about computing the total number of bytes used by a Python dictionary. The dictionary itself may contain lists and other dictionaries, each of which contain data stored in Numpy arrays. Ideas?

    Read the article

< Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >