Search Results

Search found 28707 results on 1149 pages for 'writing your own'.

Page 582/1149 | < Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >

  • Rails 3 - raw/html_safe not working in some cases?

    - by Frexuz
    I'm having difficulties with output not being encoded even though I'm using raw or html_safe. This one is writing out the &nbsp in my final HTLM page. def build_tag_cloud(tag_cloud, style_list) tag_cloud.sort!{ |x,y| x.permalink <=> y.permalink } max, min = 0, 0 tag_cloud.each do |tag| max = tag.followers.to_i if tag.followers.to_i > max min = tag.followers.to_i if tag.followers.to_i < min end divisor = ((max - min) / style_list.size) + 1 html = "" tag_cloud.each do |tag| name = raw(tag.name.gsub('&','&amp;').gsub(' ','&nbsp;')) link = raw(link_to "#{name}", {:controller => "/shows", :action => "show", :permalink => tag.permalink}, :class => "#{style_list[(tag.followers.to_i - min) / divisor]}") html += raw("<li>#{link}</li> ") end return raw(html.to_s) end What is allowed in using raw and html_safe? And how should my example above be fixed?

    Read the article

  • SVN user guidelines

    - by Oliver Moran
    I have been tasked with writing a set of user guidelines for SVN for developers in my company. The guidelines are to be solely from a user perspective (e.g. commit comments, when to commit) and not from an administrative perspective (e.g. when to tag, how to structure). An administrative guideline will be written in a separate document. We are an app development house involved also in embedded development. So our developers range from HTML5 and Flash to Java and C. Some of our coding involves forking very large (millions of files) code bases. Other parts involve us engaging in ground-up development. Are there any best practices for use of SVN from a user (i.e. grunt developer) perspective?

    Read the article

  • I need a very simple PHP database front-end admin panel; a simple records editor for a specified tab

    - by Lansen Q
    Hi there, I am looking to add some dynamics to our corporate website. This is a secondary role so I'd rather not be spending a ton of time on it. At this point, all I need is a simple PHP script where a non-technical user can pull up and manage the records in a MySQL table. There's only one table of data to be managed; it's just that it will be accessed and updated quite frequently. I recall that Grails' default scaffolding feature has precisely this: list of entries with the ability to add, edit and delete, with no nonsense. What would be the best tool to use for this? I would rather not be writing it from scratch, as this will take me quite some time. It seems like the kind of thing that ought to exist somewhere. Thanks!

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • SetWindowLongPtr with DialogBoxParam?

    - by templatetypedef
    Hey all- A while back I was writing a C++ program with the Win32 API that would display a dialog box and then listen to the messages it generated. At one point, I was interested in associating a piece of data with the dialog window. Were I manually creating the window and attaching a window proc, I'd just use SetWindowLongPtr to set the GWLP_USERDATA field to a pointer to the data to associate. However, in this case I was creating and displaying the window with DialogBoxParam, and it wasn't clear whether this function was associating that data with its own internal state. Since the MSDN didn't have a description of what would happen in this case, I ended up using some other approach to solve the problem. My question is this - is it safe to use SetWindowLongPtr to overwrite the GWLP_USERDATA value in a window created by DialogBoxParam? Thanks!

    Read the article

  • Highlighting current and previous stars on mouseover

    - by mpet
    I'm trying to make simple five star rating system using Twitter Bootstrap 3 i jQuery. For now, I'm trying to set .hover() and .mouseout() events using counter by writing this code that doesn't work: var i; for (i = 1; i <= 5; i++) { $('#overall_rating_' + i).hover(function(){ $('#overall_rating_' + i).removeClass("glyphicon-star-empty").addClass("glyphicon-star"); }); $('#overall_rating_' + i).mouseout(function(){ $('#overall_rating_' + i).removeClass("glyphicon-star").addClass("glyphicon-star-empty"); }); } Trying to highlight current and previous stars on mouseover. The code is not complete, it would be accompanied by additional sub-counters, but this part doesn't work for now. Any better methods are welcome. What's broken here?

    Read the article

  • Is there a way in C# 4.0 to have a method take a delegate with the parameters baked in?

    - by Rob Packwood
    I have this code for reporting on a simple demo app I am writing: private static void ReportOnTimedProcess(Action process) { var stopwatch = new Stopwatch(); stopwatch.Start(); process(); stopwatch.Stop(); Console.WriteLine("Process took {0} seconds", stopwatch.ElapsedMilliseconds*1000); } I basically want to track the time of any process. I am trying to have this method take a delegate as a parameter that can have any number of varying parameters. Is there some way an Expression can do this?

    Read the article

  • Boost ASIO read X bytes synchroniously into a vector

    - by xeross
    Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

    Read the article

  • How to prevent inputting Russian characters in Word with a Word addin?

    - by Edwin
    Hi, Sorry for this vaguely described problem, but please look at the problem from the Win32 API's perspective. I'm writing a Word addin using Addin Express with Delphi, and I use some other 3rd party VCL's also, including virtual stringtree, TNT controls, etc. Now I cannot input Russian characters in Word anymore, but I can input English and Chinese.... Since it's a large project I don't know where to start finding the problem, would you give me some generic tips, I'll be appreciated that! Thank you, and have a nice day!

    Read the article

  • What's the advantage of an Adobe AIR app over a traditional desktop app?

    - by John
    I'm pretty familiar with using Adobe Flex & AS3, and compared with writing apps in JS/HTML I think it's very cool. However, since AIR is essentially a non-browser version of Flex with benefits like local storage, it seems to be competing as a cross-platform desktop application platform... and in that space it's much less mature than more established desktop technologies. So what's the advantage of creating a desktop application using AIR compared to something like Java (or C++ using a cross-platform GUI library like wxWidgets)? Java's equally capable of communicating with the server for instance, I'm not quite sure what AIR adds when competing head-to-head in the desktop development world?

    Read the article

  • What format is your documentation in?

    - by Ek0nomik
    I am going to be writing documentation for two web services that I developed, and I started wondering what people on here do for documentation. Do you create it in an HTML file so it can be viewed in the browser? Word document? Wiki? What do you guys/gals use? I was originally leaning towards creating an HTML page since it seems a little more open and friendly than a word document. Plus I can use the prettify javascript to make code samples look nice. Our company has a Sharepoint though, so an HTML file may not be the best choice given that most documentation is put up in spreadsheets and word documents.

    Read the article

  • Extension methods on a static object

    - by Max Malygin
    I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

    Read the article

  • How to setup custom CSS based on account settings in a Django site?

    - by sdolan
    So I'm writing a Django based website that allows users select a color scheme through an administration interface. I already have middleware/context processors that links the current request (based on domain) to the account. My question is how to dynamically serve the CSS with the account's custom color scheme. I see two options: Add a CSS block to the base template that overrides the styles w/variables passed in through a context processors. Use a custom URL (e.g. "/static/dynamic/css//styles.css") that gets routed to a view that grabs all the necessary values and creates the css file. I'm content with either option, but was wondering if anyone else out there has dealt with similar problems and could give some insight as to "Best Practices".

    Read the article

  • Test Driven Development (TDD) with Rails

    - by macek
    I am looking for TDD resources that are specific to Rails. I've seen the Rails Guide: The Basics of Creating a Rails Plugin which really spurred my interest in the topic. I have the Agile Development with Rails book and I see there's some testing-related information there. However, it seems like the author takes you through the steps of building the app, then adds testing afterward. This isn't really Test Driven Development. Ideally, I'd like a book on this, but a collection of other tutorials or articles would be great if such a book doesn't exist. Things I'd like to learn: Primary goal: Best Practices Unit testing How to utilize Fixtures Possibly using existing development data in place of fixtures What's the community standard here? Writing tests for plugins Testing with session data User is logged in User can access URL /foo/bar Testing success of sending email Thanks for any help!

    Read the article

  • Is 'bool' a basic datatype in C++ ?

    - by Naveen
    I got this doubt while writing some code. Is 'bool' a basic datatype defined in the C++ standard or is it some sort of extension provided by the compiler ? I got this doubt because Win32 has 'BOOL' which is nothing but a typedef of long. Also what happens if I do something like this: int i = true; Is it "always" guaranteed that variable i will have value 1 or is it again depends on the compiler I am using ? Further for some Win32 APIs which accept BOOL as the parameter what happens if I pass bool variable?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Likelihood of IOError during print vs. write

    - by jkasnicki
    I recently encountered an IOError writing to a file on NFS. There wasn't a disk space or permission issue, so I assume this was just a network hiccup. The obvious solution is to wrap the write in a try-except, but I was curious whether the implementation of print and write in Python make either of the following more or less likely to raise IOError: f_print = open('print.txt', 'w') print >>f_print, 'test_print' f_print.close() vs. f_write = open('write.txt', 'w') f_write.write('test_write\n') f_write.close() (If it matters, specifically in Python 2.4 on Linux).

    Read the article

  • Idea for doing almost same work in both catch & finally(C#3.0)

    - by Newbie
    I have a requirement. I am processing some files and after the processing are done I am archiving those files into an archive folder with timestamp appended. The file archiving and putting time stamp portion I am doing in the Finally block. Now a new requirement has come where I need to mail if something wrong goes in the original files and then I need to archive the same. Now this piece of code I need to handle in the catch block. But if I write the code entirely in the catch block, then it will fire only if there is an exception; otherwise not. So basically I am writing the same pice of code in both the catch and finally block. What is the standard and recommended approach you people think will be better in this case? I am using C#3.0 Thanks.

    Read the article

  • How to write a xpath to match all elements except a particular element

    - by Unmesh Kondolikar
    I am writing an XSL transformation. I want to write a template which matches all the child elements of the document except one particular node. My xml looks like this - <Document> <NodeA><\NodeA> <NodeB><\NodeB> <ServiceNode><\ServiceNode> <NodeX><\NodeX> </Document> I want to write a template that matches all nodes except ServiceNode i.e. NodeA to NodeX. How to write this Xpath to get - <xsl:template match="ALL Nodex Except ServiceNode">

    Read the article

  • Python: How to use code.InteractiveConsole?

    - by Rosarch
    I'm trying to use InteractiveConsole to create a new front-end for a Python interpreter. These code fragments are from me playing around with InteractiveConsole in IDLE: >>> ses = code.InteractiveConsole() >>> ses.runsource("def foo():") True >>> ses.runsource(" return 2") File "<input>", line 1 SyntaxError: 'return' outside function (<input>, line 1) False Why does it raise a syntax error? How else can I finish writing the function? Also, for something like this: >>> ses.runsource("x = 1") False >>> ses.runsource("x") 1 False How can I capture the 1 value from above? False is the return value, but 1 is written to some stream.

    Read the article

  • does anyone see any issues with this thread pattern?

    - by prmatta
    Here is a simple thread pattern that I use when writing a class that needs just one thread, and needs to a specific task. The usual requirements for such a class are that it should be startable, stopable and restartable. Does anyone see any issues with this pattern that I use? public class MyThread implements Runnable { private boolean _exit = false; private Thread _thread = null; public void start () { if (_thread == null) { _thread = new Thread(this, "MyThread"); _thread.start(); } } public void run () { while (_exit) { //do something } } public void stop () { _exit = true; if (_thread != null) { _thread.interrupt(); _thread = null; } } } I am looking for comments around if I am missing something, or if there is a better way to write this.

    Read the article

  • Log4J - Speed of resolving class/method/line references

    - by Jeach
    Does log4J still gather the class, method and line numbers by generating exceptions and inspecting the stack trace? Or has Java been optimized since Sun included their own logging framework. If not, why has there not been any optimizations made since. What is the main challenges in obtaining class, method and line numbers quickly and efficiently? Although I hate annotations and try to avoid them, has log4J not made use of this, such as: @log4j-class MyClass @log4j-method currentMethodOne At least this would avoid some companies bad habit of repeatedly writing/copying the method name as the first part of their logging message (which is seriously annoying). Thanks, Jeach!

    Read the article

  • TDD, Unit Test and architectural changes

    - by Leandro
    I'm writing an RPC middleware in C++. I have a class named RPCClientProxy that contains a socket client inside: class RPCClientProxy { ... private: Socket* pSocket; ... } The constructor: RPCClientProxy::RPCClientProxy(host, port) { pSocket = new Socket(host, port); } As you can see, I don't need to tell the user that I have a socket inside. Although, to make unit tests for my proxies it would be necessary to create mocks for sockets and pass them to the proxies, and to do so I must use a setter or pass a factory to the sockets in the proxies's constructors. My question: According to TDD, is it acceptable to do it ONLY because the tests? As you can see, these changes would change the way the library is used by a programmer.

    Read the article

  • How to access constant defined in child class?

    - by kavoir.com
    I saw this example from php.net: <?php class MyClass { const MY_CONST = "yonder"; public function __construct() { $c = get_class( $this ); echo $c::MY_CONST; } } class ChildClass extends MyClass { const MY_CONST = "bar"; } $x = new ChildClass(); // prints 'bar' $y = new MyClass(); // prints 'yonder' ?> But $c::MY_CONST is only recognized in version 5.3.0 or later. The class I'm writing may be distributed a lot. Basically, I have defined a constant in ChildClass and one of the functions in MyClass (father class) needs to use the constant. Any idea?

    Read the article

  • Performance when accessing class members

    - by Dr. Acula
    I'm writing something performance-critical and wanted to know if it could make a difference if I use: int test( int a, int b, int c ) { // Do millions of calculations with a, b, c } or class myStorage { public: int a, b, c; }; int test( myStorage values ) { // Do millions of calculations with values.a, values.b, values.c } Does this basically result in similar code? Is there an extra overhead of accessing the class members? I'm sure that this is clear to an expert in C++ so I won't try and write an unrealistic benchmark for it right now

    Read the article

< Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >