Search Results

Search found 16166 results on 647 pages for 'conexant high def audio'.

Page 603/647 | < Previous Page | 599 600 601 602 603 604 605 606 607 608 609 610  | Next Page >

  • Nested attributes form for model which belongs_to few models

    - by ExiRe
    I have few models - User, Teacher and TeacherLeader. class User < ActiveRecord::Base attr_accessible ..., :teacher_attributes has_one :teacher has_one :teacher_leader accepts_nested_attributes_for :teacher_leader end class Teacher < ActiveRecord::Base belongs_to :user has_one :teacher_leader end class TeacherLeader < ActiveRecord::Base belongs_to :user belongs_to :teacher end I would like to fill TeacherLeader via nested attributes. So, i do such things in controller: class TeacherLeadersController < ApplicationController ... def new @user = User.new @teacher_leader = @user.build_teacher_leader @teachers_collection = Teacher.all.collect do |t| [ "#{t.teacher_last_name} #{t.teacher_first_name} #{t.teacher_middle_name}", t.id ] end @choosen_teacher = @teachers_collection.first.last unless @teachers_collection.empty? end end And also have such view (new.html.erb): <%= form_for @user, :url => teacher_leaders_url, :html => {:class => "form-horizontal"} do |f| %> <%= field_set_tag do %> <% f.fields_for :teacher_leader do |tl| %> <div class="control-group"> <%= tl.label :teacher_id, "Teacher names", :class => "control-label" %> <div class="controls"> <%= select_tag( :teacher_id, options_for_select( @teachers_collection, @choosen_teacher )) %> </div> </div> <% end %> <div class="control-group"> <%= f.label :user_login, "Login", :class => "control-label" %> <div class="controls"> <%= f.text_field :user_login, :placeholder => @everpresent_field_placeholder %> </div> </div> <div class="control-group"> <%= f.label :password, "Pass", :class => "control-label" %> <div class="controls"> <%= f.text_field :password, :placeholder => @everpresent_field_placeholder %> </div> </div> <% end %> <%= f.submit "Create", :class => "btn btn-large btn-success" %> <% end %> Problem is that select form here does NOT appear. Why? Do i do something wrong?

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

    - by Globalkeith
    Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

    Read the article

  • Using JSON Data to Populate a Google Map with Database Objects

    - by MikeH
    I'm revising this question after reading the resources mentioned in the original answers and working through implementing it. I'm using the google maps api to integrate a map into my Rails site. I have a markets model with the following columns: ID, name, address, lat, lng. On my markets/index view, I want to populate a map with all the markets in my markets table. I'm trying to output @markets as json data, and that's where I'm running into problems. I have the basic map displaying, but right now it's just a blank map. I'm following the tutorials very closely, but I can't get the markers to generate dynamically from the json. Any help is much appreciated! Here's my setup: Markets Controller: def index @markets = Market.filter_city(params[:filter]) respond_to do |format| format.html # index.html.erb format.json { render :json => @market} format.xml { render :xml => @market } end end Markets/index view: <head> <script type="text/javascript" src="http://www.google.com/jsapi?key=GOOGLE KEY REDACTED, BUT IT'S THERE" > </script> <script type="text/javascript"> var markets = <%= @markets.to_json %>; </script> <script type="text/javascript" charset="utf-8"> google.load("maps", "2.x"); google.load("jquery", "1.3.2"); </script> </head> <body> <div id="map" style="width:400px; height:300px;"></div> </body> Public/javascripts/application.js: function initialize() { if (GBrowserIsCompatible() && typeof markets != 'undefined') { var map = new GMap2(document.getElementById("map")); map.setCenter(new GLatLng(40.7371, -73.9903), 13); map.addControl(new GLargeMapControl()); function createMarker(latlng, market) { var marker = new GMarker(latlng); var html="<strong>"+market.name+"</strong><br />"+market.address; GEvent.addListener(marker,"click", function() { map.openInfoWindowHtml(latlng, html); }); return marker; } var bounds = new GLatLngBounds; for (var i = 0; i < markets.length; i++) { var latlng=new GLatLng(markets[i].lat,markets[i].lng) bounds.extend(latlng); map.addOverlay(createMarker(latlng, markets[i])); } } } window.onload=initialize; window.onunload=GUnload;

    Read the article

  • Multiple layouts in rails [Newbie Q]

    - by BriteLite
    Hi. As a newb, I decided to build a "home inventory" application. I am now stuck on how to programmatically select a layout based on what type of item it is when viewing it in a browser. According to my planning, so far I should have created a few models to represent types of items I can find in my home: Furniture, Electronics and Books. class Book < ActiveRecord::Base end class Furniture < ActiveRecord::Base end class Electronic < ActiveRecord::Base end Now the Books model has things like isbn, pages, address, and category. Furniture model has things like color, price, address, and category. Electronics has things like name, voltage, address, and category. Here is where I got confused. I know the property address is going to be the same for all of them. I also know that, I will need to create multiple "layouts" for 3 different types of items to show the different properties of said items with appropriate graphics and stylesheets. But how will I go about deciding which category the item is so I can determine which layout to render. According to me, this is how I will do it: class DisplayController < ApplicationController def display @item = Params[:item] if @item.category = "electronics" render :layout => 'electronics' end end In my routes.rb map.display ':item', :controller => 'display', :action => 'display' I only seem to have one concern with this, I probably will add a lot of categories later on and think there should be a more DRY-esque way of dealing, rather than hardcoding them. I understand that I need to add into my layout html tags to display relevant information for that particular category. ----Questions---- Is this the right way to approach this type of problem. Will this approach be compatible when I decide to add a gem like *thinking_sphinx* to run search. What issues do you see with my approach and how can I make it better. I was reading something about "Polymorphic Assoc", does that apply in this case, since category exist for all items? Also, I was trying to get a routes to render a URL like "http://localhost/living-room-tv"

    Read the article

  • Dynamically loading modules in Python (+ threading question)

    - by morpheous
    I am writing a Python package which reads the list of modules (along with ancillary data) from a configuration file. I then want to iterate through each of the dynamically loaded modules and invoke a do_work() function in it which will spawn a new thread, so that the code runs in a separate thread. At the moment, I am importing the list of all known modules at the beginning of my main script - this is a nasty hack I feel, and is not very flexible, as well as being a maintenance pain. This is the function that spawns the threads. I will like to modify it to dynamically load the module when it is encountered. The key in the dictionary is the name of the module containing the code: def do_work(work_info): for (worker, dataset) in work_info.items(): #import the module defined by variable worker here... t = threading.Thread(target=worker.do_work, args=[dataset]) # I'll NOT dameonize since spawned children need to clean up on shutdown # Since the threads will be holding resources #t.daemon = True t.start() Question 1 When I call the function in my script (as written above), I get the following error: AttributeError: 'str' object has no attribute 'do_work' Which makes sense, since the dictionary key is a string (name of the module to be imported). When I add the statement: import worker before spawning the thread, I get the error: ImportError: No module named worker This is strange, since the variable name rather than the value it holds are being used - when I print the variable, I get the value (as I expect) whats going on? Question 2 As I mentioned in the comments section, I realize that the do_work() function written in the spawned children needs to cleanup after itself. My understanding is to write a clean_up function that is called when do_work() has completed successfully, or an unhandled exception is caught - is there anything more I need to do to ensure resources don't leak or leave the OS in an unstable state? Question 3 If I comment out the t.daemon flag statement, will the code stil run ASYNCHRONOUSLY?. The work carried out by the spawned children are pretty intensive, and I don't want to have to be waiting for one child to finish before spawning another child. BTW, I am aware that threading in Python is in reality, a kind of time sharing/slicing - thats ok Lastly is there a better (more Pythonic) way of doing what I'm trying to do?

    Read the article

  • How to use sound and images in a Java applet?

    - by Click Upvote
    Question 1: How should I structure my project so the sound and images files can be loaded most easily? Right now, I have the folder: C:\java\pacman with the sub-directory C:\java\pacman\src containing all the code, and C:\java\pacman\assets containing the images and .wav files. Is this the best structure or should I put the assets somewhere else? Question 2: What's the best way to refer to the images/sounds without using the full path e.g C:\java\pacman\assets\something.png to them? If I use the getCodeBase() function it seems to refer to the C:\java\pacman\bin instead of C:\java\pacman\. I want to use such a function/class which would work automatically when i compile the applet in a jar as well as right now when I test the applet through eclipse. Question 3: How should I load the images/sounds? This is what I'm using now: 1) For general images: import java.awt.Image; public Image getImg(String file) { //imgDir in this case is a hardcoded string containing //"C:\\java\\pacman\\assets\\" file=imgDir + file; return new ImageIcon(file).getImage(); } The images returned from this function are used in the drawImage method of the Graphics class in the paint method of the applet. 2) For a buffered image, which is used to get subImages and load sprites from a sprite sheet: public BufferedImage getSheet() throws IOException { return ImageIO.read(new File(img.getPath("pacman-sprites.png"))); } Later: public void loadSprites() { BufferedImage sheet; try { sheet=getSheet(); redGhost.setNormalImg(sheet.getSubimage(0, 60, 20, 20)); redGhost.setUpImg(sheet.getSubimage(0, 60, 20, 20)); redGhost.setDownImg(sheet.getSubimage(30, 60, 20, 20)); redGhost.setLeftImg(sheet.getSubimage(30, 60, 20, 20)); redGhost.setRightImg(sheet.getSubimage(60, 60, 20, 20)); } catch (IOException e) { System.out.println("Couldnt open file!"); System.out.println(e.getLocalizedMessage()); } } 3) For sound files: import sun.audio.*; import java.io.*; public synchronized void play() { try { InputStream in = new FileInputStream(filename); AudioStream as = new AudioStream(in); AudioPlayer.player.start(as); } catch (IOException e) { e.printStackTrace(); } }

    Read the article

  • validate uniqueness amongst multiple subclasses with Single Table Inheritance

    - by irkenInvader
    I have a Card model that has many Sets and a Set model that has many Cards through a Membership model: class Card < ActiveRecord::Base has_many :memberships has_many :sets, :through => :memberships end class Membership < ActiveRecord::Base belongs_to :card belongs_to :set validates_uniqueness_of :card_id, :scope => :set_id end class Set < ActiveRecord::Base has_many :memberships has_many :cards, :through => :memberships validates_presence_of :cards end I also have some sub-classes of the above using Single Table Inheritance: class FooCard < Card end class BarCard < Card end and class Expansion < Set end class GameSet < Set validates_size_of :cards, :is => 10 end All of the above is working as I intend. What I'm trying to figure out is how to validate that a Card can only belong to a single Expansion. I want the following to be invalid: some_cards = FooCard.all( :limit => 25 ) first_expansion = Expansion.new second_expansion = Expansion.new first_expansion.cards = some_cards second_expansion.cards = some_cards first_expansion.save # Valid second_expansion.save # **Should be invalid** However, GameSets should allow this behavior: other_cards = FooCard.all( :limit => 10 ) first_set = GameSet.new second_set = GameSet.new first_set.cards = other_cards # Valid second_set.cards = other_cards # Also valid I'm guessing that a validates_uniqueness_of call is needed somewhere, but I'm not sure where to put it. Any suggestions? UPDATE 1 I modified the Expansion class as sugested: class Expansion < Set validate :validates_uniqueness_of_cards def validates_uniqueness_of_cards membership = Membership.find( :first, :include => :set, :conditions => [ "card_id IN (?) AND sets.type = ?", self.cards.map(&:id), "Expansion" ] ) errors.add_to_base("a Card can only belong to a single Expansion") unless membership.nil? end end This works when creating initial expansions to validate that no current expansions contain the cards. However, this (falsely) invalidates future updates to the expansion with new cards. In other words: old_exp = Expansion.find(1) old_exp.card_ids # returns [1,2,3,4,5] new_exp = Expansion.new new_exp.card_ids = [6,7,8,9,10] new_exp.save # returns true new_exp.card_ids << [11,12] # no other Expansion contains these cards new_exp.valid? # returns false ... SHOULD be true

    Read the article

  • Can I take the voice data (f.e. in mp3 format) from speech recognition? [closed]

    - by Ersin Gulbahar
    Possible Duplicate: Android: Voice Recording and saving audio I mean ; I use voice recognition classes on android and I succeed voice recognition. But I want to real voice data not words instead of it. For example I said 'teacher' and android get you said teacher.Oh ok its good but I want to my voice which include 'teacher'.Where is it ? Can I take it and save another location? I use this class to speech to text : package net.viralpatel.android.speechtotextdemo; import java.util.ArrayList; import android.app.Activity; import android.content.ActivityNotFoundException; import android.content.Intent; import android.os.Bundle; import android.speech.RecognizerIntent; import android.view.Menu; import android.view.View; import android.widget.ImageButton; import android.widget.TextView; import android.widget.Toast; public class MainActivity extends Activity { protected static final int RESULT_SPEECH = 1; private ImageButton btnSpeak; private TextView txtText; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); txtText = (TextView) findViewById(R.id.txtText); btnSpeak = (ImageButton) findViewById(R.id.btnSpeak); btnSpeak.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View v) { Intent intent = new Intent( RecognizerIntent.ACTION_RECOGNIZE_SPEECH); intent.putExtra(RecognizerIntent.EXTRA_LANGUAGE_MODEL, "en-US"); try { startActivityForResult(intent, RESULT_SPEECH); txtText.setText(""); } catch (ActivityNotFoundException a) { Toast t = Toast.makeText(getApplicationContext(), "Ops! Your device doesn't support Speech to Text", Toast.LENGTH_SHORT); t.show(); } } }); } @Override public boolean onCreateOptionsMenu(Menu menu) { getMenuInflater().inflate(R.menu.activity_main, menu); return true; } @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { super.onActivityResult(requestCode, resultCode, data); switch (requestCode) { case RESULT_SPEECH: { if (resultCode == RESULT_OK && null != data) { ArrayList<String> text = data .getStringArrayListExtra(RecognizerIntent.EXTRA_RESULTS); txtText.setText(text.get(0)); } break; } } } } Thanks.

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • User authentication in Django. Problems with is_authenticated

    - by tim
    I have one problem with users menu. So, I want, that authenticated user can see his/her profile page and logout (links) in menu. It works (when I logging in) on index page: index, page1, profile, logout ,but, if I go to the, for example, page1 I can see in menu: index, page1, login, not profile and logout. How to fix it? in urls: url(r'^accounts/login/$', 'django.contrib.auth.views.login' ), url(r'^accounts/logout/$', 'django.contrib.auth.views.logout_then_login' ), url(r'^accounts/profile/$', 'my_app.views.profile' ), in views: def profile(request): if not request.user.is_authenticated(): return HttpResponseRedirect("/accounts/login/") else: user = request.user.is_authenticated() return render_to_response('profile.html',locals()) Part of index.html: {% if user.is_authenticated or request.user.is_authenticated %} <li><a href="/accounts/profile/">Profile</a></li> <li><a href="/accounts/logout/">logout</a></li> {% else %} <li><a href="/accounts/login/">login</a></li> {% endif %} login.html: {% extends "index.html" %} {% load url from future %} {% block application %} {% if form.errors %} <p>Try one more time</p> {% endif %} <form method="post" action="{% url 'django.contrib.auth.views.login' %}"> {% csrf_token %} <table> <tr> <td>{{ form.username.label_tag }}</td> <td>{{ form.username }}</td> </tr> <tr> <td>{{ form.password.label_tag }}</td> <td>{{ form.password }}</td> </tr> </table> <input type="submit" value="Login" /> <input type="hidden" name="next" value="{{ next }}" /> </form> {% endblock %} profile.html: {% extends "index.html" %} {% block application %} {% if request.user.is_authenticated %} <p>Welcome, {{ request.user.username }}. Thanks for logging in.</p> {% else %} <p>Welcome, new user. Please log in.</p> {% endif %} {% endblock %}

    Read the article

  • Python: (sampling with replacement): efficient algorithm to extract the set of UNIQUE N-tuples from a set

    - by Homunculus Reticulli
    I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

    Read the article

  • How to fix this Speech Recognition wicked bug?

    - by aF
    I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? NOTE: this project has some code that is allways being executed. Might that be the problem? Because the other code is running it doesn't allow it to this to run?

    Read the article

  • Action Cache for root URL not working

    - by askegg
    Here's the setup. I have web site which is essentially a simple CMS. Here is the routes file: map.connect ':url', :controller => :pages, :action => :show map.root :controller => :pages, :action => :show, :url => "/" The page controller is thus: class PagesController < ApplicationController before_filter :verify_access, :except => [:show] # Cache show action if we are not logged in. caches_action :show, :layout => false, :unless => Proc.new { |controller| controller.logged_in? } def update @page = Page.find(params[:id]) respond_to do |format| expire_action :action => :show, :url => @page.url So when a visitor hits "/" it maps to :controller = "pages, :action = "show, :url = "/". This generates a cached version on first try, then returns the appropriate result there after. The log files show: Processing PagesController#show (for 127.0.0.1 at 2009-08-02 14:15:01) [GET] Parameters: {"action"=>"show", "url"=>"/", "controller"=>"pages"} Cached fragment hit: views/out.local// (0.1ms) Rendering template within layouts/application Filter chain halted as [#<ActionController::Filters::AroundFilter:0x23eb03c @identifier=nil, @method=#<Proc:0x01904858@/Library/Ruby/Gems/1.8/gems/actionpack-2.3.3/lib/action_controller/caching/actions.rb:64>, @kind=:filter, @options={:only=>#<Set: {"show"}>, :if=>nil, :unless=>#<Proc:0x025137ac@/Users/askegg/Sites/out/app/controllers/pages_controller.rb:6>}>] did_not_yield. Completed in 2ms (View: 1, DB: 0) | 200 OK [http://out.local/] OK - all good so far. When I update the page, it should expire the cache (see above). The logs show: Page Load (0.2ms) SELECT * FROM "pages" WHERE ("pages"."id" = 3) Page Load (0.1ms) SELECT "pages".id FROM "pages" WHERE ("pages"."url" = '/' AND "pages".domain_id = 1 AND "pages".id <> 3) LIMIT 1 Expired fragment: views/out.local/index (0.1ms) Redirected to http://out.local/pages/3 Completed in 9ms (DB: 0) | 302 Found [http://out.local/pages/3] See the problem? Rails is clearing the cache named "index", but it sets it as "/". Naturally this results in the cache NOT being cleared, so visitors are now seeing the old version.

    Read the article

  • Strange behavior: save video recorded within app?

    - by Josue Espinosa
    I allow the user to record a video within my app, then later play it again. When a user records a video, I save the URL of the video, then play the video later from the saved URL. I save the video both in the Photos app and in my app. If I delete the video within the photos app, it still plays. After about 7 days, the video gets deleted. I think I am saving in my tmp directory, but i'm not sure. Here is what I am doing: -(void)imagePickerController:(UIImagePickerController *)picker didFinishPickingMediaWithInfo:(NSDictionary *)info { NSString *mediaType = [info objectForKey: UIImagePickerControllerMediaType]; [self dismissViewControllerAnimated:YES completion:nil]; // Handle a movie capture if (CFStringCompare ((__bridge_retained CFStringRef) mediaType, kUTTypeMovie, 0) == kCFCompareEqualTo) { NSString *moviePath = [NSString stringWithFormat:@"%@",[[info objectForKey:UIImagePickerControllerMediaURL] path]]; NSURL *videoURL = [info objectForKey:UIImagePickerControllerMediaURL]; NSData *videoData = [NSData dataWithContentsOfURL:videoURL]; _justRecordedVideoURL = [NSString stringWithFormat:@"%@",videoURL]; AppDelegate *appDelegate = [[UIApplication sharedApplication] delegate]; _managedObjectContext = [appDelegate managedObjectContext]; Video *video = [NSEntityDescription insertNewObjectForEntityForName:@"Video" inManagedObjectContext:_managedObjectContext]; [video setVideoData:videoData]; [video setVideoURL:[NSString stringWithFormat:@"%@",videoURL]]; NSDateFormatter *dateFormatter = [[NSDateFormatter alloc] init]; dateFormatter.dateStyle = NSDateFormatterLongStyle; [dateFormatter setDateStyle:NSDateFormatterLongStyle]; NSDate *date = [dateFormatter dateFromString:[dateFormatter stringFromDate:[NSDate date]]]; NSString *dateAdded = [dateFormatter stringFromDate:date]; [video setDate_recorded:dateAdded]; if(_currentAthlete != nil){ [video setWhosVideo:_currentAthlete]; } NSError *error = nil; if(![_managedObjectContext save:&error]){ //handle dat error } NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *tempPath = [documentsDirectory stringByAppendingFormat:@"/vid1.mp4"]; BOOL success = [videoData writeToFile:tempPath atomically:NO]; if(success == FALSE){ NSLog(@"Video was not successfully saved."); } if (UIVideoAtPathIsCompatibleWithSavedPhotosAlbum(moviePath)) { UISaveVideoAtPathToSavedPhotosAlbum(moviePath, self, @selector(video:didFinishSavingWithError:contextInfo:), nil); } } } Am I saving it incorrectly? When I go to play the video, it works fine, after a couple days the video will play without audio, then eventually it will be gone. Any ideas why?

    Read the article

  • PyGTK: Radiobuttons are still displayed after removal

    - by canavanin
    Hi everyone! I am using PyGTK and the gtk.assistant. On one page I would like to display two radiobuttons in case the user selected a certain option on a previous page. The labels of the buttons - and whether the buttons are to be present at all - are to depend entirely on that earlier selection. Furthermore, if the user goes back and changes that selection, the page containing the radiobuttons is to be updated accordingly. I have got as far as having the radiobuttons displayed when necessary, and with the correct labels. The trouble is that if I go back and change the determining selection, or if I move one page further than the 'radiobutton page' and then move back, the buttons are not only not removed (in case that would have been required), their number has also doubled. To show you what I'm doing, here's part of my code (I've left out bits that do unrelated things, that's why the function name doesn't fit). The function is called when the "prepare" signal is emitted prior to construction of the 'radiobutten page'. def make_class_skills_treestore(self): print self.trained_by_default_hbox.get_children() # PRINT 1 for child in self.trained_by_default_hbox.get_children(): if type(child) == gtk.RadioButton: self.trained_by_default_hbox.remove(child) #child.destroy() # <-- removed the labels, but not the buttons print self.trained_by_default_hbox.get_children() # PRINT 2 class_skills = self.data.data['classes'][selected_class].class_skills.values() default_trained_count = (class_skills.count([True, True]) , class_skills.count([True, False])) num_default_trained_skills = default_trained_count[1] / 2 # you have to pick one of a pair --> don't # count each as trained by default for i in range(default_trained_count[0]): # those are trained by default --> no choice num_default_trained_skills +=1 selected_class = self.get_classes_key_from_class_selection() if default_trained_count[1]: for skill in self.data.data['classes'][selected_class].class_skills.keys(): if self.data.data['classes'][selected_class].class_skills[skill] == [ True, False ] and not self.default_radio: self.default_radio.append(gtk.RadioButton(group=None, label=skill)) elif self.data.data['classes'][selected_class].class_skills[skill] == [ True, False ] and self.default_radio: self.default_radio.append(gtk.RadioButton(group=self.default_radio[0], label=skill)) if self.default_radio: for radio in self.default_radio: self.trained_by_default_hbox.add(radio) self.trained_by_default_hbox.show_all() self.trained_by_default_hbox and self.trained_by_default_label, as well as self.default_radio stem from the above function's class. I have two print statements (PRINT 1 and PRINT 2) in there for debugging. Here's what they give me: PRINT 1: [<gtk.Label object at 0x8fc4c84 (GtkLabel at 0x90a2f20)>, <gtk.RadioButton object at 0x8fc4d4c (GtkRadioButton at 0x90e4018)>, <gtk.RadioButton object at 0x8fc4cac (GtkRadioButton at 0x90ceec0)>] PRINT 2: [<gtk.Label object at 0x8fc4c84 (GtkLabel at 0x90a2f20)>] So the buttons have indeed been removed, yet they still show up on the page. I know the code requires some refactoring, but first I'd like to get it to work at all... If someone could help me out that would be great! Thanks a lot in advance for your replies - any kind of help is highly appreciated.

    Read the article

  • Android Thumbnail Loading Problem

    - by y ramesh rao
    I'm using a thumbnail loader in my project the one mentioned below. The problem is that the it loads all the thumbnails properly except the ones who's size is of about 40K. When our back end is giving that sort of thumbnails are not generated and sometimes this eventually leads to a Crash too. What m I supposed to do with this ? public class ThumbnailManager { private final Map<String, Bitmap> drawableMap; public static Context context; private Resources res; private int thumbnail_size; public ThumbnailManager() { drawableMap = new HashMap<String, Bitmap >(); res = new Resources(context.getAssets(), null, null); thumbnail_size = res.getInteger(R.ThumbnailManager.THUMBNAIL_SIZE); } public Bitmap fetchBitmap(String urlString) { if(drawableMap.containsKey(urlString)) { return (drawableMap.get(urlString)); } //Log.d(getClass().getSimpleName(), " Image URL :: "+ urlString); try { InputStream is = fetch(urlString); android.util.Log.v("ThumbnailManager", "ThumbnailManager " + urlString); drawableMap.put(urlString, BitmapFactory.decodeStream(is));//Bitmap.createScaledBitmap(BitmapFactory.decodeStream(is), thumbnail_size, thumbnail_size, false)); return drawableMap.get(urlString); } catch(Exception e) { android.util.Log.v("EXCEPTION", "EXCEPTION" + urlString); return null; } } public void fetchBitmapOnThread(final String urlString, final ImageView imageView) { if(drawableMap.containsKey(urlString)) { imageView.setImageBitmap(drawableMap.get(urlString)); return; } if(urlString.compareTo("AUDIO") == 0) { Bitmap audioThumb = BitmapFactory.decodeResource(context.getResources(), R.drawable.timeline_audio_thumb); drawableMap.put(urlString, Bitmap.createScaledBitmap(audioThumb, thumbnail_size, thumbnail_size, false)); imageView.setImageBitmap(drawableMap.get(urlString)); return; } final Handler handler = new Handler() { public void handleMessage(Message message) { imageView.setImageBitmap((Bitmap) message.obj); } }; Thread thread = new Thread() { public void run() { Bitmap urlBitmap = fetchBitmap(urlString); Message message = handler.obtainMessage(1, urlBitmap); handler.sendMessage(message); } }; thread.start(); } public InputStream fetch(String urlString) throws IOException, MalformedURLException { final URL url = new URL(urlString); final URLConnection conn = url.openConnection(); HttpURLConnection httpConn = (HttpURLConnection) conn; httpConn.setAllowUserInteraction(true); httpConn.setInstanceFollowRedirects(true); httpConn.setRequestMethod("GET"); httpConn.connect(); return(conn.getInputStream()); } }

    Read the article

  • Validate dependent model validation and show error message.

    - by piemesons
    Just taking a simple example. We have a question on stackoverflow and while posting a question we want to validate title_of_question, description_of_question that they should be present. Now we have a another model tag having habtm relationshio with question model. How to validate that while saving the question. Means question must have some tags. here the code:-- Models:-- class Question < ActiveRecord::Base belongs_to :user has_and_belongs_to_many :tags has_many :comments, :as => :commentable has_many :answers, :dependent => :destroy validates_presence_of :title, :content, :user_id end class Tag < ActiveRecord::Base has_and_belongs_to_many :questions validates_presence_of :tag end Form for entering question and tag <div class="form"> <% form_for :question ,@question, :url => {:action => "create" } do |f| %> <fieldset> <%= f.error_messages %> <legend>Post a question</legend> <div> <%= f.label :title %>: <%= f.text_field :title, :size => 100 %> </div> <div> <%= f.label :content ,'Question' %>: <%= f.text_area :content, :rows => 10, :cols => 100 %> </div> <div> <%= label_tag 'tags' %>: <%= text_field_tag 'tag' ,'',:size=> 60 %> add multiple tag using comma </div> <div> <%= submit_tag "Post question" %> </div> </fieldset> <% end %> </div> From Controller.. (Right now question will be saved without validating tag) def create @question = Question.new(params[:question]) @question.user_id=session[:user_id] if @question.save flash[:notice] = "Question has been posted." redirect_to question_index_path else render :action => "new" end end questions_tags table has been created. One approach is creating a virtual column using attribute accessors. another approach is validate associated. right now assuming new tags can be created.(but not duplicate).

    Read the article

  • Python: (sampling with replacement): efficient algorithm to extract the set of DISSIMILAR N-tuples from a set

    - by Homunculus Reticulli
    I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] # Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

    Read the article

  • Howoto get id of new record after model.save

    - by tonymarschall
    I have a model with the following db structure: mysql> describe units; +------------+----------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+----------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | name | varchar(128) | NO | | NULL | | | created_at | datetime | NO | | NULL | | | updated_at | datetime | NO | | NULL | | +------------+----------+------+-----+---------+----------------+ 7 rows in set (0.00 sec) After creating a new record an saving i can not get the id of the record. 1.9.3p194 :001 > unit = Unit.new(:name => 'test') => #<Unit id: nil, name: "test", created_at: nil, updated_at: nil> 1.9.3p194 :002 > unit.save (0.2ms) BEGIN SQL (0.3ms) INSERT INTO `units` (`created_at`, `name`, `updated_at`) VALUES ('2012-08-31 23:48:12', 'test', '2012-08-31 23:48:12') (144.6ms) COMMIT => true 1.9.3p194 :003 > unit.inspect => "#<Unit id: nil, name: \"test\", created_at: \"2012-08-31 23:48:12\", updated_at: \"2012-08-31 23:48:12\">" # unit.rb class Unit < ActiveRecord::Base attr_accessible :name end # migration class CreateUnits < ActiveRecord::Migration def change create_table :units do |t| t.string :name, :null => false t.timestamps end end end Tried this with other models and have the same result (no id). Data is definitily saved and i can get data with Unit.last Another try with Foo.id = nil # /var/www# rails g model Foo name:string invoke active_record create db/migrate/20120904030554_create_foos.rb create app/models/foo.rb invoke test_unit create test/unit/foo_test.rb create test/fixtures/foos.yml # /var/www# rake db:migrate == CreateFoos: migrating ===================================================== -- create_table(:foos) -> 0.3451s == CreateFoos: migrated (0.3452s) ============================================ # /var/www# rails c Loading development environment (Rails 3.2.8) 1.9.3p194 :001 > foo = Foo.new(:name => 'bar') => #<Foo id: nil, name: "bar", created_at: nil, updated_at: nil> 1.9.3p194 :002 > foo.save (0.2ms) BEGIN SQL (0.4ms) INSERT INTO `foos` (`created_at`, `name`, `updated_at`) VALUES ('2012-09-04 03:06:26', 'bar', '2012-09-04 03:06:26') (103.2ms) COMMIT => true 1.9.3p194 :003 > foo.inspect => "#<Foo id: nil, name: \"bar\", created_at: \"2012-09-04 03:06:26\", updated_at: \"2012-09-04 03:06:26\">" 1.9.3p194 :004 > Foo.last Foo Load (0.5ms) SELECT `foos`.* FROM `foos` ORDER BY `foos`.`id` DESC LIMIT 1 => #<Foo id: 1, name: "bar", created_at: "2012-09-04 03:06:26", updated_at: "2012-09-04 03:06:26">

    Read the article

  • Project Euler #18 - how to brute force all possible paths in tree-like structure using Python?

    - by euler user
    Am trying to learn Python the Atlantic way and am stuck on Project Euler #18. All of the stuff I can find on the web (and there's a LOT more googling that happened beyond that) is some variation on 'well you COULD brute force it, but here's a more elegant solution'... I get it, I totally do. There are really neat solutions out there, and I look forward to the day where the phrase 'acyclic graph' conjures up something more than a hazy, 1 megapixel resolution in my head. But I need to walk before I run here, see the state, and toy around with the brute force answer. So, question: how do I generate (enumerate?) all valid paths for the triangle in Project Euler #18 and store them in an appropriate python data structure? (A list of lists is my initial inclination?). I don't want the answer - I want to know how to brute force all the paths and store them into a data structure. Here's what I've got. I'm definitely looping over the data set wrong. The desired behavior would be to go 'depth first(?)' rather than just looping over each row ineffectually.. I read ch. 3 of Norvig's book but couldn't translate the psuedo-code. Tried reading over the AIMA python library for ch. 3 but it makes too many leaps. triangle = [ [75], [95, 64], [17, 47, 82], [18, 35, 87, 10], [20, 4, 82, 47, 65], [19, 1, 23, 75, 3, 34], [88, 2, 77, 73, 7, 63, 67], [99, 65, 4, 28, 6, 16, 70, 92], [41, 41, 26, 56, 83, 40, 80, 70, 33], [41, 48, 72, 33, 47, 32, 37, 16, 94, 29], [53, 71, 44, 65, 25, 43, 91, 52, 97, 51, 14], [70, 11, 33, 28, 77, 73, 17, 78, 39, 68, 17, 57], [91, 71, 52, 38, 17, 14, 91, 43, 58, 50, 27, 29, 48], [63, 66, 4, 68, 89, 53, 67, 30, 73, 16, 69, 87, 40, 31], [04, 62, 98, 27, 23, 9, 70, 98, 73, 93, 38, 53, 60, 4, 23], ] def expand_node(r, c): return [[r+1,c+0],[r+1,c+1]] all_paths = [] my_path = [] for i in xrange(0, len(triangle)): for j in xrange(0, len(triangle[i])): print 'row ', i, ' and col ', j, ' value is ', triangle[i][j] ??my_path = somehow chain these together??? if my_path not in all_paths all_paths.append(my_path) Answers that avoid external libraries (like itertools) preferred.

    Read the article

  • How to fix this Speech Recognition on C# wicked bug?

    - by aF
    Hello, I have this code in my C# project: public void startRecognition(string pName) { presentationName = pName; if (WaveNative.waveInGetNumDevs() > 0) { string grammar = System.Environment.GetEnvironmentVariable("PUBLIC") + "\\SoundLog\\Presentations\\" + presentationName + "\\SpeechRecognition\\soundlog.cfg"; if (File.Exists(grammar)) { File.Delete(grammar); } executeCommand(); /// Create an instance of SpSharedRecoContextClass which will be used /// to interface with the incoming audio stream recContext = new SpSharedRecoContextClass(); // Create the grammar object recContext.CreateGrammar(1, out recGrammar); //recContext.CreateGrammar(2, out recGrammar2); // Set up dictation mode //recGrammar2.SetDictationState(SpeechLib.SPRULESTATE.SPRS_ACTIVE); //recGrammar2.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); // Set appropriate grammar mode if (File.Exists(grammar)) { recGrammar.LoadCmdFromFile(grammar, SPLOADOPTIONS.SPLO_STATIC); //recGrammar.SetDictationState(SpeechLib.SPRULESTATE.SPRS_INACTIVE); recGrammar.SetGrammarState(SPGRAMMARSTATE.SPGS_ENABLED); recGrammar.SetRuleIdState(0, SPRULESTATE.SPRS_ACTIVE); } /// Bind a callback to the recognition event which will be invoked /// When a dictated phrase has been recognised. recContext.Recognition += new _ISpeechRecoContextEvents_RecognitionEventHandler(handleRecognition); // System.Windows.Forms.MessageBox.Show(recContext.ToString()); // gramática compilada } } private static void handleRecognition(int StreamNumber, object StreamPosition, SpeechLib.SpeechRecognitionType RecognitionType, SpeechLib.ISpeechRecoResult Result) { string temp = Result.PhraseInfo.GetText(0, -1, true); _recognizedText = ""; // System.Windows.Forms.MessageBox.Show(temp); // System.Windows.Forms.MessageBox.Show(recognizedWords.Count.ToString()); foreach (string word in recognizedWords) { if (temp.Contains(word)) { // System.Windows.Forms.MessageBox.Show("yes"); _recognizedText = word; } } } This codes generates a dll that I use in another application. Now, the wicked bug: - when I run the startRecognition method in the beginning of the execution of the other application, this codes works very well. But when I run it some time after the beginning, this codes works but the handleRecognition method is never called. I see that the words are recognized because they appear on the Microsoft Speech Recognition app, but the handler method is never called. Do you know what's the problem with this code? Thanks in advance :D

    Read the article

  • Better way to write an object generator for an RAII template class?

    - by Dan
    I would like to write an object generator for a templated RAII class -- basically a function template to construct an object using type deduction of parameters so the types don't have to be specified explicitly. The problem I foresee is that the helper function that takes care of type deduction for me is going to return the object by value, which will result in a premature call to the RAII destructor when the copy is made. Perhaps C++0x move semantics could help but that's not an option for me. Anyone seen this problem before and have a good solution? This is what I have: template<typename T, typename U, typename V> class FooAdder { private: typedef OtherThing<T, U, V> Thing; Thing &thing_; int a_; // many other members public: FooAdder(Thing &thing, int a); ~FooAdder(); void foo(T t, U u); void bar(V v); }; The gist is that OtherThing has a horrible interface, and FooAdder is supposed to make it easier to use. The intended use is roughly like this: FooAdder(myThing, 2) .foo(3, 4) .foo(5, 6) .bar(7) .foo(8, 9); The FooAdder constructor initializes some internal data structures. The foo and bar methods populate those data structures. The ~FooAdder dtor wraps things up and calls a method on thing_, taking care of all the nastiness. That would work fine if FooAdder wasn't a template. But since it is, I would need to put the types in, more like this: FooAdder<Abc, Def, Ghi>(myThing, 2) ... That's annoying, because the types can be inferred based on myThing. So I would prefer to create a templated object generator, similar to std::make_pair, that will do the type deduction for me. Something like this: template<typename T, typename U, typename V> FooAdder<T, U, V> AddFoo(Thing &thing, int a) { return FooAdder<T, U, V>(thing, a); } That seems problematic: because it returns by value, the stack temporary object will be destructed, which will cause the RAII dtor to run prematurely. One thought I had was to give FooAdder a copy ctor with move semantics, kinda like std::auto_ptr. But I would like to do this without dynamic memory allocation, so I thought the copy ctor could set a flag within FooAdder indicating the dtor shouldn't do the wrap-up. Like this: FooAdder(FooAdder &rhs) // Note: rhs is not const : thing_(rhs.thing_) , a_(rhs.a_) , // etc... lots of other members, annoying. , moved(false) { rhs.moved = true; } ~FooAdder() { if (!moved) { // do whatever it would have done } } Seems clunky. Anyone got a better way?

    Read the article

  • remote_form_for in index.html.erb file not working w/ AJAX...Ruby on Rails...

    - by bgadoci
    Just curious if I am overlooking something simple here. I have deployed the remote_form_for in the show.html.erb code before to render comments on a post (project in this case) without a problem. I have moved this code to the index view and seems to degrade to the normal form_for action (page refresh). I am not getting any javascript errors so not sure what is wrong here. Here is my code: index.html.erb <% remote_form_for [project, Comment.new] do |f| %> <p> <%= f.label :body, "New Comment" %><br/> <%= f.text_area (:body, :class => "textarea") %> </p> <p> <%= f.label :name, "Name" %> (Required)<br/> <%= f.text_field (:name, :class => "textfield") %> </p> <p> <%= f.label :email, "Email" %> (Required but will not be displayed)<br/> <%= f.text_field (:email, :class => "textfield") %> </p> <p><%= f.submit "Add Comment" %></p> <% end %> CommentsController#create def create @project = Project.find(params[:project_id]) @comment = @project.comments.create!(params[:comment]) respond_to do |format| format.html { redirect_to projects_path } format.js end end /views/comments/create.js.rjs page.insert_html :bottom, :commentwrapper, :partial => @comment page[@comment].visual_effect :highlight page[:new_comment].reset page.replace_html :notice, flash[:notice] flash.discard /views/comments/_comment.html.erb <% div_for comment do %> <div id="commentwrapper"> <% if admin? %> <%=link_to_remote "X", :url => [@project, comment], :method => :delete %> <% end %> <%= h(comment.body) %><br/><br/> Posted <%= time_ago_in_words(comment.created_at) %> ago by <%= h(comment.name) %> <% if admin? %> | <%= h(comment.email) %> <% end %></div> <% end %>

    Read the article

< Previous Page | 599 600 601 602 603 604 605 606 607 608 609 610  | Next Page >