Search Results

Search found 19966 results on 799 pages for 'wild thing'.

Page 607/799 | < Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >

• How to launch multiple Internet Explorer windows/tabs from batch file?

  - by TheZenker

  I would like a batch file to launch two separate programs then have the command line window close. Actually, to clarify, I am launching Internet Explorer with two different URLs. So far I have something like this: start "~\iexplore.exe" "url1" start "~\iexplore.exe" "url2" What I get is one instance of Internet Explorer with only the second URL loaded. Seems the second is replacing the second. I seem to remember a syntax where I would load a new command line window and pass the command to execute on load, but can't find the reference. As a second part of the question: what is a good reference URL to keep for the times you need to write a quick batch file? Edit: I have marked an answer, because it does work. I now have two windows open, one for each URL. (thanks!) The funny thing is that without the /d approach using my original syntax I get different results based on whether I have a pre-existing Internet Explorer instance open. If I do I get two new tabs added for my two URLs (sweet!) If not I get only one final tab for the second URL I passed in.

  Read the article

• Numeric Order By In Transact SQL (Ordering As String Instead Of Int)

  - by Pyronaut

  I have an issue where I am trying to order a result set by what I believe to be a numberic column in my database. However when I get the result set, It has sorted the column as if it was a string (So alphabetically), instead of sorting it as an int. As an example. I have these numbers, 1 , 2, 3, 4, 5, 10, 11 When I order by in Transact SQL, I get back : 1, 10, 11, 2, 3, 4, 5 I had the same issue with Datagridview's a while back, And the issue was because of the sorting being done as if it was a string. I assume the same thing is happening here. My full SQL code is : SELECT TOP (12) DATEPART(YEAR, [OrderDate]) AS 'Year', DATEPART(MONTH, [OrderDate]) AS 'Month' , COUNT(OrderRef) AS 'OrderCount' FROM [Order] WHERE [Status] LIKE('PaymentReceived') OR [Status] LIKE ('Shipped') GROUP BY DATEPART(MONTH, [OrderDate]), DATEPART(YEAR, [OrderDate]) ORDER BY DATEPART(YEAR, OrderDate) DESC, DATEPART(MONTH, OrderDate) desc DO NOTE The wrong sorting only happens when I cam calling the function from Visual Studio. As in my code is : using (SqlConnection conn = GetConnection()) { string query = @"SELECT TOP (12) DATEPART(YEAR, [OrderDate]) AS 'Year', DATEPART(MONTH, [OrderDate]) AS 'Month' , COUNT(OrderRef) AS 'OrderCount' FROM [Order] WHERE [Status] LIKE('PaymentReceived') OR [Status] LIKE ('Shipped') GROUP BY DATEPART(MONTH, [OrderDate]), DATEPART(YEAR, [OrderDate]) ORDER BY DATEPART(YEAR, OrderDate) DESC, DATEPART(MONTH, OrderDate) desc"; SqlCommand command = new SqlCommand(query, conn); command.CommandType = CommandType.Text; using (SqlDataReader reader = command.ExecuteReader()) etc. When I run the statement in MSSQL server, there is no issues. I am currently using MSSQL 2005 express edition, And Visual Studio 2005. I have tried numerous things that are strewn across the web. Including using Convert() and ABS() to no avail. Any help would be much appreciated.

  Read the article

• The RSA key container could not be opened

  - by TenaciousImpy

  Hi, I've been developing an ASP.NET site on an older machine running XP home. I recently got a new Win 7 PC and moved all my project files across. When I try and run the project, I get this error message: "Failed to decrypt using provider 'MyRsaProtectedConfigurationProvider'. Error message from the provider: The RSA key container could not be opened." I realised that I encrypted parts of my web.config file using a RSA encryption. This is where the problem now lies. I'm not sure how to get that key working again so that I can use it on my new machine. I exported the key from the older machine and imported it using: aspnet_regiis -pi "RSAProviderName" "C:\RSA_configkey.xml" This was imported successfully. I then ran the project, but the same error message came up. I figured it might be a permission thing, so I ran: aspnet_regiis -pa "RSAProviderName" "\Desktop" -full This was also successful, but I still get the error. From reading around, I've seen people use "ASPNET" instead of "\Desktop" (Desktop is my machine name). However, when I try and use "ASPNET", I get: No mapping between account name and security IDs was done. <Exception from HRESULT = 0x80070534 I can't work on the project until this is fixed, so any help is much appreciated. Thanks!

  Read the article

• Android : Customizing tabs on state : How do I make a selector a drawable

  - by Chrispix

  I know how to put the icon on each tab, that is no problem. I also ran across this : Stack Overflow thread on pretty much same thing I followed one of the links from that question, and found this Pretty much, it said use a selector defined in the xml, sure, did that. But there is no id associated w/ it so I am not sure how to get the selector function as a drawable so I can use it as the icon for the tabs. Maybe I am going about this the wrong way.. But this is what I have, and obviously missing something. <selector android:id="@+id/myselector" xmlns:android="http://schemas.android.com/apk/res/android"> <!-- Non focused states --> <item android:state_focused="false" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/darklogo" /> <item android:state_focused="false" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Focused states --> <item android:state_focused="true" android:state_selected="false" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <item android:state_focused="true" android:state_selected="true" android:state_pressed="false" android:drawable="@drawable/lightlogo" /> <!-- Pressed --> <item android:state_pressed="true" android:drawable="@drawable/lightlogo" /> </selector> In my code, an example tab is generated using : host.addTab(host.newTabSpec("three") .setIndicator("map",drawables) .setContent(new Intent(this, Map.class))); Right now drawables is just a reference to an drawable image resource. How do I make the selector a drawable? * This is my question *

  Read the article

• Why Java language does not offer a way to declare getters and setters of a given "field" through ann

  - by zim2001

  I actually happily design and develop JEE Applications for quite 9 years, but I realized recently that as time goes by, I feel more and more fed up of dragging all these ugly bean classes with their bunch of getters and setters. Considering a basic bean like this : public class MyBean { // needs getter AND setter private int myField1; // needs only a getter, no setter private int myField2; // needs only a setter, no getter private int myField3; /** * Get the field1 * @return the field1 */ public int getField1() { return myField1; } /** * Set the field1 * @param value the value */ public void setField1(int value) { myField1 = value; } /** * Get the field2 * @return the field2 */ public int getField2() { return myField2; } /** * Set the field3 * @param value the value */ public void setField3(int value) { myField3 = value; } } I'm dreaming of something like this : public class MyBean { @inout(public,public) private int myField1; @out(public) private int myField2; @in(public) private int myField3; } No more stupid javadoc, just tell the important thing... It would still be possible to mix annotation and written down getters or setters, to cover cases when it should do non-trivial sets and gets. In other words, annotation would auto-generate the getter / setter code piece except when a literate one is provided. Moreover, I'm also dreaming of replacing things like that : MyBean b = new MyBean(); int v = b.getField1(); b.setField3(v+1); by such : MyBean b = new MyBean(); int v = b.field1; b.field3 = v+1; In fact, writing "b.field1" on the right side of an expression would be semantically identical to write "b.getField1()", I mean as if it has been replaced by some kind of a preprocessor. It's just an idea but I'm wondering if I'm alone on that topic, and also if it has major flaws. I'm aware that this question doesn't exactly meet the SO credo (we prefer questions that can be answered, not just discussed) so I flag it community wiki...

  Read the article

• Why calling Process.killProcess(Process.myPid()) is a bad idea?

  - by Tal Kanel

  I've read some posts saying using this method is "not good", shouldn't been use, it's not the right way to "close" the application and it's not how android works... I understand and accept the fact that Android OS knows better then me when it's the right time to terminate the process, but I didn't heard yet a good explanation why it's wrong using the killProcess() method?. after all - it's part of the android API... what I do know is that calling this method while other threads doing in potential an important work (operations on files, writing to DB, HTTP requests, running services..) can be terminated in the middle, and it's clearly not good. also I know I can benefit from the fact that "re-open" the application will be faster, cause the system maybe still "holds" in memory state from last time been used, and killProcess() prevents that. beside this reason, in assumption I don't have such operations, and I don't care my application will load from scratch each run, there are other reasons why not using the killProcess() method? I know about finish() method to close an Activity, so don't write me about that please.. finish() is only for Activity. not to all application, and I think I know exactly why and when to use it... and another thing - I'm developing also games with the Unity3D framework, and exporting the project to android. when I decompiled the generated apk, I was very suprised to find out that the java source code created from unity - implementing Unity's - Application.quit() method, with Process.killProcess(Process.myPid()). Application.quit() is suppose to be the right way to close game according to Unity3d guides (is it really?? maybe I'm wrong, and missed something), so how it happens that the Unity's framework developers which doing a very good work as it seems implemented this in native android to killProcess()? anyway - I wish to have a "list of reasons" why not using the killProcess() method, so please write down your answer - if you have something interesting to say about that. TIA

  Read the article

• How to serialize a Bundle?

  - by hermo

  I'd like to serialize a Bundle object, but can't seem to find a simple way of doing it. Using Parcel doesn't seem like an option, since I want to store the serialized data to file. Any ideas on ways to do this? The reason I want this is to save and restore the state of my activity, also when it's killed by the user. I already create a Bundle with the state I want to save in onSaveInstanceState. But android only keeps this Bundle when the activity is killed by the SYSTEM. When the user kills the activity, I need to store it myself. Hence i'd like to serialize and store it to file. Of course, if you have any other way of accomplishing the same thing, i'd be thankful for that too. Edit: I decided to encode my state as a JSONObject instead of a Bundle. The JSON object can then be put in a Bundle as a Serializable, or stored to file. Probably not the most efficient way, but it's simple, and it seems to work ok.

  Read the article

• ObjC: Alloc instance of Class and performing selectors on it leads to __CFRequireConcreteImplementat

  - by Arakyd

  Hi, I'm new to Objective-C and I'd like to abstract my database access using a model class like this: @interface LectureModel : NSMutableDictionary { } -(NSString*)title; -(NSDate*)begin; ... @end I use the dictionary methods setValue:forKey: to store attributes and return these in the getters. Now I want to read these models from a sqlite database by using the Class dynamically. + (NSArray*)findBySQL:(NSString*)sql intoModelClass:(Class)modelClass { NSMutableArray* models = [[[NSMutableArray alloc] init] autorelease]; sqlite3* db = sqlite3_open(...); sqlite3_stmt* result = NULL; sqlite3_prepare_v2(db, [sql UTF8String], -1, &result, NULL); while(sqlite3_step(result) == SQLITE_ROW) { id modelInstance = [[modelClass alloc] init]; for (int i = 0; i < sqlite3_column_count(result); ++i) { NSString* key = [NSString stringWithUTF8String:sqlite3_column_name(result, i)]; NSString* value = [NSString stringWithUTF8String:(const char*)sqlite3_column_text(result, i)]; if([modelInstance respondsToSelector:@selector(setValue:forKey:)]) [modelInstance setValue:value forKey:key]; } [models addObject:modelInstance]; } sqlite3_finalize(result); sqlite3_close(db); return models; } Funny thing is, the respondsToSelector: works, but if I try (in the debugger) to step over [modelInstance setValue:value forKey:key], it will throw an exception, and the stacktrace looks like: #0 0x302ac924 in ___TERMINATING_DUE_TO_UNCAUGHT_EXCEPTION___ #1 0x991d9509 in objc_exception_throw #2 0x302d6e4d in __CFRequireConcreteImplementation #3 0x00024d92 in +[DBManager findBySQL:intoModelClass:] at DBManager.m:114 #4 0x0001ea86 in -[FavoritesViewController initializeTableData:] at FavoritesViewController.m:423 #5 0x0001ee41 in -[FavoritesViewController initializeTableData] at FavoritesViewController.m:540 #6 0x305359da in __NSFireDelayedPerform #7 0x302454a0 in CFRunLoopRunSpecific #8 0x30244628 in CFRunLoopRunInMode #9 0x32044c31 in GSEventRunModal #10 0x32044cf6 in GSEventRun #11 0x309021ee in UIApplicationMain #12 0x00002988 in main at main.m:14 So, what's wrong with this? Presumably I'm doing something really stupid and just don't see it... Many thanks in advance for your answers, Arakyd :..

  Read the article

• Is Structuremap singleton thread safe?

  - by Ben

  Hi, Currently I have the following class: public class PluginManager { private static bool s_initialized; private static object s_lock = new object(); public static void Initialize() { if (!s_initialized) { lock (s_lock) { if (!s_initialized) { // initialize s_initialized = true; } } } } } The important thing here is that Initialize() should only be executed once whilst the application is running. I thought that I would refactor this into a singleton class since this would be more thread safe?: public sealed class PluginService { static PluginService() { } private static PluginService _instance = new PluginService(); public static PluginService Instance { get { return _instance; } } private bool s_initialized; public void Initialize() { if (!s_initialized) { // initialize s_initialized = true; } } } Question one, is it still necessary to have the lock here (I have removed it) since we will only ever be working on the same instance? Finally, I want to use DI and structure map to initialize my servcices so I have refactored as below: public interface IPluginService { void Initialize(); } public class NewPluginService : IPluginService { private bool s_initialized; public void Initialize() { if (!s_initialized) { // initialize s_initialized = true; } } } And in my registry: ForRequestedType<IPluginService>() .TheDefaultIsConcreteType<NewPluginService>().AsSingletons(); This works as expected (singleton returning true in the following code): var instance1 = ObjectFactory.GetInstance<IPluginService>(); var instance2 = ObjectFactory.GetInstance<IPluginService>(); bool singleton = (instance1 == instance2); So my next question, is the structure map solution as thread safe as the singleton class (second example). The only downside is that this would still allow NewPluginService to be instantiated directly (if not using structure map). Many thanks, Ben

  Read the article

• OpenGL bitmap text fails after drawing polygon

  - by kaykun

  I'm using Win32 and OpenGL to to draw text onto a window. I'm using the bitmap font method, with wglUseFontBitmaps. Here is my main rendering function: glClear(GL_COLOR_BUFFER_BIT); glPushMatrix(); glColor3f(1.0f, 0.0f, 1.0f); glBegin(GL_QUADS); glVertex2f(0.0f, 0.0f); glVertex2f(128.0f, 0.0f); glVertex2f(128.0f, 128.0f); glVertex2f(0.0f, 128.0f); glEnd(); glPopMatrix(); glPushMatrix(); glColor3f(1.0f, 1.0f, 1.0f); glRasterPos2i(200, 200); glListBase(fontList); glCallLists(5, GL_UNSIGNED_BYTE, "Test."); glPopMatrix(); SwapBuffers(hDC); As you can see it's very simple and the only thing that it's supposed to do is draw a quadrilateral and draw the text "Test.". But the problem is that drawing a polygon seems to mess up any text operations I try to do after it. If I place the text drawing functions before the polygon, both the text and the polygon draw fine. Is there something I'm missing here? Edit: This problem only happens when the window is run in Fullscreen, by ChangeDisplaySettings. Any reason why this would be??

  Read the article

• Dojo DnD: how to access newly copied node on onDndDrop event?

  - by toshinao

  Hi. I am working on code like the following. 01: var c1 = new dojo.dnd.Source('container1', {copyOnly:true}); // container1 is a div 02: var c2 = new dojo.dnd.Source('container2'); // container2 is a div 03: var list = []; 04: for (var i = 0; i < 3; i++) { list.push( dojo.create('div') ); } 05: c1.insertNodes(false, list); 06: 07: function checkDndCopy(nodes, target){ 08: dojo.forEach(nodes, function(node){ alert(node.id); } ); 09: } 10: dojo.subscribe("/dnd/drop", function(){ 11: var mgr = dojo.dnd.manager(); 12: checkDndCopy(mgr.nodes, mgr.target); 13: }); The nodes inserted to the c1 at line 05 have id of "dojoUnique1, donoUnique2, dojoUnique3". On a event of drag and drop a node from c1 to c2, a onDndDrop event is fired and the subscribe method defined in line10-13 is invoked. I expected that newly copied node appears in the nodes (for example) at line 08. But this is not true. When dojoUnique1 is target of drag and drop, nodes at line 08 contains only dojoUnique1. I want to modify some attributes of newly copied nodes on the event of onDndDrop. Please let me know how such a thing is realized.

  Read the article

• Simulating pass by reference for an array in Java

  - by Leif Andersen

  I was wondering, in java, is it possible to in anyway, simulate pass by reference for an array? Yes, I know the language doesn't support it, but is there anyway I can do it. Say, for example, I want to create a method that reverses the order of all the elements in an array. (I know that this code snippet isn't the best example, as there is a better algorithms to do this, but this is a good example of the type of thing I want to do for more complex problems). Currently, I need to make a class like this: public static void reverse(Object[] arr) { Object[] tmpArr = new Object[arr.length]; count = arr.length - 1; for(Object i : arr) tmpArr[count--] = i; // I would like to do arr = tmpArr, but that will only make the shallow // reference tmpArr, I would like to actually change the pointer they passed in // Not just the values in the array, so I have to do this: count = arr.length - 1; for(Object i : tmpArr) arr[count--] = i; return; } Yes, I know that I could just swap the values until I get to the middle, and it would be much more efficient, but for other, more complex purposes, is there anyway that I can manipulate the actual pointer? Again, thank you.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Can NSCollectionView autoresize the width of its subviews to display one column

  - by littlecharva

  Hi, I have an NSCollectionView that contains a collection of CustomViews. Initially it tiled the subviews into columns and rows like a grid. I then set the Columns property in IB to 1, so now it just displays them one after another in rows. However, even though my CustomView is 400px wide, it's set to autoresize, the NSCollectionView is 400px wide, and it's set to 1 column, the subviews are drawn about 80px wide. I know I can get around this by calling: CGFloat width = [collectionView bounds].size.width; NSSize size = NSMakeSize(width, 85); [collectionView setMinItemSize:size]; [collectionView setMaxItemSize:size]; But putting this code in the awakeFromNib method of my WindowController only sets the correct width when the program launches. When I resize the window (and the NSCollectionView autoresizes as I've specified), the CustomViews stay at their initially set width. I'm happy to take care of resizing the subviews myself if need be, but I'm quite new to Cocoa and can't seem to find any articles explaining how to do such a thing. Can someone point me in the right direction? Anthony

  Read the article

• How to transfer objects through the header in WCF

  - by Michael

  I'm trying to transfer some user information in the header of the message through message inspectors. I have created a behavior which adds the inspector to the service (both client and server). But when I try to communicate with the service I get the following error: XmlException: Name cannot begin with the '<' character, hexadecimal value 0x3C. I have also get exception telling me that DataContracts where unexpected. Type 'System.DelegateSerializationHolder+DelegateEntry' with data contract name 'DelegateSerializationHolder.DelegateEntry:http://schemas.datacontract.org/2004/07/System' is not expected. Consider using a DataContractResolver or add any types not known statically to the list of known types - for example, by using the KnownTypeAttribute attribute or by adding them to the list of known types passed to DataContractSerializer. The thing is that my object contains other objects which are marked as DataContract and I'm not interested adding the KnownType attribute for those types. Another problem might be that my object to serialize is very restricted in form of internal class and internal properties etc. Can anyone guide me in the right direction. What I'm I doing wrong? Some code: public virtual object BeforeSendRequest(ref Message request, IClientChannel channel) { var header = MessageHeader.CreateHeader("<name>", "<namespace>", object); request.Headers.Add(header); return Guid.NewGuid(); }

  Read the article

• Java Robot key activity seems to stop working while certain software is running

  - by Mike Turley

  I'm writing a Java application to automate character actions in an online game overnight (specifically, it catches fish in Final Fantasy XI). The app makes heavy use of java's Robot class both for emulating user keyboard input and for detecting color changes on certain parts of the screen. It also uses multithreading and a swing GUI. The application seems to work perfectly when I test it without the game running, just using screenshots to trigger the apps responses into notepad. But for some reason, when I actually launch FFXI and start the program, all of my keyboard and mouse manipulations just stop working altogether. The program is still running, and the Robot class is still able to read pixel colors. But Robot.keyPress, Robot.keyRelease, Robot.mouseMove, Robot.mousePress and Robot.mouseRelease all do nothing. It's the strangest thing-- to test it, I wrote a simple loop that just keeps typing letters, and focused notepad. I'd then start the game, refocus notepad, and it would do nothing. Then I'd exit the game, and it'd start working again immediately. Has anyone else come across something like this, where specific software will stop certain functions of java from working? Also, to make this more interesting-- Last year I wrote a very similar program using the same classes and programming techniques to automate healing a party in the game as they fight. Last year, this program worked perfectly. After running into these problems I dug up that old program, ran it without making any changes, and found that it too was having the same problems. The only differences between now and when it was working: I was running Windows Vista and now I'm running Windows 7, and several new Java versions as well as FFXI versions have been released. What the hell is going on? (if anyone needs to see my source code, email me at [email protected]. I'm trying to keep it to myself.)

  Read the article

• Practical size limitations for RDBMS

  - by grenade

  I am working on a project that must store very large datasets and associated reference data. I have never come across a project that required tables quite this large. I have proved that at least one development environment cannot cope at the database tier with the processing required by the complex queries against views that the application layer generates (views with multiple inner and outer joins, grouping, summing and averaging against tables with 90 million rows). The RDBMS that I have tested against is DB2 on AIX. The dev environment that failed was loaded with 1/20th of the volume that will be processed in production. I am assured that the production hardware is superior to the dev and staging hardware but I just don't believe that it will cope with the sheer volume of data and complexity of queries. Before the dev environment failed, it was taking in excess of 5 minutes to return a small dataset (several hundred rows) that was produced by a complex query (many joins, lots of grouping, summing and averaging) against the large tables. My gut feeling is that the db architecture must change so that the aggregations currently provided by the views are performed as part of an off-peak batch process. Now for my question. I am assured by people who claim to have experience of this sort of thing (which I do not) that my fears are unfounded. Are they? Can a modern RDBMS (SQL Server 2008, Oracle, DB2) cope with the volume and complexity I have described (given an appropriate amount of hardware) or are we in the realm of technologies like Google's BigTable? I'm hoping for answers from folks who have actually had to work with this sort of volume at a non-theoretical level.

  Read the article

• Inconsistent get_class_methods vs method_exists when using UTF8 characters in PHP code

  - by coma

  I have this class in a UTF-8 encoded file called EnUTF8.Class.php: class EnUTF8 { public function ñññ() { return 'ñññ()'; } } and in another UTF-8 encoded file: require_once('EnUTF8.Class.php'); require_once('OneBuggy.Class.php'); $utf8 = new EnUTF8(); //$buggy = new OneBuggy(); echo (method_exists($utf8, 'ñññ')) ? 'ñññ() exists!' : 'ñññ() does not exist...'; echo "\n\n----------------------------------\n\n" print_r(get_class_methods($utf8)); echo "\n----------------------------------\n\n" echo $utf8->ñññ(); that produces the expected result: ñññ() exists! ---------------------------------- Array ( [0] => ñññ ) ---------------------------------- ñññ() but if... require_once('EnUTF8.Class.php'); require_once('OneBuggy.Class.php'); $utf8 = new EnUTF8(); $buggy = new OneBuggy(); echo (method_exists($utf8, 'ñññ')) ? 'ñññ() exists!' : 'ñññ() does not exist...'; echo "\n\n----------------------------------\n\n" print_r(get_class_methods($utf8)); echo "\n----------------------------------\n\n" echo $utf8->ñññ(); then the weirdness appears!!!: ñññ() does not exist! ---------------------------------- Array ( [0] => ñññ ) ---------------------------------- Fatal error: Call to undefined method EnUTF8::ñññ() in /var/www/test.php on line 16 Well, the thing is that OneBuggy.Class.php is UTF-8 encoded too and shares absolutly nothing with EnUTF8.Class.php so... where is the bug? UPDATED: Well, after a long debugging time I found this in OneBuggy.Class.php constructor: setlocale (LC_ALL, "es_ES@euro", "es_ES", "esp"); so I did... //setlocale (LC_ALL, "es_ES@euro", "es_ES", "esp"); and now it works but why?.

  Read the article

• refactor LINQ TO SQL custom properties that instantiate datacontext

  - by Thiago Silva

  I am working on an existing ASP.NET MVC app that started small and has grown with time to require a good re-architecture and refactoring. One thing that I am struggling with is that we've got partial classes of the L2S entities so we could add some extra properties, but these props create a new data context and query the DB for a subset of data. This would be the equivalent to doing the following in SQL, which is not a very good way to write this query as oppsed to joins: SELECT tbl1.stuff, (SELECT nestedValue FROM tbl2 WHERE tbl2.Foo = tbl1.Bar), tbl1.moreStuff FROM tbl1 so in short here's what we've got in some of our partial entity classes: public partial class Ticket { public StatusUpdate LastStatusUpdate { get { //this static method call returns a new DataContext but needs to be refactored var ctx = OurDataContext.GetContext(); var su = Compiled_Query_GetLastUpdate(ctx, this.TicketId); return su; } } } We've got some functions that create a compiled query, but the issue is that we also have some DataLoadOptions defined in the DataContext, and because we instantiate a new datacontext for getting these nested property, we get an exception "Compiled Queries across DataContexts with different LoadOptions not supported" . The first DataContext is coming from a DataContextFactory that we implemented with the refactorings, but this second one is just hanging off the entity property getter. We're implementing the Repository pattern in the refactoring process, so we must stop doing stuff like the above. Does anyone know of a good way to address this issue?

  Read the article

• From VB6 to .net via COM and Remoting...What a mess!

  - by Robert

  I have some legacy vb6 applications that need to talk to my .Net engine application. The engine provides an interface that can be connected to via .net Remoting. Now I have a stub class library that wraps all of the types that the interface exposes. The purpose of this stub is to translate my .net types into COM-friendly types. When I run this class library as a console application, it is able to connect to the engine, call various methods, and successfully return the wrapped types. The next step in the chain is to allow my VB6 application to call this COM enabled stub. This works fine for my main engine-entry type (IModelFetcher which is wrapped as COM_ModelFetcher). However, when I try and get any of the model fetcher's model types (IClientModel, wrapped as COM_IClientModel, IUserModel, wrapped as COM_IUserModel, e.t.c.), I get the following exception: [Exception - type: System.InvalidCastException 'Return argument has an invalid type.'] in mscorlib at System.Runtime.Remoting.Proxies.RealProxy.ValidateReturnArg(Object arg, Type paramType) at System.Runtime.Remoting.Proxies.RealProxy.PropagateOutParameters(IMessage msg, Object[] outArgs, Object returnValue) at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at AWT.Common.AWTEngineInterface.IModelFetcher.get_ClientModel() at AWT.Common.AWTEngineCOMInterface.COM_ModelFetcher.GetClientModel() The first thing I did when I saw this was to handle the 'AppDomain.CurrentDomain.AssemblyResolve' event, and this allowed me to load the required assemblies. However, I'm still getting this exception now. My AssemblyResolve event handler is loading three assemblies correctly, and I can confirm that it does not get called prior to this exception. Can someone help me untie myself from this mess of interprocess communication?!

  Read the article

• Wrappers/law of demeter seems to be an anti-pattern...

  - by Robert Fraser

  I've been reading up on this "Law of Demeter" thing, and it (and pure "wrapper" classes in general) seem to generally be anti patterns. Consider an implementation class: class Foo { void doSomething() { /* whatever */ } } Now consider two different implementations of another class: class Bar1 { private static Foo _foo = new Foo(); public static Foo getFoo() { return _foo; } } class Bar2 { private static Foo _foo = new Foo(); public static void doSomething() { _foo.doSomething(); } } And the ways to call said methods: callingMethod() { Bar1.getFoo().doSomething(); // Version 1 Bar2.doSomething(); // Version 2 } At first blush, version 1 seems a bit simpler, and follows the "rule of Demeter", hide Foo's implementation, etc, etc. But this ties any changes in Foo to Bar. For example, if a parameter is added to doSomething, then we have: class Foo { void doSomething(int x) { /* whatever */ } } class Bar1 { private static Foo _foo = new Foo(); public static Foo getFoo() { return _foo; } } class Bar2 { private static Foo _foo = new Foo(); public static void doSomething(int x) { _foo.doSomething(x); } } callingMethod() { Bar1.getFoo().doSomething(5); // Version 1 Bar2.doSomething(5); // Version 2 } In both versions, Foo and callingMethod need to be changed, but in Version 2, Bar also needs to be changed. Can someone explain the advantage of having a wrapper/facade (with the exception of adapters or wrapping an external API or exposing an internal one).

  Read the article

• Automatically generating Regex from set of strings residing in DB C#

  - by Muhammad Adeel Zahid

  Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

  Read the article

• detecting pauses in a spoken word audio file using pymad, pcm, vad, etc

  - by james

  First I am going to broadly state what I'm trying to do and ask for advice. Then I will explain my current approach and ask for answers to my current problems. Problem I have an MP3 file of a person speaking. I'd like to split it up into segments roughly corresponding to a sentence or phrase. (I'd do it manually, but we are talking hours of data.) If you have advice on how to do this programatically or for some existing utilities, I'd love to hear it. (I'm aware of voice activity detection and I've looked into it a bit, but I didn't see any freely available utilities.) Current Approach I thought the simplest thing would be to scan the MP3 at certain intervals and identify places where the average volume was below some threshold. Then I would use some existing utility to cut up the mp3 at those locations. I've been playing around with pymad and I believe that I've successfully extracted the PCM (pulse code modulation) data for each frame of the mp3. Now I am stuck because I can't really seem to wrap my head around how the PCM data translates to relative volume. I'm also aware of other complicating factors like multiple channels, big endian vs little, etc. Advice on how to map a group of pcm samples to relative volume would be key. Thanks!

  Read the article

• SSL with private key on an HSM

  - by Jason

  I have a client-server architecture in my application that uses SSL. Currently, the private key is stored in CAPI's key store location. For security reasons, I'd like to store the key in a safer place, ideally a hardware signing module (HSM) that is built for this purpose. Unfortunately, with the private key stored on such a device, I can't figure out how to use it in my application. On the server, I am simply using the SslStream class and the AuthenticateAsServer(...) call. This method takes an X509Certificate object that has its private key loaded, but since the private key is stored in a secure (e.g. non exportable) location on the HSM, I don't know how to do this. On the client, I am using an HttpWebRequest object and then using the ClientCertificates property to add my client authentication certificate, but I have the same problem here: how do I get the private key? I know there are some HSMs that act as SSL accelerators but I don't really need an accelerator. Also, these products tend to have special integration with web servers such as IIS and Apache which I'm not using. Any ideas? The only thing I can think of would be to write my own SSL library that would allow me to hand off the signing portion of the transaction to the HSM, but this seems like a huge amount of work.

  Read the article

• Beginning 3.2+ iPhone development

  - by Dinah

  I'm interested in learning Objective C for iPhone development. This is a topic which I realize has been covered to death. The qualifying difference is: I'd like to start learning beginning with the latest version (the most recent iPhone OS as of May, 2010 is ver. 3.2 and 4 beta is also out). I'd like to not have to wade through or unlearn legacy information. Using the links I've found throughout related topics on Stack Overflow, I'll read a blog post or tutorial which will say one thing, but then the comments will say, "this is different now in version xyz." For example, I've found this a few times regarding memory management/garbage collection. I assume that Apple's "getting started" doc.s will have the most recent info but many SO posts have said that those are not the most clear. The Stanford iPhone course looks great, but how do I know if it still applies to the most recent versions? Where should one start learning Objective C for iPhone development starting with version 3.2 or later without having as much exposure to legacy information?

  Read the article

< Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >