Search Results

Search found 16528 results on 662 pages for 'chen xiao long'.

Page 608/662 | < Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >

• waiting for 2 different events in a single thread

  - by João Portela

  component A (in C++) - is blocked waiting for alarm signals (not relevant) and IO signals (1 udp socket). has one handler for each of these. component B (java) - has to receive the same information the component A udp socket receives. periodicaly gives instructions that should be sent through component A udp socket. How to join both components? it is strongly desirable that: the changes to attach component B to component A are minimal (its not my code and it is not very pleasent to mess with). the time taken by the new operations (usually communicating with component B) interfere very little with the usual processing time of component A - this means that if the operations are going to take a "some" time I would rather use a thread or something to do them. note: since component A receives udp packets more frequently that it has component B instructions to forward, if necessary, it can only forward the instructions (when available) from the IO handler. my initial ideia was to develop a component C (in C++) that would sit inside the component A code (is this called an adapter?) that when instanciated starts the java process and makes the necessary connections (that not so little overhead in the initialization is not a problem). It would have 2 stacks, one for the data to give component B (lets call it Bstack) and for the data to give component A (lets call it Astack). It would sit on its thread (lets call it new-thread) waiting for data to be available in Bstack to send it over udp, and listen on the udp socket to put data on the Astack. This means that the changes to component A are only: when it receives a new UDP packet put it on the Bstack, and if there is something on the Astack sent it over its UDP socket (I decided for this because this socket would only be used in the main thread). One of the problems is that I don't know how to wait for both of these events at the same time using only one thread. so my questions are: Do I really need to use the main thread to send the data over component A socket or can I do it from the new-thread? (I think the answer is no, but I'm not sure about race conditions on sockets) how to I wait for both events? boost::condition_variable or something similar seems the solution in the case of the stack and boost::asio::io_service io_service.run() seems like the thing to use for the socket. Is there any other alternative solution for this problem that I'm not aware of? Thanks for reading this long text but I really wanted you to understand the problem.

  Read the article

• Loading the last related record instantly for multiple parent records using Entity framework

  - by Guillaume Schuermans

  Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• How can I combine xsl:attribute and xsl:use-attribute-sets to conditionally use an attribute set?

  - by Peter

  We have an xml node "item" with an attribute "style", which is "Header1". This style can change however. We have an attribute set named Header1 which defines how this should look in a PDF, generated through xsl:fo. This works (the use-attribute-sets is mentioned inline, in the fo:table-cell node): <xsl:template match="item[@type='label']"> <fo:table-row> <fo:table-cell xsl:use-attribute-sets="Header1"> <fo:block> <fo:inline font-size="8pt" > <xsl:value-of select="." /> </fo:inline> </fo:block> </fo:table-cell> </fo:table-row> </xsl:template> But this doesn't (using xsl:attribute, because the attribute @style can also be Header2 for example). It doesn't generate an error, the PDF is created, but the attributes aren't applied. <xsl:template match="item[@type='label']"> <fo:table-row> <fo:table-cell> <xsl:attribute name="xsl:use-attribute-sets"> <xsl:value-of select="@style" /> </xsl:attribute> <fo:block> <fo:inline font-size="8pt" > <xsl:value-of select="." /> </fo:inline> </fo:block> </fo:table-cell> </fo:table-row> </xsl:template> Does anyone know why? And how we could achieve this, preferably without long xsl:if or xsl:when stuff?

  Read the article

• basic operations for modifying a source document with XSLT

  - by SpliFF

  All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

  Read the article

• Fixed strptime exception with thread lock, but slows down the program

  - by eWizardII

  I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

  Read the article

• how do i know how many clients are calling my WCF service function

  - by ZhengZhiren

  i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

  Read the article

• Extending AdapterView

  - by Ander Webbs

  Hi, i'm trying to make (for learning purposes) my own implementation of a simple AdapterView where items comes from an basic Adapter (ImageAdapter from sdk samples). Actual code is like this: public class MyAdapterView extends AdapterView<ImageAdapter> implements AdapterView.OnItemClickListener{ private ImageAdapter mAdapter; public MyAdapterView(Context context, AttributeSet attrs, int defStyle) { super(context, attrs, defStyle); initThings(); } private void initThings(){ setOnItemClickListener(this); } @Override public ImageAdapter getAdapter() { // TODO Auto-generated method stub return mAdapter; } @Override public void setAdapter(ImageAdapter adapter) { // TODO Auto-generated method stub mAdapter=adapter; requestLayout(); } View obtainView(int position) { View child = mAdapter.getView(position, null, this); return child; } @Override protected void onLayout(boolean changed, int l, int t, int r, int b) { super.onLayout(changed, l, t, r, b); for(int i=0;i<mAdapter.getCount();i++){ View child = obtainView(i); child.layout(10, 70*i, 70, 70); addViewInLayout(child, i, null, true); } this.invalidate(); } @Override public void onItemClick(AdapterView<?> parent, View v, int position, long id) { Log.d("MYEXAMPLES","Clicked an item!"); } } This isn't a coding masterpiece, it just displays a pseudo-listview with pictures. I know i could've used ListView, GridView, Spinner, etc. but i'm relative new to android and i'm trying to figure out some things on it. Well, the question here is: Why is my onItemClick not firing? Using the same ImageAdapter with a GridView, everything works ok, but when i use with above class, i get nothing. Inside AdapterView.java there is code for those click, longclick, etc events... so why can't i just fire them? Maybe i'm misunderstanding basic things on how AdapterView works? Should I extend other base classes instead? And why? Hoping to find more experienced guidance on here, thanks in advance.

  Read the article

• How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

  - by Paul Chernoch

  I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

  Read the article

• Effective Data Validation

  - by John Conde

  What's an effective way to handle data validation, say, from a form submission? Originally I had a bunch of if statements that checked each value and collected invalid values in an array for later retrieval (and listing). // Store errors here $errors = array(); // Hypothetical check if a string is alphanumeric if (!preg_match('/^[a-z\d]+$/i', $fieldvalue)) { $errors[$fieldname] = 'Please only use letters and numbers for your street address'; } // etc... What I did next was create a class that handles various data validation scenarios and store the results in an internal array. After data validation was complete I would check to see if any errors occurred and handle accordingly: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more methods here public function creditCard($cardNumber, $field, $msg = '') { // Validate credit card number } // more methods here public function hasErrors() { return count($this->errorList); } } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue1, $fieldname1, 'Please only use letters and numbers for your street address'); $validate->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Naturally it didn't take long before this class became bloated with the virtually unlimited types of data to be validated. What I'm doing now is using decorators to separate the different types of data into their own classes and call them only when needed leaving generic validations (i.e. isAlphaNumeric()) in the base class: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more generic methods here public function setError($field, $msg = '') { $this->errorList[$field] = $msg; } public function hasErrors() { return count($this->errorList); } } class ValidationCreditCard { protected $validate; public function __construct(Validation $validate) { $this->validate = $validate; } public function creditCard($cardNumber, $field, $msg = '') { // Do validation // ... // if there is an error $this->validate->setError($field, $msg); } // more methods here } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue, $fieldname, 'Please only use letters and numbers for your street address'); $validateCC = new ValidationCreditCard($validate); $validateCC->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Am I on the right track? Or did I just complicate data validation more then I needed to?

  Read the article

• How to manipulate file paths intelligently in .Net 3.0?

  - by Hamish Grubijan

  Scenario: I am maintaining a function which helps with an install - copies files from PathPart1/pending_install/PathPart2/fileName to PathPart1/PathPart2/fileName. It seems that String.Replace() and Path.Combine() do not play well together. The code is below. I added this section: // The behavior of Path.Combine is weird. See: // http://stackoverflow.com/questions/53102/why-does-path-combine-not-properly-concatenate-filenames-that-start-with-path-dir while (strDestFile.StartsWith(@"\")) { strDestFile = strDestFile.Substring(1); // Remove any leading backslashes } Debug.Assert(!Path.IsPathRooted(strDestFile), "This will make the Path.Combine(,) fail)."); in order to take care of a bug (code is sensitive to a constant @"pending_install\" vs @"pending_install" which I did not like and changed (long story, but there was a good opportunity for constant reuse). Now the whole function: //You want to uncompress only the files downloaded. Not every file in the dest directory. private void UncompressFiles() { string strSrcDir = _application.Client.TempDir; ArrayList arrFiles = new ArrayList(); GetAllCompressedFiles(ref arrFiles, strSrcDir); IEnumerator enumer = arrFiles.GetEnumerator(); while (enumer.MoveNext()) { string strDestFile = enumer.Current.ToString().Replace(_application.Client.TempDir, String.Empty); // The behavior of Path.Combine is weird. See: // http://stackoverflow.com/questions/53102/why-does-path-combine-not-properly-concatenate-filenames-that-start-with-path-dir while (strDestFile.StartsWith(@"\")) { strDestFile = strDestFile.Substring(1); // Remove any leading backslashes } Debug.Assert(!Path.IsPathRooted(strDestFile), "This will make the Path.Combine(,) fail)."); strDestFile = Path.Combine(_application.Client.BaseDir, strDestFile); strDestFile = strDestFile.Replace(Path.GetExtension(strDestFile), String.Empty); ZSharpLib.ZipExtractor.ExtractZip(enumer.Current.ToString(), strDestFile); FileUtility.DeleteFile(enumer.Current.ToString()); } } Please do not laugh at the use of ArrayList and the way it is being iterated - it was pioneered by a C++ coder during a .Net 1.1 era. I will change it. What I am interested in: what is a better way of replacing PathPart1/pending_install/PathPart2/fileName with PathPart1/PathPart2/fileName within the current code. Note that _application.Client.TempDir is just _application.Client.BaseDir + @"\pending_install". While there are many ways to improve the code, I am mainly concerned with the part which has to do with String.Replace(...) and Path.Combine(,). I do not want to make changes outside of this function. I wish Path.Combine(,) took an optional bool flag, but it does not. So ... given my constraints, how can I rework this so that it starts to sucks less? Thanks!

  Read the article

• Remote Postgresql - extremely slow

  - by Muffinbubble

  Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

  Read the article

• how to fix protocol violation in c#

  - by Jeremy Styers

  I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

  Read the article

• how to deal with the position in a c# stream

  - by CapsicumDreams

  The (entire) documentation for the position property on a stream says: When overridden in a derived class, gets or sets the position within the current stream. The Position property does not keep track of the number of bytes from the stream that have been consumed, skipped, or both. That's it. OK, so we're fairly clear on what it doesn't tell us, but I'd really like to know what it in fact does stand for. What is 'the position' for? Why would we want to alter or read it? If we change it - what happens? In a pratical example, I have a a stream that periodically gets written to, and I have a thread that attempts to read from it (ideally ASAP). From reading many SO issues, I reset the position field to zero to start my reading. Once this is done: Does this affect where the writer to this stream is going to attempt to put the data? Do I need to keep track of the last write position myself? (ie if I set the position to zero to read, does the writer begin to overwrite everything from the first byte?) If so, do I need a semaphore/lock around this 'position' field (subclassing, perhaps?) due to my two threads accessing it? If I don't handle this property, does the writer just overflow the buffer? Perhaps I don't understand the Stream itself - I'm regarding it as a FIFO pipe: shove data in at one end, and suck it out at the other. If it's not like this, then do I have to keep copying the data past my last read (ie from position 0x84 on) back to the start of my buffer? I've seriously tried to research all of this for quite some time - but I'm new to .NET. Perhaps the Streams have a long, proud (undocumented) history that everyone else implicitly understands. But for a newcomer, it's like reading the manual to your car, and finding out: The accelerator pedal affects the volume of fuel and air sent to the fuel injectors. It does not affect the volume of the entertainment system, or the air pressure in any of the tires, if fitted. Technically true, but seriously, what we want to know is that if we mash it to the floor you go faster..

  Read the article

• Android onActivityResult is always 0

  - by Dean

  This has been killing me for two days now. I have a main Activity A which calls a second Activity B. Activity B simply presents the user with a listview. When I press an item on the list view I want a couple of strings to be passed back to the main Activity A and Activiy B will finish. The problem is I always get a resultcode of 0 and the data bundle is null. I really don't understand why this is happening. Here is my code. Start Activity B for result; Test.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View v) { Intent i = new Intent(recipeActivity.this, BrowseLoadRecipes.class); startActivityForResult(i, RECIPE_CHOOSER); } }); This starts the second Activity fine. Activity B populates a listview and when I click an item I'm trying to send some data back to the calling Activity A. Any text at the moment, so I used the following in Activity B; lv.setOnItemClickListener(new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> a, View v, int position, long id) { Bundle bundle = new Bundle(); bundle.putString("TEXT", "Please work... pleeeeaasee"); Intent mIntent = new Intent(); mIntent.putExtras(bundle); setResult(RESULT_OK, mIntent); finish(); } }); In the calling activity I have the following listening for the return as follows; protected void onActivityResult(int requestCode, int resultCode, Intent data) { switch(requestCode) { //TODO case RECIPE_CHOOSER: Toast.makeText(getApplicationContext(), "In recipe return", Toast.LENGTH_SHORT).show(); Toast.makeText(getApplicationContext(), "resultCode is " + String.valueOf(resultCode), Toast.LENGTH_SHORT).show(); if (resultCode == RESULT_OK) { Bundle b = getIntent().getExtras(); Toast.makeText(getApplicationContext(), "Returned " + b.getString("TEXT"), Toast.LENGTH_LONG).show(); } if (resultCode == RESULT_CANCELED) { } break; } } } I can see that the request code is correctly returned, but the resultcode is always a 0 and the data is always a null. I've ran through the debug and the setResult is doing its job and the bundle does indeed have the data I'm passing, but it's lost at some point along the way. Is there something in the manifest I'm missing or something. It's killed my progress on this project so far. Any help would truly be appreciated. Thanks, Dean

  Read the article

• Database schema for simple stats project

  - by Bubnoff

  Backdrop: I have a file hierarchy of cvs files for multiple locations named by dates they cover ...by month specifically. Each cvs file in the folder is named after the location. eg', folder name: 2010-feb contains: location1.csv location2.csv Each CSV file holds records like this: 2010-06-28, 20:30:00 , 0 2010-06-29, 08:30:00 , 0 2010-06-29, 09:30:00 , 0 2010-06-29, 10:30:00 , 0 2010-06-29, 11:30:00 , 0 meaning of record columns ( column names ): Date, time, # of sessions I have a perl script that pulls the data from this mess and originally I was going to store it as json files, but am thinking a database might be more appropriate long term ...comparing year to year trends ...fun stuff like that. Pt 2 - My question/problem: So I now have a REST service that coughs up json with a test database. My question is [ I suck at db design ], how best to design a database backend for this? I am thinking the following tables would suffice and keep it simple: Location: (PK)location_code, name session: (PK)id, (FK)location_code, month, hour, num_sessions I need to be able to average sessions (plus min and max) for each hour across days of week in addition to days of week in a given month or months. I've been using perl hashes to do this and am trying to decide how best to implement this with a database. Do you think stored procedures should be used? As to the database, depending on info gathered here, it will be postgresql or sqlite. If there is no compelling reason for postgresql I'll stick with sqlite. How and where should I compare the data to hours of operation. I am storing the hours of operation in a yaml file. I currently 'match' the hour in the data to a hash from the yaml to do this. Would a database open simpler methods? I am thinking I would do this comparison as I do now then insert the data. Can be recalled with: SELECT hour, num_sessions FROM session WHERE location_code=LOC1 Since only hours of operation are present, I do not need to worry about it. Should I calculate all results as I do now then store as a stats table for different 'reports'? This, rather than processing on demand? How would this look? Anyway ...I ramble. Thanks for reading! Bubnoff

  Read the article

• One intent is working, second is giving me a crash

  - by user1480742

  ok, so both intents receiver sides are on the same activite and they are sending from different ones....second one is not working, first one does, dont know why...all 3 activites are ok in manifest and all that //second intent on senders side public void onItemSelected(AdapterView<?> arg0, View users, int i, long l) { FILENAME = (adapter.getItem(i)).toString(); Bundle viewBag2 = new Bundle(); viewBag2.putString("profile_name", FILENAME); Intent b = new Intent(OptionsMenu.this, CoreActivity.class); b.putExtras(viewBag2); startActivity(b); } //second intent on receiver side private void Data_transfer() { Bundle gotbasket2 = getIntent().getExtras(); profileName = gotbasket2.getString("profile_name"); } //first (working intent) on senders side public void onClick(View v) { Bundle viewBag = new Bundle(); viewBag.putString("spinner_result", s); a.putExtras(viewBag); } //first (working intent) on receiver side private void Data_transfer() { // TODO Auto-generated method stub Bundle gotbasket = getIntent().getExtras(); x = gotbasket.getString("spinner_result"); } 06-26 20:22:09.787: D/AndroidRuntime(1802): Shutting down VM 06-26 20:22:09.787: W/dalvikvm(1802): threadid=1: thread exiting with uncaught exception (group=0x40015560) 06-26 20:22:09.847: E/AndroidRuntime(1802): FATAL EXCEPTION: main 06-26 20:22:09.847: E/AndroidRuntime(1802): java.lang.RuntimeException: Unable to start activity ComponentInfo{mioc.diver/mioc.diver.CoreActivity}: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Handler.dispatchMessage(Handler.java:99) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Looper.loop(Looper.java:123) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.main(ActivityThread.java:3683) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invokeNative(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invoke(Method.java:507) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 06-26 20:22:09.847: E/AndroidRuntime(1802): at dalvik.system.NativeStart.main(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): Caused by: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.Data_transfer(CoreActivity.java:189) 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.onCreate(CoreActivity.java:88) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611) 06-26 20:22:09.847: E/AndroidRuntime(1802): ... 11 more

  Read the article

• Refactoring Singleton Overuse

  - by drharris

  Today I had an epiphany, and it was that I was doing everything wrong. Some history: I inherited a C# application, which was really just a collection of static methods, a completely procedural mess of C# code. I refactored this the best I knew at the time, bringing in lots of post-college OOP knowledge. To make a long story short, many of the entities in code have turned out to be Singletons. Today I realized I needed 3 new classes, which would each follow the same Singleton pattern to match the rest of the software. If I keep tumbling down this slippery slope, eventually every class in my application will be Singleton, which will really be no logically different from the original group of static methods. I need help on rethinking this. I know about Dependency Injection, and that would generally be the strategy to use in breaking the Singleton curse. However, I have a few specific questions related to this refactoring, and all about best practices for doing so. How acceptable is the use of static variables to encapsulate configuration information? I have a brain block on using static, and I think it is due to an early OO class in college where the professor said static was bad. But, should I have to reconfigure the class every time I access it? When accessing hardware, is it ok to leave a static pointer to the addresses and variables needed, or should I continually perform Open() and Close() operations? Right now I have a single method acting as the controller. Specifically, I continually poll several external instruments (via hardware drivers) for data. Should this type of controller be the way to go, or should I spawn separate threads for each instrument at the program's startup? If the latter, how do I make this object oriented? Should I create classes called InstrumentAListener and InstrumentBListener? Or is there some standard way to approach this? Is there a better way to do global configuration? Right now I simply have Configuration.Instance.Foo sprinkled liberally throughout the code. Almost every class uses it, so perhaps keeping it as a Singleton makes sense. Any thoughts? A lot of my classes are things like SerialPortWriter or DataFileWriter, which must sit around waiting for this data to stream in. Since they are active the entire time, how should I arrange these in order to listen for the events generated when data comes in? Any other resources, books, or comments about how to get away from Singletons and other pattern overuse would be helpful.

  Read the article

• How do I handle the Maybe result of at in Control.Lens.Indexed without a Monoid instance

  - by Matthias Hörmann

  I recently discovered the lens package on Hackage and have been trying to make use of it now in a small test project that might turn into a MUD/MUSH server one very distant day if I keep working on it. Here is a minimized version of my code illustrating the problem I am facing right now with the at lenses used to access Key/Value containers (Data.Map.Strict in my case) {-# LANGUAGE OverloadedStrings, GeneralizedNewtypeDeriving, TemplateHaskell #-} module World where import Control.Applicative ((<$>),(<*>), pure) import Control.Lens import Data.Map.Strict (Map) import qualified Data.Map.Strict as DM import Data.Maybe import Data.UUID import Data.Text (Text) import qualified Data.Text as T import System.Random (Random, randomIO) newtype RoomId = RoomId UUID deriving (Eq, Ord, Show, Read, Random) newtype PlayerId = PlayerId UUID deriving (Eq, Ord, Show, Read, Random) data Room = Room { _roomId :: RoomId , _roomName :: Text , _roomDescription :: Text , _roomPlayers :: [PlayerId] } deriving (Eq, Ord, Show, Read) makeLenses ''Room data Player = Player { _playerId :: PlayerId , _playerDisplayName :: Text , _playerLocation :: RoomId } deriving (Eq, Ord, Show, Read) makeLenses ''Player data World = World { _worldRooms :: Map RoomId Room , _worldPlayers :: Map PlayerId Player } deriving (Eq, Ord, Show, Read) makeLenses ''World mkWorld :: IO World mkWorld = do r1 <- Room <$> randomIO <*> (pure "The Singularity") <*> (pure "You are standing in the only place in the whole world") <*> (pure []) p1 <- Player <$> randomIO <*> (pure "testplayer1") <*> (pure $ r1^.roomId) let rooms = at (r1^.roomId) ?~ (set roomPlayers [p1^.playerId] r1) $ DM.empty players = at (p1^.playerId) ?~ p1 $ DM.empty in do return $ World rooms players viewPlayerLocation :: World -> PlayerId -> RoomId viewPlayerLocation world playerId= view (worldPlayers.at playerId.traverse.playerLocation) world Since rooms, players and similar objects are referenced all over the code I store them in my World state type as maps of Ids (newtyped UUIDs) to their data objects. To retrieve those with lenses I need to handle the Maybe returned by the at lens (in case the key is not in the map this is Nothing) somehow. In my last line I tried to do this via traverse which does typecheck as long as the final result is an instance of Monoid but this is not generally the case. Right here it is not because playerLocation returns a RoomId which has no Monoid instance. No instance for (Data.Monoid.Monoid RoomId) arising from a use of `traverse' Possible fix: add an instance declaration for (Data.Monoid.Monoid RoomId) In the first argument of `(.)', namely `traverse' In the second argument of `(.)', namely `traverse . playerLocation' In the second argument of `(.)', namely `at playerId . traverse . playerLocation' Since the Monoid is required by traverse only because traverse generalizes to containers of sizes greater than one I was now wondering if there is a better way to handle this that does not require semantically nonsensical Monoid instances on all types possibly contained in one my objects I want to store in the map. Or maybe I misunderstood the issue here completely and I need to use a completely different bit of the rather large lens package?

  Read the article

• Spring MVC, REST, and HATEOAS

  - by SingleShot

  I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

  Read the article

• Parsing CSV File to MySQL DB in PHP

  - by Austin

  I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

  Read the article

• Jquery-UI tabs : Double loading of the default tab with

  - by Stephane

  I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

  Read the article

• SQL query - choosing 'last updated' record in a group, better db design?

  - by Jimmy

  Hi, Let's say I have a MySQL database with 3 tables: table 1: Persons, with 1 column ID (int) table 2: Newsletters, with 1 column ID (int) table 3: Subscriptions, with columns Person_ID (int), Newsletter_ID (int), Subscribed (bool), Updated (Datetime) Subscriptions.Person_ID points to a Person, and Subscription.Newsletter_ID points to a Newsletter. Thus, each person may have 0 or more subscriptions to 0 or more magazines at once. The table Subscriptions will also store the entire history of each person's subscriptions to each newsletter. If a particular Person_ID-Newsletter_ID pair doesn't have a row in the Subscriptions table, then it's equivalent to that pair having a subscription status of 'false'. Here is a sample dataset Persons ID 1 2 3 Newsletters ID 4 5 6 Subscriptions Person_ID Newsletter_ID Subscribed Updated 2 4 true 2010-05-01 3 4 true 2010-05-01 3 5 true 2010-05-10 3 4 false 2010-05-15 Thus, as of 2010-05-16, Person 1 has no subscription, Person 2 has a subscription to Newsletter 4, and Person 3 has a subscription to Newsletter 5. Person 3 had a subscription to Newsletter 4 for a while, but not anymore. I'm trying to do 2 kinds of query. A query that shows everyone's active subscriptions as of query time (we can assume that updated will never be in the future -- thus, this means returning the record with the latest 'updated' value for each Person_ID-Newsletter_ID pair, as long as Subscribed is true (if the latest record for a Person_ID-Newsletter_ID pair has a Subscribed status of false, then I don't want that record returned)). A query that returns all active subscriptions for a specific newsletter - same qualification as in 1. regarding records with 'false' in the Subscribed column. I don't use SQL/databases often enough to tell if this design is good, or if the SQL queries needed would be slow on a database with, say, 1M records in the Subscriptions table. I was using the Visual query builder tool in Visual Studio 2010 but I can't even get the query to return the latest updated record for each Person_ID-Newsletter_ID pair. Is it possible to come up with SQL queries that don't involve using subqueries (presumably because they would become too slow with a larger data set)? If not, would it be a better design to have a separate Subscriptions_History table, and every time a subscription status for a Person_ID-Newsletter-ID pair is added to Subscriptions, any existing record for that pair is moved to Subscriptions_History (that way the Subscriptions table only ever contains the latest status update for any Person_ID-Newsletter_ID pair)? I'm using .net on Windows, so would it be easier (or the same, or harder) to do this kind of queries using Linq? Entity Framework? Thanks!

  Read the article

• Multiple word Auttosuggest using Lucene.Net

  - by eric

  I am currently working on an search application which uses Lucene.Net to index the data from the database to Index file. I have a product catalog which has Name, short and long description, sku and other fields. The data is stored in Index using StandardAnalyzer. I am trying to add auto suggestion for a text field and using TermEnum to get all the keyword terms and its score from the Index. But the terms returned are of single term. For example, if I type for co, the suggestion returned are costume, count, collection, cowboy, combination etc. But I want the suggestion to return phrases. For exmaple, if I search for co, the suggestions should be cowboy costume, costume for adults, combination locks etc. The following is the code used to get the suggestions: public string[] GetKeywords(string strSearchExp) { IndexReader rd = IndexReader.Open(mIndexLoc); TermEnum tenum = rd.Terms(new Term("Name", strSearchExp)); string[] strResult = new string[10]; int i = 0; Dictionary<string, double> KeywordList = new Dictionary<string, double>(); do { //terms = tenum.Term(); if (tenum.Term() != null) { //strResult[i] = terms.text.ToString(); KeywordList.Add(tenum.Term().text.ToString(), tenum.DocFreq()); } } while (tenum.Next() && tenum.Term().text.StartsWith(strSearchExp) && tenum.Term().text.Length > 1); var sortedDict = (from entry in KeywordList orderby entry.Value descending select entry); foreach (KeyValuePair<string, double> data in sortedDict) { if (data.Key.Length > 1) { strResult[i] = data.Key; i++; } if (i >= 10) //Exit the for Loop if the count exceeds 10 break; } tenum.Close(); rd.Close(); return strResult; } Can anyone please give me directions to achive this? Thanks for looking into this.

  Read the article

• Simple RSA encryption (Java)

  - by jake blue

  This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

  Read the article

< Previous Page | 604 605 606 607 608 609 610 611 612 613 614 615  | Next Page >