Search Results

Search found 4647 results on 186 pages for 'localizable strings'.

Page 62/186 | < Previous Page | 58 59 60 61 62 63 64 65 66 67 68 69  | Next Page >

  • Create Class objects based on type signature

    - by Andreas_D
    Class.forName(boolean.class.getName()); This doesn't work in Java - the virtual machine slaps you with a ClassNotFoundException. I was in need for something like that because I wanted to reflect methods based on Strings that included the method signatures, like public void doSomething(boolean yesWeCan, java.lang.String[] presidents); At the end I came up with a custom 'ClassFactory' which translates the type Strings to class objects. This factory includes a lot of handlers for primitive and array type values. The handler for array type objects is something like: if (isArrayOfObjects) { return Class.forName("L["+typeName.replace("[]", "")+";"); } My question is - have I missed something in the Java 1.5+ API that might do the trick?

    Read the article

  • php codeigniter MySQL search query

    - by kalafun
    I want to create a search query on MySQL database that will consist of 5 different strings typed in from user. I want to query 5 different table columns with these strings. When I for example have input fields like: first name, last name, address, post number, city. How should I query the database that I dont always get all the rows. My query is something like this: SELECT user_id, username from users where a like %?% AND b like %?% AND c like %?% AND d like %?% AND e like %?%; When I exchange the AND for OR I always get all the results which makes sense, and when I use AND I get only the exact matches... Is there any function or statement that would help me with this?

    Read the article

  • C++ string array from ifstream

    - by David Beck
    I have a program that I need to read in an array of strings from a file. The array must be C type strings (char * or char[]). Using the following code, I get a bad access error: for (i = 0; i < MAX_WORDS && !inputFile.eof(); i++) { inputFile >> words[i]; } words is declared as: char *words[MAX_WORDS];

    Read the article

  • Delphi: How to localize description for a menu shortcut?

    - by Ulrich Gerhardt
    Is there a way to get a localized description of a shortcut like Ctrl+Z so that I get "Ctrl+Z" if the app runs on an English system and "Strg+Z" on a German system? The VCL function ShortCutToText isn't internationalized. The API function GetKeyNameText is a bit better but still not perfect: If one switches the regional settings of a German XP to English (US), it still produces German texts. Besides the results are in CAPITALS which is ugly. Clarification: I know how I can replace ShortCutToText or the Smkc* resource strings with customized versions. But to use that I need the translated strings. And I would like to get these from the OS (or similar). Update: It looks like Microsoft expects developers to do the translation on their own - see 2. in Associating a Menu Item with an Accelerator Key.

    Read the article

  • Pick Random String From Array

    - by atrljoe
    How do I go about picking a random string from my array but not picking the same one twice. string[] names = { "image1.png", "image2.png", "image3.png", "image4.png", "image5.png" }; Is this possible? I was thinking about using return strings[random.Next(strings.Length)]; But this has the possibility of returning the same string twice. Or am I wrong about this? Should I be using something else like a List to accomplish this. Any feedback is welcome.

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • File System Types in .Net

    - by Avi
    I don't get the abstractions and the terminology :-( For example, DirectoryInfo.FullName is defined as the full path of the directory or file, but it's a string! So is DirectoryInfo.Name, FileInfo.FullName, Path.GetDirectoyName and so on. This means that in .Net there is no "depth" (or "meat" - my English isn't so good) for the file system objects. There's no protection from a type system. I can't, for example, define two Path objects and ask if one of them is "above" the other - I have to manipulate the strings. I can't differentiate between a Path that identifies a directory and a path that identifies a file. I can't do anything!-( Just manipulate strings. Is this correct (or am I simply missing something). If correct, are there any alternatives?

    Read the article

  • String.split() - matching leading empty String prior to first delimiter?

    - by tehblanx
    I need to be able to split an input String by commas, semi-colons or white-space (or a mix of the three). I would also like to treat multiple consecutive delimiters in the input as a single delimiter. Here's what I have so far: String regex = "[,;\\s]+"; return input.split(regex); This works, except for when the input string starts with one of the delimiter characters, in which case the first element of the result array is an empty String. I do not want my result to have empty Strings, so that something like, ",,,,ZERO; , ;;ONE ,TWO;," returns just a three element array containing the capitalized Strings. Is there a better way to do this than stripping out any leading characters that match my reg-ex prior to invoking String.split? Thanks in advance!

    Read the article

  • Efficient questions

    - by rayman
    Hi, I have to manage xml's and Strings in my app. by efficenty and memory saving, is collection(ArrayList) will be much more 'expensive' then array of Strings? another issue is: i could use the content as regular String, or XML.. is working with XML also makes it more 'expensive' ? when i say i expensive i talk about taking system sources. please tell me by any of your exprience if the diffrences are significant? thanks, ray.

    Read the article

  • Whats the difference between a C++ and a Cocoa Project in Xcode?

    - by david
    I need to work with TagLib for my project. I've created a framework (and I tried using it as a lib) but the compiler cannot find #include < strings on compiling (No such file or Directory). I've created a test C++ project and it #includes < strings just fine. I've looked at the project settings and I cannot find a difference between them. But the standard cocoa projects obviously so not have the search path set to include C++ libraries (Or am I completely getting it wrong?). I've searched for a solution but no one else seems to have run into this problem.

    Read the article

  • fastest in objC: IsEqualToString:@"" or length > 0?

    - by Cœur
    I'd like to know which one is fastest for testing a non-empty NSString for iOS 4.0+ (iPhone 3G). Note: the strings to test will be 99% of the time from 2 to 100 chars length. if ([foo length] > 0) or if ([foo isEqualToString:@""] == NO && foo != nil) I think it depends if isEqualToString: compares the length first (and in that case first way is faster) or if isEqualToString: compares first character of strings first (and in that case second way might be faster). ps: I already know isEqualToString: is faster than isEqual: which is itself faster than compare:.

    Read the article

  • (C++) While reading a file (ifstream), is there any way to direct it to make a new line?

    - by Enzo
    While reading a file (ifstream), is there any way to direct it to make a new line? For instance, I would like for THIS to happen: myfilearray[1]array[2]endl; Obviously, the "endl" just isn't allowed. Is there another way to do this? Edit---thanks for the quick responses guys! From a text file, I'm trying to store two strings from that file into arrays and then do the same with the next line (or until I desire, using a for loop) Using strings is important to me as it will make my future program a lot more flexible.

    Read the article

  • Pass variable number of variables to a class in PHP

    - by user325282
    I need to pass a variable number of strings to instantiate different classes. I can always do a switch on the size of the array: switch(count($a)) { case 1: new Class(${$a[0]}); break; case 2: new Class(${$a[0]}, ${$a[1]}); break; etc... There has to be a better way to do this. If I have an array of strings ("variable1", "variable2", 'variable3", ...), how can I instantiate a Class without manually accounting for every possibility?

    Read the article

  • Get the top nth values from a rectangular array

    - by user355925
    I am reading a txt file for strings that represent integers. The file is space delimited. I have created an array[10,2]. Everytime the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. i.e. txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. The result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

    Read the article

  • Converting image to byte/encoding it? - RichTextBox

    - by user1667191
    I have strings that are "Images", although they are in "String" format. Here's how one of the strings look like: {\pict\wmetafile8\picw820\pich900\picwgoal465\pichgoal510 010009000003ac1000000000f60900000000f6090000..etc.. It goes on like this for a few more lines. The guy that got this said he converted the image by pasting it in a richtextbox and getting that string. How can I go about getting the same result? Sorry for the lack of info. Just not sure how this is called.

    Read the article

  • In-memory data structure that supports boolean querying

    - by sanity
    I need to store data in memory where I map one or more key strings to an object, as follows: "green", "blue" -> object1 "red", "yellow" -> object2 I need to be able to efficiently receive a list of objects, where the strings match some boolean criteria, such as: ("red" OR "green") AND NOT "blue" I'm working in Java, so the ideal solution would be an off-the-shelf Java library. I am, however, willing to implement something from scratch if necessary. Anyone have any ideas? I'd rather avoid the overhead of an in-memory database if possible, I'm hoping for something comparable in speed to a HashMap (or at least the same order of magnitude).

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • Map a property in the entity framework to a different type

    - by Tom
    I have a SQL Server 2008 database. I have a bunch of fields in TableA that are just strings that corresponds to booleans. So every value is either true or false. The edmx I generated using Entity Framework 4.0 has them as strings. This is technically correct but I would like to have them mapped as Booleans instead. Is this possible? If so how can I accomplish this? Thanks much!

    Read the article

< Previous Page | 58 59 60 61 62 63 64 65 66 67 68 69  | Next Page >