Search Results

Search found 16914 results on 677 pages for 'single threaded'.

Page 628/677 | < Previous Page | 624 625 626 627 628 629 630 631 632 633 634 635  | Next Page >

  • How to perform duplicate key validation using entlib (or DataAnnotations), MVC, and Repository pattern

    - by olivehour
    I have a set of ASP.NET 4 projects that culminate in an MVC (3 RC2) app. The solution uses Unity and EntLib Validation for cross-cutting dependency injection and validation. Both are working great for injecting repository and service layer implementations. However, I can't figure out how to do duplicate key validation. For example, when a user registers, we want to make sure they don't pick a UserID that someone else is already using. For this type of validation, the validating object must have a repository reference... or some other way to get an IQueryable / IEnumerable reference to check against other rows already in the DB. What I have is a UserMetadata class that has all of the property setters and getters for a user, along with all of the appropriate DataAnnotations and EntLib Validation attributes. There is also a UserEntity class implemented using EF4 POCO Entity Generator templates. The UserEntity depends on UserMetadata, because it has a MetadataTypeAttribute. I also have a UserViewModel class that has the same exact MetadataType attribute. This way, I can apply the same validation rules, via attributes, to both the entity and viewmodel. There are no concrete references to the Repository classes whatsoever. All repositories are injected using Unity. There is also a service layer that gets dependency injection. In the MVC project, service layer implementation classes are injected into the Controller classes (the controller classes only contain service layer interface references). Unity then injects the Repository implementations into the service layer classes (service classes also only contain interface references). I've experimented with the DataAnnotations CustomValidationAttribute in the metadata class. The problem with this is the validation method must be static, and the method cannot instantiate a repository implementation directly. My repository interface is IRepository, and I have only one single repository implementation class defined as EntityRepository for all domain objects. To instantiate a repository explicitly I would need to say new EntityRepository(), which would result in a circular dependency graph: UserMetadata [depends on] DuplicateUserIDValidator [depends on] UserEntity [depends on] UserMetadata. I've also tried creating a custom EntLib Validator along with a custom validation attribute. Here I don't have the same problem with a static method. I think I could get this to work if I could just figure out how to make Unity inject my EntityRepository into the validator class... which I can't. Right now, all of the validation code is in my Metadata class library, since that's where the custom validation attribute would go. Any ideas on how to perform validations that need to check against the current repository state? Can Unity be used to inject a dependency into a lower-layer class library?

    Read the article

  • Windows Question: RunOnce/Second Boot Issues [closed]

    - by Greg
    Moved to Super User: Windows Question: RunOnce/Second Boot Issues I am attempting to create a Windows XP SP3 image that will run my application on Second Boot. Here is the intended workflow. 1) Run Image Prep Utility (I wrote) on windows to add my runonce entries and clean a few things up. 2) Reboot to ghost, make image file. 3) Package into my ISO and distribute. 4) System will be imaged by user. 5) On first boot, I have about 5 things that run, one of which includes a driver updater (I wrote) for my own specific devices. 6) One of the entries inside of HKCU/../runonce is a reg file, which adds another key to HKLM/../runonce. This is how second boot is acquired. 7) As a result of the driver updater, user is prompted to reboot. 8) My application is then launched from HKLM/../runonce on second boot. This workflow works perfectly, except for a select few legacy systems that contain devices that cause the add hardware wizard to pop up. When the add hardware wizard pops up is when I begin to see problems. It's important to note, that if I manually inspect the registry after the add hardware wizard pops up, it appears as I would expect, with all the first boot scripts having run, and it's sitting in a state I would correctly expect it to be in for a second boot scenario. The problem comes when I click next on the add hardware wizard, it seems to re-run the single entry I've added, and re-executes the runonce scripts. (only one script now as it's already executed and cleared out the initial entries). This causes my application to open as if it were a second boot, only when next is clicked on the add hardware wizard. If I click cancel, and reboot, then it also works as expected. I don't care as much about other solutions, because I could design a system that doesn't fully rely on Microsoft's registry. I simply can't find any information as to WHY this is happening. I believe this is some type of Microsoft issue that's presenting itself as a result of an overstretched image that's expected to support too many legacy platforms, but any help that can be provided would be appreciated. Thanks,

    Read the article

  • objective C convert NSString to unsigned

    - by user1501354
    I have changed my question. I want to convert an NSString to an unsigned int. Why? Because I want to do parallel payment in PayPal. Below I have given my coding in which I want to convert the NSString to an unsigned int. My query is: //optional, set shippingEnabled to TRUE if you want to display shipping //options to the user, default: TRUE [PayPal getPayPalInst].shippingEnabled = TRUE; //optional, set dynamicAmountUpdateEnabled to TRUE if you want to compute //shipping and tax based on the user's address choice, default: FALSE [PayPal getPayPalInst].dynamicAmountUpdateEnabled = TRUE; //optional, choose who pays the fee, default: FEEPAYER_EACHRECEIVER [PayPal getPayPalInst].feePayer = FEEPAYER_EACHRECEIVER; //for a payment with multiple recipients, use a PayPalAdvancedPayment object PayPalAdvancedPayment *payment = [[PayPalAdvancedPayment alloc] init]; payment.paymentCurrency = @"USD"; // A payment note applied to all recipients. payment.memo = @"A Note applied to all recipients"; //receiverPaymentDetails is a list of PPReceiverPaymentDetails objects payment.receiverPaymentDetails = [NSMutableArray array]; NSArray *emailArray = [NSArray arrayWithObjects:@"[email protected]",@"[email protected]", nil]; for (int i = 1; i <= 2; i++) { PayPalReceiverPaymentDetails *details = [[PayPalReceiverPaymentDetails alloc] init]; // Customize the payment notes for one of the three recipient. if (i == 2) { details.description = [NSString stringWithFormat:@"Component %d", i]; } details.recipient = [NSString stringWithFormat:@"%@",[emailArray objectAtIndex:i-1]]; unsigned order; if (i==1) { order = [[feeArray objectAtIndex:0] unsignedIntValue]; } if (i==2) { order = [[amountArray objectAtIndex:0] unsignedIntValue]; } //subtotal of all items for this recipient, without tax and shipping details.subTotal = [NSDecimalNumber decimalNumberWithMantissa:order exponent:-4 isNegative:FALSE]; //invoiceData is a PayPalInvoiceData object which contains tax, shipping, and a list of PayPalInvoiceItem objects details.invoiceData = [[PayPalInvoiceData alloc] init]; //invoiceItems is a list of PayPalInvoiceItem objects //NOTE: sum of totalPrice for all items must equal details.subTotal //NOTE: example only shows a single item, but you can have more than one details.invoiceData.invoiceItems = [NSMutableArray array]; PayPalInvoiceItem *item = [[PayPalInvoiceItem alloc] init]; item.totalPrice = details.subTotal; [details.invoiceData.invoiceItems addObject:item]; [payment.receiverPaymentDetails addObject:details]; } [[PayPal getPayPalInst] advancedCheckoutWithPayment:payment]; Can anybody tell me how to do this conversion? Thanks and regards in advance.

    Read the article

  • Need a fast programming language that can drive two printers

    - by Pete
    I have a rather unusual application that isn't working the way I need, and I hope someone here will have some suggestions or at least a direction to investigate. We have a museum exhibit that has a computer at the entrance driving two small receipt printers. There are two buttons on a console, wired to the left and right buttons of a disemboweled mouse. The two printers and associated buttons are for girls and boys, each button does a random selection from a database of names and prints a small ticket on the appropriate printer with a graphic image, a few words about the exhibit and the randomly chosen name. Conceptually all is well, but it hangs quite often. I got the project at the last minute, because the original designer got bogged down and couldn't deliver, so the exhibit's author asked me the day before opening, whether I could write something that would work. I did it in Word, since I am an experienced VBA programmer. Several other avenues I attempted first all lead to dead ends - one couldn't do graphics, another couldn't handle two printers, yet another couldn't change fonts and so on. The problem is that it simply isn't fast enough - Word can only drive one printer at a time and changing the active printer takes a long time. Not by office standards, where a second or two of delay before a printer starts working on your document is not an issue, but here I need more or less instant response. If kids press a button and nothing happens, they press it over and over until something does happen, resulting in maybe half a dozen commands being sent before the printer starts reacting. Sometimes it jams the program completely, since boys and girls will be pressing the two buttons simultaneously and Word locks up, and even when it doesn't jam, the printers then spit out a stream of tickets, making a mess. The kids start squabbling over which ticket is whose, pulling them out of the printers, snarling the paper tape, jamming the printer and generally making a mess of the whole affair, often necessitating the exhibit caretakers having to restart the computer and clear torn bits of paper out the printers. What I need is some sort of fast programming language that can drive two printers *-simultaneously-*, not the MSOffice claptrap of having to switch the active printer, that can react to both left and right mouse button click events, can print a small graphic image and can print in different font sizes and styles and. I don't need many, but it's not all in one typeface. Can anyone suggest what I might use for this? I don't even know if it's possible at all under Windows, whether the "single active printer" garbage is an Office artifact, or a Windows restriction. My little Commodore-64 twenty-five years ago had two printers attached to it and drove both simultaneously with no difficulties - it doesn't seem to me it should be such an impossible requirement today.

    Read the article

  • Detecting abuse for post rating system

    - by Steven smethurst
    I am using a wordpress plugin called "GD Star Rating" to allow my users to vote on stories that I post to one of my websites. http://everydayfiction.com/ Recently we have been having a lot of abuse of the system. Stories that have obviously been voted up artificially. "GD Star Rating" creates some detailed logs when a user votes on a story. Including; IP, Time of vote, and user_adgent, ect.. For example this story has 181 votes with an average of 5.7 http://www.everydayfiction.com/snowman-by-shaun-simon/ Most other stories only get around ~40 votes each day. At first I thought that the story got on to a social bookmarking site Digg, Stumbleupon ect... but after checking the logs I found that this story is getting the same amount of traffic that a normal story gets ~2k-3k. I checked if all the votes for this perpendicular story where coming from a the same IP address. I could see this happening if a user was at a school's computer lab using all their lab computers to vote up this story. Not one duplicate IP address in the log for this story. SELECT ip, COUNT(*) as count FROM wp_gdsr_votes_log WHERE id=3932 GROUP BY (ip ) ORDER BY count DESC Next I thought that a use might be using a proxy to vote up a story. I checked this by grouping all the browser user_agent together to see if there a single browser voting in a perpendicular way. At most 7 users where using a similar browser but voted sporadically (1-5), no evidence of wrong doing. SELECT user_agent, COUNT(*) as count FROM wp_gdsr_votes_log WHERE id=3932 GROUP BY ( user_agent) ORDER BY count DESC I check was to see if all the votes came in at a once. Maybe someone has a really interesting bot that can change the user_adgent and uses proxies, ect... At most 5 votes came with in 2 mins of each other. It doesn't seem to be any regularity on how people vote (IE a 5 vote does not come in once a min) SELECT * FROM wp_gdsr_votes_log WHERE id =3932 AND vote=5 ORDER BY wp_gdsr_votes_log.voted DESC The obvious solution to this problem is to force people to login before they are allowed to vote. But I would prefer to not have to go down that route unless it is absolutely necessary. I'm looking for suggestions on things to test for to detect the abuse.

    Read the article

  • Why does my Perl regular expression only find the last occurrence?

    - by scharan
    I have the following input to a Perl script and I wish to get the first occurrence of NAME="..." strings in each of the <table>...</table> structures. The entire file is read into a single string and the regex acts on that input. However, the regex always returns the last occurrence of NAME="..." strings. Can anyone explain what is going on and how this can be fixed? Input file: ADSDF <TABLE> NAME="ORDERSAA" line1 line2 NAME="ORDERSA" line3 NAME="ORDERSAB" </TABLE> <TABLE> line1 line2 NAME="ORDERSB" line3 </TABLE> <TABLE> line1 line2 NAME="ORDERSC" line3 </TABLE> <TABLE> line1 line2 NAME="ORDERSD" line3 line3 line3 </TABLE> <TABLE> line1 line2 NAME="QUOTES2" line3 NAME="QUOTES3" NAME="QUOTES4" line3 NAME="QUOTES5" line3 </TABLE> <TABLE> line1 line2 NAME="QUOTES6" NAME="QUOTES7" NAME="QUOTES8" NAME="QUOTES9" line3 line3 </TABLE> <TABLE> NAME="MyName IsKhan" </TABLE> Perl Code starts here: use warnings; use strict; my $nameRegExp = '(<table>((NAME="(.+)")|(.*|\n))*</table>)'; sub extractNames($$){ my ($ifh, $ofh) = @_; my $fullFile; read ($ifh, $fullFile, 1024);#Hardcoded to read just 1024 bytes. while( $fullFile =~ m#$nameRegExp#gi){ print "found: ".$4."\n"; } } sub main(){ if( ($#ARGV + 1 )!= 1){ die("Usage: extractNames infile\n"); } my $infileName = $ARGV[0]; my $outfileName = $ARGV[1]; open my $inFile, "<$infileName" or die("Could not open log file $infileName"); my $outFile; #open my $outFile, ">$outfileName" or die("Could not open log file $outfileName"); extractNames( $inFile, $outFile ); close( $inFile ); #close( $outFile ); } #call main();

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Scalable Database Tagging Schema

    - by Longpoke
    EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

    Read the article

  • User Defined Exceptions with JMX

    - by Daniel
    I have exposed methods for remote management in my application server using JMX by creating an MXBean interface, and a class to implement it. Included in this interface are operations for setting attributes on my server, and for getting the current value of attributes. For example, take the following methods: public interface WordManagerMXBean { public void addWord(String word); public WordsObject getWords(); public void removeWord(String word); } The WordsObject is a custom, serializable class used to retrieve data about the state of the server. Then I also have a WordManager class that implements the above interface. I then create a JMX agent to manage my resource: MBeanServer mbs = ManagementFactory.getPlatformMBeanServer(); ObjectName wordManagerName = new ObjectName("com.example:type=WordManager"); mbs.registerMBean(wordManager, wordManagerName); I have created a client that invokes these methods, and this works as expected. However, I would like to extend this current configuration by adding user defined exceptions that can be sent back to my client. So I would like to change my interface to something like this: public interface WordManagerMXBean { public void addWord(String word) throws WordAlreadyExistsException; public WordsObject getWords(); public void removeWord(String word); } My WordAlreadyExistsException looks like this: public class WordAlreadyExistsException extends Exception implements Serializable { private static final long serialVersionUID = -9095552123119275304L; public WordAlreadyExistsException() { super(); } } When I call the addWord() method in my client, I would like to get back a WordAlreadyExistsException if the word already exists. However, when I do this, I get an error like this: java.rmi.UnmarshalException: Error unmarshaling return; nested exception is: java.lang.ClassNotFoundException: com.example.WordAlreadyExistsException The WordAlreadyExistsException, the WordsObject and the WordManagerMXBean interface are all in a single jar file that is available to both the client and the server. If I call the getWords() method, the client has no difficulty handling the WordsObject. However, if a user defined exception, like the one above, is thrown, then the client gives the error shown above. Is it possible to configure JMX to handle this exception correctly in the client? Following some searching, I noticed that there is an MBeanException class that is used to wrap exceptions. I'm not sure if this wrapping is performed by the agent automatically, or if I'm supposed to do the wrapping myself. I tried both, but in either case I get the same error on the client. I have also tried this with both checked and unchecked exceptions, again the same error occurs. One solution to this is to simply pass back the error string inside a generic error, as all of the standard java exceptions work. But I'd prefer to get back the actual exception for processing by the client. Is it possible to handle user defined exceptions in JMX? If so, any ideas how?

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • How to handle environment-specific application configuration organization-wide?

    - by Stuart Lange
    Problem Your organization has many separate applications, some of which interact with each other (to form "systems"). You need to deploy these applications to separate environments to facilitate staged testing (for example, DEV, QA, UAT, PROD). A given application needs to be configured slightly differently in each environment (each environment has a separate database, for example). You want this re-configuration to be handled by some sort of automated mechanism so that your release managers don't have to manually configure each application every time it is deployed to a different environment. Desired Features I would like to design an organization-wide configuration solution with the following properties (ideally): Supports "one click" deployments (only the environment needs to be specified, and no manual re-configuration during/after deployment should be necessary). There should be a single "system of record" where a shared environment-dependent property is specified (such as a database connection string that is shared by many applications). Supports re-configuration of deployed applications (in the event that an environment-specific property needs to change), ideally without requiring a re-deployment of the application. Allows an application to be run on the same machine, but in different environments (run a PROD instance and a DEV instance simultaneously). Possible Solutions I see two basic directions in which a solution could go: Make all applications "environment aware". You would pass the environment name (DEV, QA, etc) at the command line to the app, and then the app is "smart" enough to figure out the environment-specific configuration values at run-time. The app could fetch the values from flat files deployed along with the app, or from a central configuration service. Applications are not "smart" as they are in #1, and simply fetch configuration by property name from config files deployed with the app. The values of these properties are injected into the config files at deploy-time by the install program/script. That install script takes the environment name and fetches all relevant configuration values from a central configuration service. Question How would/have you achieved a configuration solution that solves these problems and supports these desired features? Am I on target with the two possible solutions? Do you have a preference between those solutions? Also, please feel free to tell me that I'm thinking about the problem all wrong. Any feedback would be greatly appreciated.

    Read the article

  • A standard event messaging system with AJAX?

    - by Gutzofter
    Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

    Read the article

  • Why is FLD1 loading NaN instead?

    - by Bernd Jendrissek
    I have a one-liner C function that is just return value * pow(1.+rate, -delay); - it discounts a future value to a present value. The interesting part of the disassembly is 0x080555b9 : neg %eax 0x080555bb : push %eax 0x080555bc : fildl (%esp) 0x080555bf : lea 0x4(%esp),%esp 0x080555c3 : fldl 0xfffffff0(%ebp) 0x080555c6 : fld1 0x080555c8 : faddp %st,%st(1) 0x080555ca : fxch %st(1) 0x080555cc : fstpl 0x8(%esp) 0x080555d0 : fstpl (%esp) 0x080555d3 : call 0x8051ce0 0x080555d8 : fmull 0xfffffff8(%ebp) While single-stepping through this function, gdb says (rate is 0.02, delay is 2; you can see them on the stack): (gdb) si 0x080555c6 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 =R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 R2: Valid 0x4004ff147ae147ae1800 +63.77000000000000313 R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1861 IE PE SF TOP: 3 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0000 Instruction Pointer: 0x73:0x080555c3 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xdd45 And after the fld1: (gdb) si 0x080555c8 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 =R2: Special 0xffffc000000000000000 Real Indefinite (QNaN) R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1261 IE PE SF C1 TOP: 2 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0020 Instruction Pointer: 0x73:0x080555c6 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xd9e8 After this, everything goes to hell. Things get grossly over or undervalued, so even if there were no other bugs in my freeciv AI attempt, it would choose all the wrong strategies. Like sending the whole army to the arctic. (Sigh, if only I were getting that far.) I must be missing something obvious, or getting blinded by something, because I can't believe that fld1 should ever possibly fail. Even less that it should fail only after a handful of passes through this function. On earlier passes the FPU correctly loads 1 into ST(0). The bytes at 0x080555c6 definitely encode fld1 - checked with x/... on the running process. What gives?

    Read the article

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • Web SITE publishing, dynamic compilation, smoke & mirrors

    - by tbehunin
    When you publish a web SITE in Visual Studio, in the dialog box that follows, you are given an option to "Allow this precompiled site to be updatable". According to MSDN, checking this option "specifies that all program code is compiled into assemblies, but that .aspx files (including single-file ASP.NET Web pages) are copied as-is to the target folder". With this option checked, you can update existing .aspx files as well as add new ones without any issue. When a page, that has either been updated or newly created, is requested, the page gets dynamically compiled at run-time and is then processed and returned to the user. If, on the other hand, you didn't check that checkbox during the publish phase, the .aspx files get compiled, along with the code-behind and App_Code files in separate assemblies. The .aspx files are then completely overwritten with a line of text that says: This is a marker file generated by the precompilation tool, and should not be deleted! You obviously can't edit an existing page in this scenario. If you were to ADD a new .aspx file to this site, you would get a .Net run-time error saying that the file hasn't been precompiled. With that background, my questions are these: Something must be able to determine that this website was published to be updatable (allow dynamic compilation) or not. If it was published as updatable, it must also be able to determine whether a file was changed or added, so it can do a dynamic compile. Who makes those determinations? IIS? ASP.NET worker process? HOW does it make those determinations? If I had the same website published in both of those scenarios, could I make a visual determination that one is updatable and the other is not? Is there some bit I can look at in the assemblies using Reflector to make that determination myself? In addition to answering those questions, what also might be helpful would be information on the process flow from when a resource is requested to when it starts being processed, not necessarily the ASP.NET Page Lifecycle, but what happens BEFORE ASP.Net worker process starts processing the page and firing off events. The dynamic compilation appears to be smoke and mirrors. Can someone demystify this for me?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • Delphi Unit local variables - how to make each instance unique?

    - by Justin
    Ok, this, I'm sure is something simple that is easy to do. The problem : I've inherited scary spaghetti code and am slowly trying to better it when new features need adding - generally when a refactor makes adding the new feature neater. I've got a bunch of code I'm packing into a single unit which, in different places in the application, controls the same physical thing in the outside world. The control appears in several places in the application and operates slightly differently in each instance. What I've done is to create a unit with all of the features I need which I can simply drop, as a frame, into each form that requires it. Each form then uses the unit's interface methods to customise the behaviour for each instance. The problem within the problem : In the unit in question (the frame) I have a variable declared in the IMPLEMENTATION section - local to the unit. I also have a procedure, declared in the TYPE section which takes an argument and assigns that argument to the local variable in question - each form passes a unique variable to each instance of the frame/unit. What I want it to do is for each instance of the frame to keep its own version of that variable, different from the others, and use that to define how it operates. What seems to be happening, however, is that all instances are using the same value, even if I explicitly pass each instance a different variable. ie: Unit FlexibleUnit; interface uses //the uses stuff type TFlexibleUnit=class(TFrame) //declarations including procedure makeThisInstanceX(passMeTheVar:integer); private // public // end; implementation uses //the uses var myLocalVar; procedure makeThisInstanceX(passMeTheVar:integer); begin myLocalVar:=passMeTheVar; end; //other procedures using myLocalVar //etc to the end; Now somewhere in another Form I've dropped this Frame onto the Design pane, sometimes two of these frames on one Form, and have it declared in the proper places, etc. Each is unique in that : ThisFlexibleUnit : TFlexibleUnit; ThatFlexibleUnit : TFlexibleUnit; and when I do a: ThisFlexibleUnit.makeThisInstanceX(var1); //want to behave in way "var1" ThatFlexibleUnit.makeThisInstanceX(var2); //want to behave in way "var2" it seems that they both share the same variable "myLocalVar". Am I doing this wrong, in principle? If this is the correct method then it's a matter of debugging what I have (which is too huge to post) but if this is not correct in principle then is there a way to do what I am suggesting? Thanks in advance, Stack Overflow - you guys (and gals!) are legendary.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • What database table structure should I use for versions, codebases, deployables?

    - by Zac Thompson
    I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

    Read the article

  • To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

    - by Globalkeith
    Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

    Read the article

< Previous Page | 624 625 626 627 628 629 630 631 632 633 634 635  | Next Page >