Search Results

Search found 16914 results on 677 pages for 'single threaded'.

Page 629/677 | < Previous Page | 625 626 627 628 629 630 631 632 633 634 635 636  | Next Page >

• android app crashes if keyboard was shown

  - by Jaume

  I have an activity that I force keyboard to appears using, InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.SHOW_FORCED, 0); keyboard appears properly and also obscured when needed. Problem is when I finish the activity, app crashes. If the activity never shows keyboard or shows it without start editing text, it is finished with no errors but if you just write one single character or more, app will crash. How to solve it? thank you. method used to finish activity, boto_back.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.HIDE_IMPLICIT_ONLY, 0); finish(); } }); @Override public void onDestroy() { if (adMob != null) { // Destroy the AdView. adMob.destroy(); } super.onDestroy(); } logcat, 07-07 19:04:25.191: E/AndroidRuntime(8443): FATAL EXCEPTION: main 07-07 19:04:25.191: E/AndroidRuntime(8443): java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.TabBar_iOSActivity}: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.handleDestroyActivity(ActivityThread.java:2711) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.access$2100(ActivityThread.java:121) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:976) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Handler.dispatchMessage(Handler.java:99) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Looper.loop(Looper.java:130) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.main(ActivityThread.java:3701) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invokeNative(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invoke(Method.java:507) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:866) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:624) 07-07 19:04:25.191: E/AndroidRuntime(8443): at dalvik.system.NativeStart.main(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): Caused by: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2603) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.LocalActivityManager.dispatchDestroy(LocalActivityManager.java:622) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityGroup.onDestroy(ActivityGroup.java:85) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.xxxx.projecte1.TabBar_iOSActivity.onDestroy(TabBar_iOSActivity.java:417) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2680) 07-07 19:04:25.191: E/AndroidRuntime(8443): ... 11 more

  Read the article

• Solving a cyclical dependency in Ninject (Compact Framework)

  - by Alex

  I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

  Read the article

• Sessions not persisting between requests

  - by klonq

  My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

  Read the article

• What database table structure should I use for versions, codebases, deployables?

  - by Zac Thompson

  I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

  Read the article

• What to Expect in Rails 4

  - by mikhailov

  Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

  Read the article

• small scale web site - global javascript file style/format/pattern - improving maintainability

  - by yaya3

  I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

  Read the article

• Is it Bad Practice to use C++ only for the STL containers?

  - by gmatt

  First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

  Read the article

• To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

  - by Globalkeith

  Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• JavaScript code inside UpdatePanel

  - by Ed Woodcock

  Ok: I've got an UpdatePanel on an aspx page that contains a single Placeholder. Inside this placeholder I'm appending one of a selection of usercontrols depending on certain external conditions (this is a configuration page). In each of these usercontrols there is a bindUcEvents() javascript function that binds the various jQuery and javascript events to buttons and validators inside the usercontrol. The issue I'm having is that the usercontrol's javascript is not being recognised. Normally, javascript inside an updatepanel is executed when the updatepanel posts back, however none of this code can be found by the page (I've tried running the function manually via firebug's console, but it tells me it cannot find the function). Does anyone have any suggestions? Cheers, Ed. EDIT: cut down (but functional) example: Markup: <script src="/js/jquery-1.3.2.min.js"></script> <form id="form1" runat="server"> <div> <asp:ScriptManager ID="Script" runat="server" /> <asp:Button ID="Postback" runat="server" Text="Populate" OnClick="PopulatePlaceholder" /> <asp:UpdatePanel ID="UpdateMe" runat="server"> <Triggers> <asp:AsyncPostBackTrigger ControlID="Postback" EventName="Click" /> </Triggers> <ContentTemplate> <asp:Literal ID="Code" runat="server" /> <asp:PlaceHolder ID="PlaceMe" runat="server" /> </ContentTemplate> </asp:UpdatePanel> </div> </form> C#: protected void PopulatePlaceholder(object sender, EventArgs e) { Button button = new Button(); button.ID = "Push"; button.Text = "push"; button.OnClientClick = "javascript:return false;"; Code.Text = "<script type=\"text/javascript\"> function bindEvents() { $('#" + button.ClientID + "').click(function() { alert('hello'); }); } bindEvents(); </script>"; PlaceMe.Controls.Add(button); } You'll see that the button does not poput the alert message, even though the code is present on the page.

  Read the article

• I'm searching for a messaging platform (like XMPP) that allows tight integration with a web applicat

  - by loxs

  Hi, At the company I work for, we are building a cluster of web applications for collaboration. Things like accounting, billing, CRM etc. We are using a RESTfull technique: For database we use CouchDB Different applications communicate with one another and with the database via http. Besides, we have a single sign on solution, so that when you login in one application, you are automatically logged to the other. For all apps we use Python (Pylons). Now we need to add instant messaging to the stack. We need to support both web and desktop clients. But just being able to chat is not enough. We need to be able to achieve all of the following (and more similar things). When somebody gets assigned to a task, they must receive a message. I guess this is possible with some system daemon. There must be an option to automatically group people in groups by lots of different properties. For example, there must be groups divided both by geographical location, by company division, by job type (all the programers from different cities and different company divisions must form a group), so that one can send mass messages to a group of choice. Rooms should be automatically created and destroyed. For example when several people visit the same invoice, a room for them must be automatically created (and they must auto-join). And when all leave the invoice, the room must be destroyed. Authentication and authorization from our applications. I can implement this using custom solutions like hookbox http://hookbox.org/docs/intro.html but then I'll have lots of problems in supporting desktop clients. I have no former experience with instant messaging. I've been reading about this lately. I've been looking mostly at things like ejabberd. But it has been a hard time and I can't find whether what I want is possible at all. So I'd be happy if people with experience in this field could help me with some advice, articles, tales of what is possible etc.

  Read the article

• how to bind the image dynamically for datagrid in.cs

  - by prince23

  hi, this is my xaml code. <sdk:DataGrid x:Name="dgMarks" CanUserResizeColumns="False" SelectionMode="Single" AutoGenerateColumns="False" VerticalAlignment="Top" IsReadOnly="True" Margin="13,44,0,0" RowDetailsVisibilityChanged="dgMarks_RowDetailsVisibilityChanged" RowDetailsVisibilityMode="Collapsed" Height="391" HorizontalAlignment="Left" Width="965" SelectionChanged="dgMarks_SelectionChanged" VerticalScrollBarVisibility="Visible" > <sdk:DataGrid.Columns> <sdk:DataGridTemplateColumn> <sdk:DataGridTemplateColumn.CellTemplate> <DataTemplate> <Button x:Name="myButton" Click="ExpandMarks_Click"> <TextBlock Text="{Binding Level}" TextWrapping="NoWrap" ></TextBlock> <Image x:Name="imgMarks" Stretch="None"/> </Button> </DataTemplate> </sdk:DataGridTemplateColumn.CellTemplate> </sdk:DataGridTemplateColumn> <sdk:DataGridTemplateColumn Header="Name" Visibility="Collapsed"> <sdk:DataGridTemplateColumn.CellTemplate> <DataTemplate > <sdk:Label Content="{Binding Name}"/> </DataTemplate> </sdk:DataGridTemplateColumn.CellTemplate> </sdk:DataGridTemplateColumn> <sdk:DataGridTemplateColumn Header="Marks" Width="80"> <sdk:DataGridTemplateColumn.CellTemplate> <DataTemplate> <sdk:Label Content="{Binding Marks}"/> </DataTemplate> </sdk:DataGridTemplateColumn.CellTemplate> </sdk:DataGridTemplateColumn> </sdk:DataGrid.Columns> </sdk:DataGrid> from database i am getting these values name marks Level abc 23 0 xyz 67 1 yu 56 0 aa 89 1 here i am binding these values for datagrid. i have an tricky thing to be done .based on the level i should be binding image if level value is 1 then bind the image. if level value is 0 then do not bind the image for that row i know this is how we need to handle but where should i write this code in which events? Image imgLevel = (Image)templateTrendScore.FindName("imgMarks"); if (level1==1) { imgLevel .Source = new BitmapImage(new Uri("/Images/image1.JPG", UriKind.Relative)); } any help would be great thanks in advance

  Read the article

• How do I remove elements from a jQuery wrapped set

  - by Bungle

  I'm a little confused about which jQuery method and/or selectors to use when trying to select an element, and then remove certain descendant elements from the wrapped set. For example, given the following HTML: <div id="article"> <div id="inset"> <ul> <li>This is bullet point #1.</li> <li>This is bullet point #2.</li> <li>This is bullet point #3.</li> </ul> </div> <p>This is the first paragraph of the article</p> <p>This is the second paragraph of the article</p> <p>This is the third paragraph of the article</p> </div> I want to select the article: var $article = $('#article'); but then remove <div id="inset"></div> and its descendants from the wrapped set. I tried the following: var $article = $('#article').not('#inset'); but that didn't work, and in retrospect, I think I can see why. I also tried using remove() unsuccessfully. What would be the correct way to do this? Ultimately, I need to set this up in such a way that I can define a configuration array, such as: var selectors = [ { select: '#article', exclude: ['#inset'] } ]; where select defines a single element that contains text content, and exclude is an optional array that defines one or more selectors to disregard text content from. Given the final wrapped set with the excluded elements removed, I would like to be able to call jQuery's text() method to end up with the following text: This is the first paragraph of the article.This is the second paragraph of the article.This is the third paragraph of the article. The configuration array doesn't need to work exactly like that, but it should provide roughly equivalent configuration potential. Thanks for any help you can provide!

  Read the article

• CodeIgniter Third party class not loading

  - by Jatin Soni

  I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

  Read the article

• What common routines do you put in your Program.cs for C#

  - by Rick

  I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

  Read the article

• using a Singleton to pass credentials in a multi-tenant application a code smell?

  - by Hans Gruber

  Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

  Read the article

• Refactoring Singleton Overuse

  - by drharris

  Today I had an epiphany, and it was that I was doing everything wrong. Some history: I inherited a C# application, which was really just a collection of static methods, a completely procedural mess of C# code. I refactored this the best I knew at the time, bringing in lots of post-college OOP knowledge. To make a long story short, many of the entities in code have turned out to be Singletons. Today I realized I needed 3 new classes, which would each follow the same Singleton pattern to match the rest of the software. If I keep tumbling down this slippery slope, eventually every class in my application will be Singleton, which will really be no logically different from the original group of static methods. I need help on rethinking this. I know about Dependency Injection, and that would generally be the strategy to use in breaking the Singleton curse. However, I have a few specific questions related to this refactoring, and all about best practices for doing so. How acceptable is the use of static variables to encapsulate configuration information? I have a brain block on using static, and I think it is due to an early OO class in college where the professor said static was bad. But, should I have to reconfigure the class every time I access it? When accessing hardware, is it ok to leave a static pointer to the addresses and variables needed, or should I continually perform Open() and Close() operations? Right now I have a single method acting as the controller. Specifically, I continually poll several external instruments (via hardware drivers) for data. Should this type of controller be the way to go, or should I spawn separate threads for each instrument at the program's startup? If the latter, how do I make this object oriented? Should I create classes called InstrumentAListener and InstrumentBListener? Or is there some standard way to approach this? Is there a better way to do global configuration? Right now I simply have Configuration.Instance.Foo sprinkled liberally throughout the code. Almost every class uses it, so perhaps keeping it as a Singleton makes sense. Any thoughts? A lot of my classes are things like SerialPortWriter or DataFileWriter, which must sit around waiting for this data to stream in. Since they are active the entire time, how should I arrange these in order to listen for the events generated when data comes in? Any other resources, books, or comments about how to get away from Singletons and other pattern overuse would be helpful.

  Read the article

• Java replacement for C macros

  - by thkala

  Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

  Read the article

• objective C convert NSString to unsigned

  - by user1501354

  I have changed my question. I want to convert an NSString to an unsigned int. Why? Because I want to do parallel payment in PayPal. Below I have given my coding in which I want to convert the NSString to an unsigned int. My query is: //optional, set shippingEnabled to TRUE if you want to display shipping //options to the user, default: TRUE [PayPal getPayPalInst].shippingEnabled = TRUE; //optional, set dynamicAmountUpdateEnabled to TRUE if you want to compute //shipping and tax based on the user's address choice, default: FALSE [PayPal getPayPalInst].dynamicAmountUpdateEnabled = TRUE; //optional, choose who pays the fee, default: FEEPAYER_EACHRECEIVER [PayPal getPayPalInst].feePayer = FEEPAYER_EACHRECEIVER; //for a payment with multiple recipients, use a PayPalAdvancedPayment object PayPalAdvancedPayment *payment = [[PayPalAdvancedPayment alloc] init]; payment.paymentCurrency = @"USD"; // A payment note applied to all recipients. payment.memo = @"A Note applied to all recipients"; //receiverPaymentDetails is a list of PPReceiverPaymentDetails objects payment.receiverPaymentDetails = [NSMutableArray array]; NSArray *emailArray = [NSArray arrayWithObjects:@"[email protected]",@"[email protected]", nil]; for (int i = 1; i <= 2; i++) { PayPalReceiverPaymentDetails *details = [[PayPalReceiverPaymentDetails alloc] init]; // Customize the payment notes for one of the three recipient. if (i == 2) { details.description = [NSString stringWithFormat:@"Component %d", i]; } details.recipient = [NSString stringWithFormat:@"%@",[emailArray objectAtIndex:i-1]]; unsigned order; if (i==1) { order = [[feeArray objectAtIndex:0] unsignedIntValue]; } if (i==2) { order = [[amountArray objectAtIndex:0] unsignedIntValue]; } //subtotal of all items for this recipient, without tax and shipping details.subTotal = [NSDecimalNumber decimalNumberWithMantissa:order exponent:-4 isNegative:FALSE]; //invoiceData is a PayPalInvoiceData object which contains tax, shipping, and a list of PayPalInvoiceItem objects details.invoiceData = [[PayPalInvoiceData alloc] init]; //invoiceItems is a list of PayPalInvoiceItem objects //NOTE: sum of totalPrice for all items must equal details.subTotal //NOTE: example only shows a single item, but you can have more than one details.invoiceData.invoiceItems = [NSMutableArray array]; PayPalInvoiceItem *item = [[PayPalInvoiceItem alloc] init]; item.totalPrice = details.subTotal; [details.invoiceData.invoiceItems addObject:item]; [payment.receiverPaymentDetails addObject:details]; } [[PayPal getPayPalInst] advancedCheckoutWithPayment:payment]; Can anybody tell me how to do this conversion? Thanks and regards in advance.

  Read the article

• NHibernate and objects with value-semantics

  - by Groo

  Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

  Read the article

• mod_rewrite not working for a specific directory

  - by punkish

  This has got me completely foxed for a couple of days now, and I am convinced that I will look stupid once I solve it, but will be even stupider if I don't ask for help now. I have mod_rewrite working successfully on my localhost (no vhosts involved; this is my laptop, my development machine), and I use .htaccess in various directories to help rewrite crufty URLs to clean ones. EXCEPT... it doesn't work in one directory. Since it is impossible to reproduce my entire laptop in this question, I provide the following details. In my httpd.conf, I have mod_rewrite.so loaded. LoadModule rewrite_module modules/mod_rewrite.so In my httpd.conf, I have included another conf file like so Include /usr/local/apache2/conf/other/punkish.conf In my punkish.conf, I have directories defined like so DocumentRoot "/Users/punkish/Sites" <Directory "/Users/punkish/Sites"> Options ExecCGI AllowOverride None Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/one"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <Directory "/Users/punkish/Sites/two"> Options FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> In ~/Sites/one I have the following .htaccess file RewriteEngine On RewriteBase /one/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, everything works just fine. However, in my directory ~/Sites/two I have the following .htaccess file RewriteEngine On RewriteBase /two/ # If an actual file or directory is requested, serve directly RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d # Otherwise, pass everything through to the dispatcher RewriteRule ^(.*)$ index.cgi/$1 [L,QSA] and, nothing works. Nada. Zip. Zilch. I just get a 404. I have determined that mod_rewrite is not even looking at my ~/Sites/two/.htaccess by putting spurious commands in it and not getting any error other than 404. Another confounding issue -- I have turned on RewriteLog in my httpd.conf with RewriteLogLevel 3, but my rewrite_log is completely empty. I know this is hard to trouble shoot unless sitting physically at the computer in question, but I hope someone can give me some indication as to what is going on. **Update: ** There are no aliases involved anywhere. This is my laptop, and everything is under the above stated Document Root, so I just access each directory as http://localhost/. Yes, typos are a big possibility (I did say that I will look stupid once I solve it, however, for now, I have not discovered a single typo anywhere, and yes, I have restarted Apache about a dozen times now. I even thought that perhaps I had two different Apaches running, but no, I have only one, the one under /usr/local/apache2, and I installed it myself a while back.

  Read the article

• Multiple word Auttosuggest using Lucene.Net

  - by eric

  I am currently working on an search application which uses Lucene.Net to index the data from the database to Index file. I have a product catalog which has Name, short and long description, sku and other fields. The data is stored in Index using StandardAnalyzer. I am trying to add auto suggestion for a text field and using TermEnum to get all the keyword terms and its score from the Index. But the terms returned are of single term. For example, if I type for co, the suggestion returned are costume, count, collection, cowboy, combination etc. But I want the suggestion to return phrases. For exmaple, if I search for co, the suggestions should be cowboy costume, costume for adults, combination locks etc. The following is the code used to get the suggestions: public string[] GetKeywords(string strSearchExp) { IndexReader rd = IndexReader.Open(mIndexLoc); TermEnum tenum = rd.Terms(new Term("Name", strSearchExp)); string[] strResult = new string[10]; int i = 0; Dictionary<string, double> KeywordList = new Dictionary<string, double>(); do { //terms = tenum.Term(); if (tenum.Term() != null) { //strResult[i] = terms.text.ToString(); KeywordList.Add(tenum.Term().text.ToString(), tenum.DocFreq()); } } while (tenum.Next() && tenum.Term().text.StartsWith(strSearchExp) && tenum.Term().text.Length > 1); var sortedDict = (from entry in KeywordList orderby entry.Value descending select entry); foreach (KeyValuePair<string, double> data in sortedDict) { if (data.Key.Length > 1) { strResult[i] = data.Key; i++; } if (i >= 10) //Exit the for Loop if the count exceeds 10 break; } tenum.Close(); rd.Close(); return strResult; } Can anyone please give me directions to achive this? Thanks for looking into this.

  Read the article

• A standard event messaging system with AJAX?

  - by Gutzofter

  Is there any standards or messaging framework for AJAX? Right now I have a single page that loads content using Ajax. Because I had a complex form for data entry as part of my content, I need to validate certain events that can occur in my form. So after some adjustments driven by my tests: asyncShould("search customer list click", 3, function() { stop(1000); $('#content').show(); var forCustomerList = newCustomerListRequest(); var forShipAndCharge = newShipAndChargeRequest(forCustomerList); forCustomerList.page = '../../vt/' + forCustomerList.page; forShipAndCharge.page = 'helpers/helper.php'; forShipAndCharge.data = { 'action': 'shipAndCharge', 'DB': '11001' }; var originalComplete = forShipAndCharge.complete; forShipAndCharge.complete = function(xhr, status) { originalComplete(xhr, status); ok($('#customer_edit').is(":visible"), 'Shows customer editor'); $('#search').click(); ok($('#customer_list').is(":visible"), 'Shows customer list'); ok($('#customer_edit').is(":hidden"), 'Does not show customer editor'); start(); }; testController.getContent(forShipAndCharge); }); Here is the controller for getting content: getContent: function (request) { $.ajax({ type: 'GET', url: request.page, dataType: 'json', data: request.data, async: request.async, success: request.success, complete: request.complete }); }, And here is the request event: function newShipAndChargeRequest(serverRequest) { var that = { serverRequest: serverRequest, page: 'nodes/orders/sc.php', data: 'customer_id=-1', complete: errorHandler, success: function(msg) { shipAndChargeHandler(msg); initWhenCustomer(that.serverRequest); }, async: true }; return that; } And here is a success handler: function shipAndChargeHandler(msg) { $('.contentContainer').html(msg.html); if (msg.status == 'flash') { flash(msg.flash); } } And on my server side I end up with a JSON structure that looks like this: $message['status'] = 'success'; $message['data'] = array(); $message['flash'] = ''; $message['html'] = ''; echo json_encode($message); So now loading content consists of two parts: HTML, this is the presentation of the form. DATA, this is any data that needs be loaded for the form FLASH, any validation or server errors STATUS tells client what happened on server. My question is: Is this a valid way to handle event messaging on the client-side or am I going down a path of heartache and pain?

  Read the article

• jQuery reports incorrect element height in Firefox iframe

  - by Augustus

  Here a short test to demonstrate my problem. I have a page that loads an iframe: <html> <head> <title></title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.js"></script> </head> <body> <iframe id="iframe" src="box.html" style="width: 100px; height: 100px"></iframe> <script> $('#iframe').bind('load', function () { var div = $(this).contents().find('div'); alert(div.height()); alert(div.innerHeight()); alert(div.outerHeight()); alert(div.outerHeight(true)); }); </script> </body> </html> The iframe (box.html) contains a single styled div: <html> <head> <title></title> <style> div { height: 50px; width: 50px; margin: 5px; padding: 5px; border: 2px solid #00f; background-color: #f00; } </style> </head> <body> <div></div> </body> </html> The four alerts should return 50, 60, 64 and 74, respectively. This works as expected in Safari and Chrome. In FF 3.5.1, they all return 64. This is wrong. Does anyone know how I can force FF/jQuery to return the correct values?

  Read the article

• I need help converting a C# string from one character encoding to another?

  - by Handleman

  According to Spolsky I can't call myself a developer, so there is a lot of shame behind this question... Scenario: From a C# application, I would like to take a string value from a SQL db and use it as the name of a directory. I have a secure (SSL) FTP server on which I want to set the current directory using the string value from the DB. Problem: Everything is working fine until I hit a string value with a "special" character - I seem unable to encode the directory name correctly to satisfy the FTP server. The code example below uses "special" character é as an example uses WinSCP as an external application for the ftps comms does not show all the code required to setup the Process "_winscp". sends commands to the WinSCP exe by writing to the process standardinput for simplicity, does not get the info from the DB, but instead simply declares a string (but I did do a .Equals to confirm that the value from the DB is the same as the declared string) makes three attempts to set the current directory on the FTP server using different string encodings - all of which fail makes an attempt to set the directory using a string that was created from a hand-crafted byte array - which works Process _winscp = new Process(); byte[] buffer; string nameFromString = "Sinéad O'Connor"; _winscp.StandardInput.WriteLine("cd \"" + nameFromString + "\""); buffer = Encoding.UTF8.GetBytes(nameFromString); _winscp.StandardInput.WriteLine("cd \"" + Encoding.UTF8.GetString(buffer) + "\""); buffer = Encoding.ASCII.GetBytes(nameFromString); _winscp.StandardInput.WriteLine("cd \"" + Encoding.ASCII.GetString(buffer) + "\""); byte[] nameFromBytes = new byte[] { 83, 105, 110, 130, 97, 100, 32, 79, 39, 67, 111, 110, 110, 111, 114 }; _winscp.StandardInput.WriteLine("cd \"" + Encoding.Default.GetString(nameFromBytes) + "\""); The UTF8 encoding changes é to 101 (decimal) but the FTP server doesn't like it. The ASCII encoding changes é to 63 (decimal) but the FTP server doesn't like it. When I represent é as value 130 (decimal) the FTP server is happy, except I can't find a method that will do this for me (I had to manually contruct the string from explicit bytes). Anyone know what I should do to my string to encode the é as 130 and make the FTP server happy and finally elevate me to level 1 developer by explaining the only single thing a developer should understand?

  Read the article

< Previous Page | 625 626 627 628 629 630 631 632 633 634 635 636  | Next Page >