Search Results

Search found 29753 results on 1191 pages for 'best practices'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 644/1191 | < Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >

  • Open Source Text Editor

    - by user355451
    Which is the best open source text editor and why? I have used the YUI editor before, but I am looking for something more extensible and manageable and that will ultimately prove more stable.

    Read the article

  • showcase website in album

    - by proyb2
    What is the best gallery to showcase web design you have came across? Plan to get various creative agencies to showcase their works on an advertisement platform so that new user will be able to see various portfolio. When it come to select a suitable album, I am indecisive if it too plain (Load and display) or too flashy (coverflow album), which album/gallery script do you recommend for our corporate theme? I would prefer background to be white.

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • Is Paypal In-App model for Android legal on Android Market?

    - by sunil
    Hi, As you all might be knowing that Paypal has launched an in-App purchase model for Anroid. I will like to know whether this is legally allowed in Android market or not. I know this may not be the best place to ask this but being developers if anyone has developed an application which uses Paypal In-App and is on Android Market then it would be a great help. Regards Sunil

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Dictionary with single item

    - by alhazen
    In the case where Dictionary<object, object> myDictionary happens to contain a single item, what is the best way to retrieve the value object (if I don't care about the key) ? if (myDictionary.Count == 1) { // Doesn't work object obj = myDictionary.Values[0]; } Thanks

    Read the article

  • Rearrange items in ListBox

    - by superexsl
    Hey, I have a ListBox with a number of ListBoxItem objects. What is the best way to allow users to rearrange the items by dragging and dropping? Do I have to use StackPanels instead? Thanks for any suggestions

    Read the article

  • Visualization in "VisIt"

    - by Naveen
    Hi, Did any one over here work in "VisIt" visualization software? I have a dataset where the x, y, z coordinates are stored in separate bin files, i don't know how to visualize these files in VisIt, which would be the best file format to use. Till now, we were using Advanced Visual System (AVS) .fld files to read the data in AVS, now we have to switch to VisIt, don't know how to do it. Would appreciate if anyone can give some pointers in this direction.

    Read the article

  • Distinguish between single and double click events in Qt

    - by Jesse
    I have a QAbstractItemView that needs to react to single and double click events. The actions are different depending on whether it was single clicked or double clicked. The problem that is occurring is that the single click event is received prior to the double click event. Is there a recommended way/best practice for distinguishing between the two? I don't want to perform the single click action when the user has actually double clicked. I am using Qt 4.6

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Inter process communication C# <--> C++ for game debugging engine.

    - by Andy
    I am working on a debugger project for a game's scripting engine. I'm hoping to write the debugger's GUI in C#. The actual debugging engine, however, is embedded in the game itself and is written in a mixture of C, C++, and assembly patches. What's the best way to handle communication between the debugger GUI and the debugging engine? The two will be running in separate processes. Thanks! Andy

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • Complex Calculations

    - by mson
    What are the best tools (most efficient) available in .NET (C#) for calculating: integrals partial derivatives other non-trivial math Can people please comment on Mathematica and Matlab and their integration into C#?

    Read the article

  • Redis - which PHP module to use?

    - by Patrick
    If i check redis php supported language (http://code.google.com/p/redis/wiki/SupportedLanguages), there's 4 PHP ones: Redis PHP Bindings,phpredis,Predis,Redisent. Question is, which is the best and good to use? Thanks!

    Read the article

  • Is there a good J2ME IDE?

    - by William
    Is there a good J2ME IDE? I mean something lightweight, and portable. Something that can run what you program on it. My favorite Java IDE is JCreator Lite. Is there something like that for J2ME? Also, which would you say is the best J2ME IDE?

    Read the article

  • Archiving sharepoint site instade of deleting

    - by Sachin
    Hi All, I have a sharepoint site. This site large nubmer of site and sub site sollection in it. There are few that are created and are not in use. Now my questuion is how can I findout these old sites and before going deleting I have to first archive it. Can any one tell me what is the best possible approach to do it?

    Read the article

  • Does anyone know of a spell check library that underlines text?

    - by Icono123
    Does anyone know of a C# spell check library that would underline misspelled works in a windows form text box? In the past, I've used NetSpell and works great if users use the dialog box. I'm thinking I might be able to automatically call the spell check while text is being updated and underline the text. Anyone have any good ideas on what would be the best way to go about doing it?

    Read the article

  • How do I use a string as a keyword argument?

    - by Issac Kelly
    Specifically, I'm trying to use a string to arbitrairly filter the ORM. I've tried exec and eval solutions, but I'm running into walls. The code below doesn't work, but it's the best way I know how to explain where I'm trying to go from gblocks.models import Image f = 'image__endswith="jpg"' # Would be scripted in another area, but passed as text <user input> d = Image.objects.filter(f) #for the non-django pythonistas: d = Image.objects.filter(image__endswith="jpg") # would be the non-dynamic equivalent.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >