Search Results

Search found 29753 results on 1191 pages for 'best practices'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 644/1191 | < Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >

  • Custom search engine in asp.net mvc and entity framework

    - by Rahat
    Hi, does anyone have any idea how I can get started building a search engine for my asp.net mvc site using entity framework. I plan to build something like: http://www.carsguide.com.au/search/?N=4294962119++492&type=cars there on the left there is a refine search option panel. What's the best approach to design a model for the UI and optimized query with entity framework.

    Read the article

  • Play audio file on hover

    - by powtac
    What is the best solution to play an audio file on mouse over via JavaScript? And stop it when the mouse leaves the link. jQuery is available. <a href="/test.mp3" class="play">play</a>

    Read the article

  • Does anyone know of a spell check library that underlines text?

    - by Icono123
    Does anyone know of a C# spell check library that would underline misspelled works in a windows form text box? In the past, I've used NetSpell and works great if users use the dialog box. I'm thinking I might be able to automatically call the spell check while text is being updated and underline the text. Anyone have any good ideas on what would be the best way to go about doing it?

    Read the article

  • PHP ingore case sensitivity when comparing array values

    - by dan.codes
    I have to modify some code in a application I am working on that is using the array_diff($array1,$array2) method. The problem I am having is it is case sensitive and I need to have it return the correct value if the array values match even if the case is different. I don't want to change the case to lowercase because I need the value returned to keep its case. I'm a little confused as the best method to do this.

    Read the article

  • Black hole generator [closed]

    - by Timmy O' Tool
    I have a requirement for developing a black hole generator. They say that this may allow time travel and getting rich... whatever...what do you think it's the best approach for black hole generator a) Infinite loop while (1==1) blackHole++; b) Division by 0 try { 6/0 } catch { //blackHoleGenerated }

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Using Python to add/remove Ubuntu login script items

    - by codebox_rob
    I have written a Python application and would like to give my users the option of having the app automatically launch itself when the user logs in. It is important that the user is able to toggle this option on/off from within the app itself, rather than having to manually edit login scripts, so this needs to be done from within the Python code rather than from a shell script. The app is deployed on Ubuntu Linux, any suggestions for the best way of doing this?

    Read the article

  • Redirect page without losing SEO

    - by Ramesh Soni
    I want to change address of my online page but want to make sure that I won't lose any SEO thing. e.g. want to move a page from http://example.com/1.aspx to http://example2.com/a.aspx Is it possible to do this? If yes, then how? If no, what best could be done here if I have to move page and there is no way to stop this.

    Read the article

  • Is Borland C++ v3 for DOS available anywhere now?

    - by Galwegian
    Hi, I'm looking for a copy of either Borland C++ v3 or Turbo C++ which can run on DOS, but my searches are turning up a blank. I vaguely remember a free Turbo version available, but can't track it down. Are there free/pay versions of these still available? Is http://www.embarcadero.com my best hope? Thanks for any info...

    Read the article

  • How to secure the communication between an MSSQL database and a c# administrative tool?

    - by citronas
    How can I secure the communication between a C# programm running locally on my computer and a MSSQL Server in a hosted environment? I have an asp.net application that is secured by SSL encryption. So using the asp.net from an open wlan connection is no problem. How can I achieve the same kind of encryption for my administrative tool? Would it be best to write a service? But how would that connection to the service be secured?

    Read the article

  • C# Reading the registry and Wow6432Node key

    - by Jade M
    Hi all, I have come code that reads the registry and looks for a value in HKEY_LOCAL_MACHINE\Software\App\ but when running on 64bit versions of Windows the value is under HKEY_LOCAL_MACHINE\Software\Wow6432Node\App. How should I best approach this? Do I need a 64bit installer or should I rewrite my code to detect both places? Thanks

    Read the article

  • Model callback failure in CakePHP

    - by Benedikt R.
    Hi! Can someone confirm a save process misbehaviour in the AppModel for the method beforeSave( )? This method doesn't seem to be executed before saving a data set. I can remember of reading something about a bug in a current version (btw, I am using 1.3.1). Best regards, Beendikt

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Complex Calculations

    - by mson
    What are the best tools (most efficient) available in .NET (C#) for calculating: integrals partial derivatives other non-trivial math Can people please comment on Mathematica and Matlab and their integration into C#?

    Read the article

  • Recent OpenSLL book

    - by Martin
    Does anyone know of a more recent OpenSLL book then Network Security with OpenSSL: Cryptography for Secure Communications (http://www.opensslbook.com/). It is from 2002 and does not cover OpenSSL version 0.97+. Best would be a book for OpenSSL 1.0.0 but I guess that one is to recent.

    Read the article

  • Is there a good J2ME IDE?

    - by William
    Is there a good J2ME IDE? I mean something lightweight, and portable. Something that can run what you program on it. My favorite Java IDE is JCreator Lite. Is there something like that for J2ME? Also, which would you say is the best J2ME IDE?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >