Search Results

Search found 29753 results on 1191 pages for 'best practices'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 644/1191 | < Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >

  • Redis - which PHP module to use?

    - by Patrick
    If i check redis php supported language (http://code.google.com/p/redis/wiki/SupportedLanguages), there's 4 PHP ones: Redis PHP Bindings,phpredis,Predis,Redisent. Question is, which is the best and good to use? Thanks!

    Read the article

  • .htaccess, two consecutive rewrites?

    - by Matthew Haworth
    I need to take a url, "/ServiceSearch/r.php?n=blahblah", and have it go to "/search/blahblah/" so that it appears in the browser as "/search/blahblah", but I actually want it to REALLY be going to "r.php?n=ServiceSearch&n=blahblah".. So I was thinking I'll need to rewrite the first URL to "/ServiceSearch/r.php?n=blahblah" and then the second url, "/search/blahblah/", to the third, "r.php?n=ServiceSearch&n=blahblah". Well, I know this is wrong, but it's my best guess. I'm really struggling with it.

    Read the article

  • how could I store data within a GUID

    - by Mark
    I have an application that I want to represent a users session (just small pieces of data here and there) within a GUID. Its a 16 HEX characters (so 16^16 possible values) string and I want to 'encode' some data within that GUID. How can I achieve this? I am really after any ideas and implementations here, Ive not yet decided on the best mechanism for it yet. I would also like encryption to be involved if possible... Thanks a lot Mark

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Redirect page without losing SEO

    - by Ramesh Soni
    I want to change address of my online page but want to make sure that I won't lose any SEO thing. e.g. want to move a page from http://example.com/1.aspx to http://example2.com/a.aspx Is it possible to do this? If yes, then how? If no, what best could be done here if I have to move page and there is no way to stop this.

    Read the article

  • img captions based on src value match

    - by Basho
    I am trying t o create img captions based on src value match. JQUERY : What is the best way to extract "Author-ABC" from an img with src value wwww.abcd.com/images/imagename_Author-ABC_.jpg and replace the alt value with this value. DRUPAL : Is there a way to preprocess this a drupal template function and save the value in img alt attribute? Ideas? Basho

    Read the article

  • How to build and deploy Python web applications

    - by sverrejoh
    I have a Python web application consisting of several Python packages. What is the best way of building and deploying this to the servers? Currently I'm deploying the packages with Capistrano, installing the packages into a virtualenv with bash, and configuring the servers with puppet, but I would like to go for a more Python based solution. I've been looking a bit into zc.buildout, but it's not clear for me what I can/should use it for.

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • Matching between product and customer personal information

    - by Yanshof
    I writing some application that find ( according to some question ) information about some person ( lets say that the information are weight, hight and age of the person ). In the other hand i have product list ( can be very big one ) and according to the product information i need to find the best matching between the person information and the product ( the product information that i have are water part, nitrogen part and ext. ) I can't use flow chart algorithm or Breadth-first search because the number of the product is dynamically ( read the product list from DB ... )

    Read the article

  • Percent of internet running Google Native Client?

    - by anon
    Anyone have numbers on how many machines / % of internet uses have Google Native Client? I'm curious about google NaCL as a platform: it seems to combine the best of the web (just a webpage, accessible on any machine) and desktop apps (OpenGL, C/C++ power). The only question is -- what percent of the world actually use it. Anyone have data on this? Thanks!

    Read the article

  • Undo/Redo using Memento: Stack, Queue or just LinkedList?

    - by serhio
    What is the best having when implementing Memento pattern (for Undo/Redo) in witch collection to Keep Mementos? Basically, I need this(c = change, u = undo, r = redo): 0 *c -1 0 *c -2 -1 0 *c -3 -2 -1 0 <u -2 -1 0 1 *c -3 -2 -1 0 Variants: LinkedList - possible in principle, maybe not optimized. Queue - not adapted for this task, IMO. Stack - not adapted for undo AND redo; Double Stack - maybe optimal, but can't control the undo maximum size.

    Read the article

  • Archiving sharepoint site instade of deleting

    - by Sachin
    Hi All, I have a sharepoint site. This site large nubmer of site and sub site sollection in it. There are few that are created and are not in use. Now my questuion is how can I findout these old sites and before going deleting I have to first archive it. Can any one tell me what is the best possible approach to do it?

    Read the article

  • SQLite and Portuguese-br characters

    - by ForeignerBR
    I'm developing an app that requires the storage of Portuguese characters. I was wondering if I need to do any configuration to prepare my SQLite db to store those considered special characters. When I query a db table that contains those characters I get a '?' (without quotes) in their place. best regards, mp

    Read the article

  • How do you encourage users to fill out their profile?

    - by mattdell
    Hello, I wanted to open up the topic to discuss ways to encourage or incentivize users to fill in information in a user profile on a website, such as skills, location, organization, etc. More information in a user profile can give a website an improved capability for its users to search, network, and collaborate. Without bugging users to fill in their profiles (ie - via annoying e-mail reminders), what other ways have you guys come up with to encourage user input? Best, -Matt

    Read the article

  • showcase website in album

    - by proyb2
    What is the best gallery to showcase web design you have came across? Plan to get various creative agencies to showcase their works on an advertisement platform so that new user will be able to see various portfolio. When it come to select a suitable album, I am indecisive if it too plain (Load and display) or too flashy (coverflow album), which album/gallery script do you recommend for our corporate theme? I would prefer background to be white.

    Read the article

  • wpf Image resources and visual studio 2010 resource editor

    - by Berryl
    Hello My motivation for this question is really just to specify an image to be used in a user control via a dependency property for ImageSource. I'm hitting some pain points involving the management, access, and unit testing for this. Is the resource editor a good tool to use to maintain images for the application? What is the best way to translate the Bitmap from the editor to an ImageSource? How can I grab the resource Filename from the editor? Cheers, Berryl

    Read the article

  • How to read using C++ (C#) sound stream sent by flash?

    - by Oleg
    Hello. I need to read sound stream sent by flash audio in my C++ application (C++ is not a real limitation, it may be C# or any other desktop language). Now flash app sends audio to another flash app but I need to receive the same audio by desktop application. So, is there a standard or best way how to do it? Thank you for your answers.

    Read the article

  • SWT: cleaning up before application exit

    - by Alexey Romanov
    What is the best way for an SWT application to clean up resources before application exit? I see two options: 1) Add a DisposeListener to main window (or better, to the Display). Will it get run if an uncaught exception happens? 2) Use a shutdown hook. Any problems to be aware of there which aren't mentioned in Design of the Shutdown Hooks API?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 640 641 642 643 644 645 646 647 648 649 650 651  | Next Page >