Search Results

Search found 29753 results on 1191 pages for 'best practices'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 646/1191 | < Previous Page | 642 643 644 645 646 647 648 649 650 651 652 653  | Next Page >

  • Creating content input form with custom theme (Drupal)

    - by AndrewSmith
    I'm creating a site which I want to place content input form in custom themed template. I opted to do this because I wanted the whole site to be looked uniform. That said, I'm not sure as to what is the best approach to do this. Is it proper to invoke hook_insert/delete/update and hook_perm/hook_access by myself or is there anyway I can still use my custom theme and write a code in a way that drupal would take care of invoking appropriate hooks accordingly? Thanks in advance PS : I'm on drupal 6.x

    Read the article

  • Undo/Redo using Memento: Stack, Queue or just LinkedList?

    - by serhio
    What is the best having when implementing Memento pattern (for Undo/Redo) in witch collection to Keep Mementos? Basically, I need this(c = change, u = undo, r = redo): 0 *c -1 0 *c -2 -1 0 *c -3 -2 -1 0 <u -2 -1 0 1 *c -3 -2 -1 0 Variants: LinkedList - possible in principle, maybe not optimized. Queue - not adapted for this task, IMO. Stack - not adapted for undo AND redo; Double Stack - maybe optimal, but can't control the undo maximum size.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • Is Borland C++ v3 for DOS available anywhere now?

    - by Galwegian
    Hi, I'm looking for a copy of either Borland C++ v3 or Turbo C++ which can run on DOS, but my searches are turning up a blank. I vaguely remember a free Turbo version available, but can't track it down. Are there free/pay versions of these still available? Is http://www.embarcadero.com my best hope? Thanks for any info...

    Read the article

  • Inter process communication C# <--> C++ for game debugging engine.

    - by Andy
    I am working on a debugger project for a game's scripting engine. I'm hoping to write the debugger's GUI in C#. The actual debugging engine, however, is embedded in the game itself and is written in a mixture of C, C++, and assembly patches. What's the best way to handle communication between the debugger GUI and the debugging engine? The two will be running in separate processes. Thanks! Andy

    Read the article

  • Can anyone help with this Magento error?

    - by Duane
    Fatal error: Call to a member function getArea() on a non-object in {directory}/includes/src/Mage_Core_Model_App_Area.php on line 155 Cropped up when I installed an extension that I wrote on a clean install of Magento. When ported to the dev server it took it down and I cant seem to find where it has originated. Disabling the extension changes nothing. Along with clearing the cache and all the regular Magento hiccups. I've ensured that file permissions are correct to the best of my knowledge.

    Read the article

  • Should HTML be encoded before being persisted?

    - by Sir Psycho
    Should HTML be encoded before being stored in say, a database? Or is it normal practice to encode on its way out to the browser? Should all my text based field lengths be quadrupled in the database to allow for extra storage? Looking for best practice rather than a solid yes or no :-)

    Read the article

  • Get just the hour of day from DateTime using either 12 or 24 hour format as defined by the current c

    - by InvisibleBacon
    .Net has the built in ToShortDateString() function for DateTime that uses the CultureInfo.CurrentCulture.DateTimeFormat.ShortTimePattern format. It returns something like this for en-US: "5:00 pm". For a 24 hour culture such as de-DE it would return "17:00". What I want is a way to just return just the hour (So "5 pm" and "17" in the cases above) that works with every culture. What's the best/cleanest way to do this? Thanks!

    Read the article

  • JPA: what is the proper pattern for iterating over large result sets?

    - by Caffeine Coma
    Let's say I have a table with millions of rows. Using JPA, what's the proper way to iterate over a query against that table, such that I don't have all an in-memory List with millions of objects? I suspect that the following will blow up if the table is large: List<Model> models = entityManager().createQuery("from Model m", Model.class).getResultList(); for (Model model : models) { // do something with model } Is pagination (looping and manually updating setFirstResult()/setMaxResult()) really the best solution?

    Read the article

  • drawing circle without floating point calculation

    - by zaharpopov
    This is common interview question (according to some interview sites) but I can find no normal answers in Internet - some are wrong and some point to complex theory I expect not looked for in interview (like Bressenham algorithm). The question is simple: The circle equation is: x^2 + y^2 = R^2. Given R, draw 0,0-centered circle as best as possible without using any floating point (no trigo, square roots, and so on, only integers)

    Read the article

  • How to create a horizontal scrollable list?

    - by Thomas Joos
    hi all, I am wondering what the best approach is for creating a horizontal list with custom buttons. I read there is no native control for that: I am considering a UIView with a scroll view inside. On this scrollview I visualize my array of button objects. Any thoughts?

    Read the article

  • jQuery MVC architecture

    - by Tomas Barbak
    Hi, what is the best way to create MVC architecture in jQuery? Should I use jQuery.extend()? jQuery.extend({ View: function(){} }); ...or jQuery Plugin? (function($) { $.fn.model = function() { return this; }; })(jQuery); ...or just objects in JavaScript? var model = {} var view = {} var controller = {} Thank you!

    Read the article

  • Java method: retrieve the inheriting type

    - by DrDro
    I have several classes that extend C and I would need a method that accepts any argument of type C. But in this method I would like to know if I'm dealing with A or B. * public A extends C public B extends C public void goForIt(C c)() If I cast how can I retrieve the type in a clean way (I just read using getClass or instanceof is often not the best way). *Sorry but I can't type closing braces

    Read the article

  • Recommendations for Open Source Parallel programming IDE

    - by Andrew Bolster
    What are the best IDE's / IDE plugins / Tools, etc for programming with CUDA / MPI etc? I've been working in these frameworks for a short while but feel like the IDE could be doing more heavy lifting in terms of scaling and job processing interactions. (I usually use Eclipse or Netbeans, and usually in C/C++ with occasional Java, and its a vague question but I can't think of any more specific way to put it)

    Read the article

  • How to localize ASP .Net MVC application?

    - by pirho
    What would be best practice to localize your ASP .Net MVC application ? I would like to cover two situations: one application deployment in IIS which would handle multiple languages one language / application deployment. In first situation should you go with somekind of view based thing like, ~/View/EN, ~/View/FI, ~/View/SWE or something different ? What about second case, just application based config via Web.config and point these different languages to different urls ?

    Read the article

  • Virtual destructors for interfaces.

    - by wowus
    Do interfaces need a virtual destructor, or is the auto-generated one fine? For example, which of the following two code snippets is best, and why? class Base { public: virtual void foo() = 0; virtual ~Base() {} }; OR... class Base { public: virtual void foo() = 0; };

    Read the article

  • ServerVariables and POST Data

    - by tyndall
    I've got a piece of tracking code which is capturing REMOTE_HOST, SERVER, REQUEST_METHOD, SCRIPT_NAME and QUERY_STRING. It grabs these from ServerVariables and sticks them in a database by user and IP. What is the best way to pick up the exact contents of what was posted back to a URL in ASP.NET? Is there an HTTP_POST? I'd rather not grab something and then have to parse it.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 642 643 644 645 646 647 648 649 650 651 652 653  | Next Page >