Search Results

Search found 29753 results on 1191 pages for 'best practices'.

Page 645/1191 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • Distinguish between single and double click events in Qt

    - by Jesse
    I have a QAbstractItemView that needs to react to single and double click events. The actions are different depending on whether it was single clicked or double clicked. The problem that is occurring is that the single click event is received prior to the double click event. Is there a recommended way/best practice for distinguishing between the two? I don't want to perform the single click action when the user has actually double clicked. I am using Qt 4.6

    Read the article

  • Which is clearer form: if(!value) or if(flag == value) ?

    - by CodexArcanum
    I understand this is a subjective question, so I apologize if it needs to be closed, but I feel like it comes up often enough for me to wonder if there is a general preference for one form over the other. Obviously, the best answer is "refactor the code so you don't need to test for falsehood" but sometimes there's no easy way to do so and the "else" branch is simply to continue processing. So when you must have an "if not false" construct, which is the preferred standard: The not operator if(!value) Or the test for false if(value == false)

    Read the article

  • Play audio file on hover

    - by powtac
    What is the best solution to play an audio file on mouse over via JavaScript? And stop it when the mouse leaves the link. jQuery is available. <a href="/test.mp3" class="play">play</a>

    Read the article

  • Is it possible to resize text to fit a fixed size div?

    - by int3
    This seems like a pretty natural use case to me, though I haven't been able to find anything on it: Say I have a fixed-width div that is dynamically populated with some number. What's the best way to ensure that numbers with more digits take smaller font sizes such that they fit nicely into that fixed width? Is there some CSS property for this, or do I have to resort to Javascript hackage?

    Read the article

  • Should HTML be encoded before being persisted?

    - by Sir Psycho
    Should HTML be encoded before being stored in say, a database? Or is it normal practice to encode on its way out to the browser? Should all my text based field lengths be quadrupled in the database to allow for extra storage? Looking for best practice rather than a solid yes or no :-)

    Read the article

  • Passing login details between pages in jQuery Mobile?

    - by manraj82
    I am a newbie to jQuery Mobile and trying to come with the best and scure way of passing login details between pages in jQuery Mobile.I did a quick search and found some solutions, Solution 1 :Since its the same dom data can be accessed using plain old variables. Solution 2 :Use HTML5 sessionStorage I have not found anymore solutions yet.If some one has successfully implemented this,could you please advise how I should go about doing this? Thank You

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Eclipse project artefacts in Maven repository

    - by Georgios Gousios
    I want to use some of the libraries produced by the Eclipse project through Maven. I 've had a look at the main Maven repo and while it looks like that there are a few projects already imported, their versions are old and some important ones are missing (e.g. cdt). Is there any Eclipse project official Maven repository? If not, what would be the best option to use current versions of libraries such as the JDT compiler in a maven-enabled project?

    Read the article

  • WCF MSMQ consumer thread count

    - by Andy White
    What's the best way to configure the maximum number of threads that can pull messages from an MSMQ queue, using a netMsmqBinding in WCF? For example, say I have an MSMQ service for which I only want to have 2 (or 10, or whatever number of) worker threads pulling messages off at a time.

    Read the article

  • I simple search controller that stores search history, should I use resource routing or non-resource?

    - by vfilby
    I am learning rails and am toying with a simple web-app that integrates with flickr to search photos based on user given criteria and store the query in a search history table. I am seeking the best or 'rails' way of handling this. Should I setup a controller and non-resource routes that handle the search and store the data in a custom table; or should I create a resource for queries with a resource route and an additional path for search?

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • PHP echo query result in Class??

    - by Jerry
    Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

    Read the article

  • Warning: pointer of type 'void *' used in subtraction

    - by idealistikz
    Although it runs correctly, the following results in the aforementioned compiler warning: return ((item - (my->items))/(my->itemSize)); 'item' is a 'void *'; 'my-items' is a 'void *'; 'my-itemSize' is an 'int' Casting 'item' and 'my-items' as an 'int *' caused the program to run improperly. What is the best way to remove the warning?

    Read the article

  • Copying a byte buffer with JNI

    - by Daniel
    I've found plenty of tutorials / questions on Stackoverflow that deal with copying char arrays from C/JNI side into something like a byte[] in Java, but not the other way around. I am using a native C library which expects a byte array. I simply want to get data from a byte[] in java, into preferably an unsigned char[] in C. Long story short: What is the best way of copying data from a jBytearray in JNI? Is there any way to detect it's size?

    Read the article

  • How can I retrieve the instance of an attribute's associated object?

    - by Brandon Linton
    I'm writing a PropertiesMustMatch validation attribute that can take a string property name as a parameter. I'd like it to find the corresponding property by name on that object and do a basic equality comparison. What's the best way to access this through reflection? Also, I checked out the Validation application block in the Enterprise Library and decided its PropertyComparisonValidator was way too intense for what we need.

    Read the article

  • Is Borland C++ v3 for DOS available anywhere now?

    - by Galwegian
    Hi, I'm looking for a copy of either Borland C++ v3 or Turbo C++ which can run on DOS, but my searches are turning up a blank. I vaguely remember a free Turbo version available, but can't track it down. Are there free/pay versions of these still available? Is http://www.embarcadero.com my best hope? Thanks for any info...

    Read the article

  • Custom search engine in asp.net mvc and entity framework

    - by Rahat
    Hi, does anyone have any idea how I can get started building a search engine for my asp.net mvc site using entity framework. I plan to build something like: http://www.carsguide.com.au/search/?N=4294962119++492&type=cars there on the left there is a refine search option panel. What's the best approach to design a model for the UI and optimized query with entity framework.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >