Search Results

Search found 18092 results on 724 pages for 'matt long'.

Page 670/724 | < Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >

• remove data layer and put into it's own domain

  - by user334768

  I have a SL4 application that uses EF4 & RIA Services. DB is SQL 2008. All is working well. Now I want to put the Database and web services on one domain (A.com) with the web service exposing the same methods available in my working project. (one listed at top of message) Then put a Silverlight application (same one as above) on domain(B.com) and call the web services on A.com. I thought I had a fair understanding of RIA Services. Enough to get the above application working. Now when I say "working" I do mean on my local dev machine. I have yet to deployed as SL4 & .NET 4 application to my hosting site. But I don't think I understand it well enough. I normally create a new business app, add EF then create the RIA DomainService. Add any [Includes] I need, modify my linq queries and run application. And it works. Now I need to break off my data layer and put it on another hosting site (A.com) And put my UI and business logic on another hosting site (B.com) I think I need to do the following : On the Database & web service site: domain(A.com) create application, create EF4, create RIA Services and deploy. At this time, are the methods exposed available as a "WEB SERVICE" to other applications calling by http:// a.com/serviceName.svc address? I think I need to do the following : On the application site : domain(B.com) create a business application (later will need authentication and navigation). How can I create an EF when I don't have access to the database? (I know I do have access but I want know what happens here when I do not have access to the database, but only data provided by a web service) If I can not create an EF how do I create my RIA Service? I hope any one who takes time to help me understands what I'm asking. Sorry so long.

  Read the article

• how do i know how many clients are calling my WCF service function

  - by ZhengZhiren

  i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

  Read the article

• Subband decomposition using Daubechies filter

  - by misha

  I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

  Read the article

• How to tag photos in facebook-api?

  - by Camillo

  Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

  Read the article

• TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

  - by domsom

  I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

  Read the article

• Creating multiple heads in remote repository

  - by Jab

  We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

  Read the article

• Simple RSA encryption (Java)

  - by jake blue

  This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

  Read the article

• One intent is working, second is giving me a crash

  - by user1480742

  ok, so both intents receiver sides are on the same activite and they are sending from different ones....second one is not working, first one does, dont know why...all 3 activites are ok in manifest and all that //second intent on senders side public void onItemSelected(AdapterView<?> arg0, View users, int i, long l) { FILENAME = (adapter.getItem(i)).toString(); Bundle viewBag2 = new Bundle(); viewBag2.putString("profile_name", FILENAME); Intent b = new Intent(OptionsMenu.this, CoreActivity.class); b.putExtras(viewBag2); startActivity(b); } //second intent on receiver side private void Data_transfer() { Bundle gotbasket2 = getIntent().getExtras(); profileName = gotbasket2.getString("profile_name"); } //first (working intent) on senders side public void onClick(View v) { Bundle viewBag = new Bundle(); viewBag.putString("spinner_result", s); a.putExtras(viewBag); } //first (working intent) on receiver side private void Data_transfer() { // TODO Auto-generated method stub Bundle gotbasket = getIntent().getExtras(); x = gotbasket.getString("spinner_result"); } 06-26 20:22:09.787: D/AndroidRuntime(1802): Shutting down VM 06-26 20:22:09.787: W/dalvikvm(1802): threadid=1: thread exiting with uncaught exception (group=0x40015560) 06-26 20:22:09.847: E/AndroidRuntime(1802): FATAL EXCEPTION: main 06-26 20:22:09.847: E/AndroidRuntime(1802): java.lang.RuntimeException: Unable to start activity ComponentInfo{mioc.diver/mioc.diver.CoreActivity}: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Handler.dispatchMessage(Handler.java:99) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Looper.loop(Looper.java:123) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.main(ActivityThread.java:3683) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invokeNative(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invoke(Method.java:507) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 06-26 20:22:09.847: E/AndroidRuntime(1802): at dalvik.system.NativeStart.main(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): Caused by: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.Data_transfer(CoreActivity.java:189) 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.onCreate(CoreActivity.java:88) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611) 06-26 20:22:09.847: E/AndroidRuntime(1802): ... 11 more

  Read the article

• ASP.Net MVC Ajax form with jQuery validation

  - by Tomas Lycken

  I have an MVC view with a form built with the Ajax.BeginForm() helper method, and I'm trying to validate user input with the jQuery Validation plugin. I get the plugin to highlight the inputs with invalid input data, but despite the invalid input the form is posted to the server. How do I stop this, and make sure that the data is only posted when the form validates? My code The form: <fieldset> <legend>leave a message</legend> <% using (Ajax.BeginForm("Post", new AjaxOptions { UpdateTargetId = "GBPostList", InsertionMode = InsertionMode.InsertBefore, OnSuccess = "getGbPostSuccess", OnFailure = "showFaliure" })) { %> <div class="column" style="width: 230px;"> <p> <label for="Post.Header"> Rubrik</label> <%= Html.TextBox("Post.Header", null, new { @style = "width: 200px;", @class="text required" }) %></p> <p> <label for="Post.Post"> Meddelande</label> <%= Html.TextArea("Post.Post", new { @style = "width: 230px; height: 120px;" }) %></p> </div> <p> <input type="submit" value="OK!" /></p> </fieldset> The JavaScript validation: $(document).ready(function() { // for highlight var elements = $("input[type!='submit'], textarea, select"); elements.focus(function() { $(this).parents('p').addClass('highlight'); }); elements.blur(function() { $(this).parents('p').removeClass('highlight'); }); // for validation $("form").validate(); }); EDIT: As I was getting downvotes for publishing follow-up problems and their solutions in answers, here is also the working validate method... function ajaxValidate() { return $('form').validate({ rules: { "Post.Header": { required: true }, "Post.Post": { required: true, minlength: 3 } }, messages: { "Post.Header": "Please enter a header", "Post.Post": { required: "Please enter a message", minlength: "Your message must be 3 characters long" } } }).form(); }

  Read the article

• WPF multibound textblock not updating

  - by Superstringcheese

  I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

  Read the article

• Accordion nonfunctional in Opera

  - by nona

  While working as expected in all other browsers, opera refuses to tween the height of content. oddly enough, as i sat annoyed rapidly clicking it over and over again, if it's closed, and you select some text, and keep clicking the same spot long enough, sometimes it pops open. lol. seriously. ahh, it seems to sometimes open the first time clicked after the page is loaded. wth? the javascript: window.addEvent('domready', function(){ var content_height = [];i=0; $$( '.bio_accordion' ).each(function(item){ i++; content_height.push(item.getElement('.moreInfo').offsetHeight); var thisSlider = new Fx.Slide( item.getElement( '.moreInfo' ), { mode: 'horizontal' } ); thisSlider.hide(); item.getElement('.moreInfo').set('tween').tween('height', '0px'); var morph = new Fx.Morph(item.getElement( '.divToggle' )); var selected = 0; item.getElement( '.divToggle' ).addEvents({ 'mouseenter': function(){ if(!selected) this.morph('.div_highlight'); }, 'mouseleave': function(){ if(!selected) { this.morph('.divToggle'); } }, 'click': function(){ if (!selected){ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; item.getElement('.moreInfo').set('tween', { duration: 1500, transition: Fx.Transitions.Bounce.easeOut }).tween('height', content_height[i]); selected = 1; thisSlider.slideIn(); } else{ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; thisSlider.slideOut(); item.getElement('.moreInfo').set('tween', { duration: 1000, transition: Fx.Transitions.Bounce.easeOut }).tween('height', '0px'); selected = 0; } } }); } ); }); the html: <div class="bio_accordion"> <div class="divToggle">test<span class="symbol">-</span></div> <div class="moreInfo" style="margin-left:10px;"> aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa asdfasdfasdfasdfasdfasdfasdfasdfasdfasdfasdf aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa asdfasdfasdfasdfasdfasdfasdfasdfasdfasdfasdf aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa asdfasdfasdfasdfasdfasdfasdfasdfasdfasdfasdf </div> </div> the css: .bio_accordion { padding:0px; margin:0px; } .divToggle { cursor: pointer; color: #ffffff; background-color:#1089b5; padding: 8px; } .div_highlight { padding-left:30px; padding-right:30px; background-color:#096687; } .moreInfo { padding: 2px; padding-top:15px; padding-bottom:15px; overflow: hidden; } .symbol { float:right; }

  Read the article

• Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

  - by Pickels

  Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

  Read the article

• How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

  - by dommer

  I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

  Read the article

• Learning... anything really

  - by WebDevHobo

  I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

  Read the article

• weird performance in C++ (VC 2010)

  - by raicuandi

  Hello, I have this loop written in C++, that compiled with MSVC2010 takes a long time to run. (300ms) for (int i=0; i<h; i++) { for (int j=0; j<w; j++) { if (buf[i*w+j] > 0) { const int sy = max(0, i - hr); const int ey = min(h, i + hr + 1); const int sx = max(0, j - hr); const int ex = min(w, j + hr + 1); float val = 0; for (int k=sy; k < ey; k++) { for (int m=sx; m < ex; m++) { val += original[k*w + m] * ds[k - i + hr][m - j + hr]; } } heat_map[i*w + j] = val; } } } It seemed a bit strange to me, so I did some tests then changed a few bits to inline assembly: (specifically, the code that sums "val") for (int i=0; i<h; i++) { for (int j=0; j<w; j++) { if (buf[i*w+j] > 0) { const int sy = max(0, i - hr); const int ey = min(h, i + hr + 1); const int sx = max(0, j - hr); const int ex = min(w, j + hr + 1); __asm { fldz } for (int k=sy; k < ey; k++) { for (int m=sx; m < ex; m++) { float val = original[k*w + m] * ds[k - i + hr][m - j + hr]; __asm { fld val fadd } } } float val1; __asm { fstp val1 } heat_map[i*w + j] = val1; } } } Now it runs in half the time, 150ms. It does exactly the same thing, but why is it twice as quick? In both cases it was run in Release mode with optimizations on. Am I doing anything wrong in my original C++ code?

  Read the article

• Across process marhalling problem with an array of points

  - by ElMagn

  Hi All, We have what we think is a marshalling problem with a renderer object when called across process boundaries. The renderer is an ATL COM server with a COM object that implements the IPoints interface defined below: typedef [uuid(B0E01719-005A-427c-B9DD-B42A18E969AE)] struct Point { double X; double Y; } Point; [ object, uuid(3BFECFE3-B4FB-4f14-8257-6E065D02E3B3), helpstring("IPoints Interface"), dual, ] interface IPoints : IDispatch { HRESULT DrawPolyLine([in] long hDC, [in] short count, [in, size_is(count)] Point * points ); // many more like DrawLine } The count parameter represents the number of points and the points parameter represents an array of the actual points. We have two process running, a graphical display process (GDP) and a tabular (grid) display process (TDP). A factory in the GDP, written in C#, creates the renderer and the clients of the renderer in the GDP. When the clients call into the renderer, everything displays correctly. The renderer is created at start up BTW. There is another factory in the TDP, written in VB6, that calls into the factory in the GDP to create the clients. When the clients call into the renderer, only the first point in the array is marshaled correctly, all the other points are garbage. Seems that the rendering works only when the client creation is started from the same process as the renderer. Now, i am not sure what the solution to this problem is. It seems that if we can guarantee that the clients are always created from a thread in the same GDP process as the renderer then the points are marshaled correctly. We tried using a background thread from the Thread Pool in C# and it indeed worked. The problem is that Windows Forms created from the clients stopped working because accessing the form's controls from a thread other than the thread that created the control is not allowed. We might change the calls to access the forms but we have quite a few of them and are trying to look into a different solution that might involve making changes to the renderer. The other problem is that the renderer is legacy code and we can't just change the interface. I am wondering what can we do to the renderer's interface that would help with marshalling from across process calls. Any ideas would be greatly appreciated. Regards, ElMagn

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• div popup inside td

  - by sims

  I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

  Read the article

• mysql: can't set max_allowed_package to anything grater than 16MB

  - by sas

  I'm not sure if this is the right place to post these kind of questions, if it's not so, please (politely) let me know... :-) I need to save files greater than 16MB on a mysql database from a php site... I've already changed the c:\xampp\mysql\bin\my.cnf and set max_allowed_packet to 16 MB, and everything worked fine then I set it to 32 MB but there´s no way I can handle a file bigger than 16 MB I get the following error: 'MySQL server has gone away' (the same error I had when max_allowed_packet was set to 1MB) there must be some other setting that doesn´t allow me to handle files bigger than 16MB maybe the php client, I guess, but I don't know where to edit it this is the code I'm running when file.txt is smaller than 16.776.192 bytes long, it works fine, but if file.txt has 16.777.216 bytes i get the aforementioned error oh, and the field download.content is a longblob... $file = 'file.txt'; $file_handle = fopen( $file, 'r' ); $content = fread( $file_handle, filesize( $file ) ); fclose( $file_handle ); db_execute( 'truncate table download', true ); $sql = "insert into download( code, title, name, description, original_name, mime_type, size, content, user_insert_id, date_insert, user_update_id, date_update ) values ( 'new file', 'new file', 'sas.jpg', 'new file', '$file', 'mime', " . filesize( $file ) . ", '" . addslashes( $content ) . "', 0, " . db_char_to_sql( now_char(), 'datetime' ) . ", 0, " . db_char_to_sql( now_char(), 'datetime' ) . " )"; db_execute( $sql, true ); (the db_execute funcion just opens the connections and executes the sql stuff) running on windows XP sp2 server version: 5.0.67-community PHP Version 4.4.9 mysql client API version: 3.23.49 using: ApacheFriends XAMPP (Basispaket) version 1.6.8 that comes with + Apache 2.2.9 + MySQL 5.0.67 (Community Server) + PHP 5.2.6 + PHP 4.4.9 + PEAR + phpMyAdmin 2.11.9.2 ... this is part of the content of c:\xampp\mysql\bin\my.cnf # The MySQL server [mysqld] port= 3306 socket= "C:/xampp/mysql/mysql.sock" basedir="C:/xampp/mysql" tmpdir="C:/xampp/tmp" datadir="C:/xampp/mysql/data" skip-locking key_buffer = 16M # max_allowed_packet = 1M max_allowed_packet = 32M table_cache = 128 sort_buffer_size = 512K net_buffer_length = 8K read_buffer_size = 256K read_rnd_buffer_size = 512K myisam_sort_buffer_size = 8M

  Read the article

• basic operations for modifying a source document with XSLT

  - by SpliFF

  All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

  Read the article

• PHP Regex: How to match anything except a pattern between two tags

  - by Ryan

  Hello, I am attempting to match a string which is composed of HTML. Basically it is an image gallery so there is a lot of similarity in the string. There are a lot of <dl> tags in the string, but I am looking to match the last <dl>(.?)+</dl> combo that comes before a </div>. The way I've devised to do this is to make sure that there aren't any <dl's inside the <dl></dl> combo I'm matching. I don't care what else is there, including other tags and line breaks. I decided I had to do it with regular expressions because I can't predict how long this substring will be or anything that's inside it. Here is my current regex that only returns me an array with two NULL indicies: preg_match_all('/<dl((?!<dl).)+<\/dl>(?=<\/div>)/', $foo, $bar) As you can see I use negative lookahead to try and see if there is another <dl> within this one. I've also tried negative lookbehind here with the same results. I've also tried using +? instead of just + to no avail. Keep in mind that there's no pattern <dl><dl></dl> or anything, but that my regex is either matching the first <dl> and the last </dl> or nothing at all. Now I realize . won't match line breaks but I've tried anything I could imagine there and it still either provides me with the NULL indicies or nearly the whole string (from the very first occurance of <dl to </dl></div>, which includes several other occurances of <dl>, exactly what I didn't want). I honestly don't know what I'm doing incorrectly. Thanks for your help! I've spent over an hour just trying to straighten out this one problem and it's about driven me to pulling my hair out.

  Read the article

• how to fix protocol violation in c#

  - by Jeremy Styers

  I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

  Read the article

• Solving a cyclical dependency in Ninject (Compact Framework)

  - by Alex

  I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

  Read the article

• How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

  - by Paul Chernoch

  I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

  Read the article

• PHP array pointer craziness

  - by JMan

  I'm trying to create a "GetCurrentLevel" method that takes a point value as an input and returns what "Level" that corresponds to. I'm storing the Level = Points mapping in an array, but the array pointer is not moving logically when I use it a foreach loop. I've added echo statements for debugging. Here's my class definition: class Levels extends Model { protected $_map = array ( 'None' => 0, 'Bronze' => 50, 'Silver' => 200, 'Gold' => 500 ); public function __construct() { parent::__construct(); } public function GetCurrentLevel($points) { foreach ($this->_map as $name => $threshold) { echo "Level Name: $name<br/>"; echo "Level Threshold: $threshold<br/>"; echo "Current Level: " . key($this->_map) . "<br/>"; echo "Current Threshold: " . current($this->_map) . "<br/>"; if ($points < $threshold) /* Threshold is now above the points, so need to go back one level */ { $previousThreshold = prev($this->_map); echo "Previous Threshold: $previousThreshold<br/>"; echo "Final Level: " . key($this->_map) . "<br/>"; return key($this->_map); } echo "Go to next level <br/>"; } } And here is what I see when I call GetCurrentLevel(60): Level Name: None Level Threshold: 0 Current Level: Bronze //* Looks like foreach immediately moves the array pointer *// Current Threshold: 50 Go to next level Level Name: Bronze Level Threshold: 50 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Go to next level Level Name: Silver Level Threshold: 200 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Previous Threshold: 0 Final Level: None But the "Final Level" should be 'Bronze' since 60 points is above the 50 points needed for a Bronze medal, but below the 200 points needed for a Silver medal. Sorry for the long post. Thanks for your help!

  Read the article

< Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >