Search Results

Search found 18092 results on 724 pages for 'matt long'.

Page 670/724 | < Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >

• Need help simplifying my php table

  - by user342391

  I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

  Read the article

• How do you combine "Revision Control" with "WorkFlow" for R?

  - by Tal Galili

  Hello all, I remember coming across R users writing that they use "Revision control" (e.g: "Source control"), and I am curious to know: How do you combine "Revision control" with your statistical analysis WorkFlow? Two (very) interesting discussions talk about how to deal with the WorkFlow. But neither of them refer to the revision control element: http://stackoverflow.com/questions/1266279/how-to-organize-large-r-programs http://stackoverflow.com/questions/1429907/workflow-for-statistical-analysis-and-report-writing A Long Update To The Question: Following some of the people's answers, and Dirk's question in the comment, I would like to direct my question a bit more. After reading the Wiki article about "revision control" (which I was previously not familiar with), it was clear to me that when using revision control, what one does is to build a development structure of his code. This structure either leads to a "final product" or to several branches. When building something like, let's say, a website. There is usually one end product you work towards (the website), with some prototypes along the way. But when doing a statistical analysis, the work (to my view) is different. Sometimes you know where you want to get to. But more often, you explore. Explore cleaning the dataset. Explore different methods for statistical analysis, and ask various questions of your data (and I am writing this, knowing how Frank Harrell, and other experience statisticians feels about Data dredging). That is way the WorkFlow question with statistical programming is (in my view) a serious and deep question, raising many issues, The simpler ones are technical: Which revision control software do you use (and why) ? Which IDE do you use(and why) ? The more interesting question are about work process: How do you structure your files? What do you keep as a separate file and what as a revision? or asking in a different way - What should be a "branch" and what should be a "sub project" in your code? For example: When starting to explore your data, should a plot be creating and then erased because it didn't lead any where (but kept as a revision) or should there be a backup file of that path? How you solve this tension was my initial curiosity. The second question is "what might I be missing?". What rules (of thumb) should one follow so to avoid common pitfalls doing statistical programming with version control? In my intuition, I feel that statistical programming is inherently different then software development (I am writing this without being a real expert in statistical programming, and even less so in software development). That's way I am unsure which of the lessons I have read here about version control would be applicable. Thanks a lot, Tal

  Read the article

• problem to create session of facebook

  - by khoyendra

  try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

  Read the article

• Subband decomposition using Daubechies filter

  - by misha

  I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

  Read the article

• HTML table ignoring element-style width

  - by sangil

  HTML table ignoring element-style width I have an HTML table where certain cells have very long text contents. I want to specify a width (in pixels) for these cells using jQuery, but the rendered table just ignores the given width. Is there any way to force the table to respect this width? Thanks! JSFiddle: http://jsfiddle.net/sangil/6hejy/35/ (If you inspect the cell you can see the the computed width is different than the element-style width) HTML: <div id="tblcont" class="tblcont"> <table id="pivot_table"> <tbody> <tr> <th id="h0" >product</th> <th id="h1" >price</th> <th id="h2" >change</th> </tr> <tr> <!-- this is the cell causing trouble --> <td id="c00" >Acer 2400 aaaaaaaaaaaaaaaaaaaaaaaaaa</td> <td id="c01" >3212</td> <td id="c02" >219</td> </tr> <tr> <td id="c10" >Acer</td> <td id="c11" >3821</td> <td id="c12" >206</td> </tr> </tbody> </table> </div> CSS: .tblcont { overflow: hidden; width: 500px; } table { table-layout: fixed; border-collapse: collapse; overflow-x: scroll; border-spacing:0; width: 100%; } th, td { overflow: hidden; text-overflow: ellipsis; word-wrap: break-word; } th { height: 50px; } ?Javascript: $(document).ready(function() { // THIS LINE HAS NO EFFECT! $('#c00').width(30); });

  Read the article

• Two loops speeds drawing in a Jframe

  - by noahn567

  I have a program that requires two classes. The player-Names class, and the Player-Model class. I want the player-Names class to repaint every half second, and the Player-Model class to repaint 60 times per second because i want the movement to be smooth. The problem that i am having is that i want all of this to be done on one J-frame. How would i go about doing this? If you could lead me in the right direction or give me a little example that would be great! Thank you :). for some reason it wont let me post so i'm going to put in some random code import java.awt.Color; import java.awt.Font; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.RenderingHints; import javax.swing.JComponent; import javax.swing.JFrame; public class PlayerNames extends JFrame { static int connectionTimer = 0; static int connectionTimer2 = 0; static int reconnect = 0; static int reconnectValue = 1; static int x = 0; static int reconnectWait = connectionTimer + reconnectValue; private static final long serialVersionUID = 1L; public graph gg = new graph(); public graph g = new graph(); private static GameClient socketClient; private GameServer socketServer; public static void main(int width, int height) { PlayerNames tt = new PlayerNames(); // PlayerGraphics t = new PlayerGraphics(); tt.setSize(width, height); if (Game.ServerOwner == 1) { tt.setTitle("Server: " + Game.username); } else { tt.setTitle("Username: " + Game.username); } tt.setVisible(true); tt.getContentPane().add(tt.gg); tt.getContentPane().add(tt.g); tt.setDefaultCloseOperation(EXIT_ON_CLOSE); tt.setResizable(false); }

  Read the article

• Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

  - by jboyd

  Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

  Read the article

• SQL Server architecture guidance

  - by Liam

  Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

  Read the article

• Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

  - by Nailuj

  I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

  Read the article

• Fixed strptime exception with thread lock, but slows down the program

  - by eWizardII

  I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

  Read the article

• Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

  - by Pickels

  Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

  Read the article

• Across process marhalling problem with an array of points

  - by ElMagn

  Hi All, We have what we think is a marshalling problem with a renderer object when called across process boundaries. The renderer is an ATL COM server with a COM object that implements the IPoints interface defined below: typedef [uuid(B0E01719-005A-427c-B9DD-B42A18E969AE)] struct Point { double X; double Y; } Point; [ object, uuid(3BFECFE3-B4FB-4f14-8257-6E065D02E3B3), helpstring("IPoints Interface"), dual, ] interface IPoints : IDispatch { HRESULT DrawPolyLine([in] long hDC, [in] short count, [in, size_is(count)] Point * points ); // many more like DrawLine } The count parameter represents the number of points and the points parameter represents an array of the actual points. We have two process running, a graphical display process (GDP) and a tabular (grid) display process (TDP). A factory in the GDP, written in C#, creates the renderer and the clients of the renderer in the GDP. When the clients call into the renderer, everything displays correctly. The renderer is created at start up BTW. There is another factory in the TDP, written in VB6, that calls into the factory in the GDP to create the clients. When the clients call into the renderer, only the first point in the array is marshaled correctly, all the other points are garbage. Seems that the rendering works only when the client creation is started from the same process as the renderer. Now, i am not sure what the solution to this problem is. It seems that if we can guarantee that the clients are always created from a thread in the same GDP process as the renderer then the points are marshaled correctly. We tried using a background thread from the Thread Pool in C# and it indeed worked. The problem is that Windows Forms created from the clients stopped working because accessing the form's controls from a thread other than the thread that created the control is not allowed. We might change the calls to access the forms but we have quite a few of them and are trying to look into a different solution that might involve making changes to the renderer. The other problem is that the renderer is legacy code and we can't just change the interface. I am wondering what can we do to the renderer's interface that would help with marshalling from across process calls. Any ideas would be greatly appreciated. Regards, ElMagn

  Read the article

• how do i know how many clients are calling my WCF service function

  - by ZhengZhiren

  i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Change HttpContext.Request.InputStream

  - by user320478

  I am getting lot of errors for HttpRequestValidationException in my event log. Is it possible to HTMLEncode all the inputs from override of ProcessRequest on web page. I have tried this but it gives context.Request.InputStream.CanWrite == false always. Is there any way to HTMLEncode all the feilds when request is made? public override void ProcessRequest(HttpContext context) { if (context.Request.InputStream.CanRead) { IEnumerator en = HttpContext.Current.Request.Form.GetEnumerator(); while (en.MoveNext()) { //Response.Write(Server.HtmlEncode(en.Current + " = " + //HttpContext.Current.Request.Form[(string)en.Current])); } long nLen = context.Request.InputStream.Length; if (nLen > 0) { string strInputStream = string.Empty; context.Request.InputStream.Position = 0; byte[] bytes = new byte[nLen]; context.Request.InputStream.Read(bytes, 0, Convert.ToInt32(nLen)); strInputStream = Encoding.Default.GetString(bytes); if (!string.IsNullOrEmpty(strInputStream)) { List<string> stream = strInputStream.Split('&').ToList<string>(); Dictionary<int, string> data = new Dictionary<int, string>(); if (stream != null && stream.Count > 0) { int index = 0; foreach (string str in stream) { if (str.Length > 3 && str.Substring(0, 3) == "txt") { string textBoxData = str; string temp = Server.HtmlEncode(str); //stream[index] = temp; data.Add(index, temp); index++; } } if (data.Count > 0) { List<string> streamNew = stream; foreach (KeyValuePair<int, string> kvp in data) { streamNew[kvp.Key] = kvp.Value; } string newStream = string.Join("", streamNew.ToArray()); byte[] bytesNew = Encoding.Default.GetBytes(newStream); if (context.Request.InputStream.CanWrite) { context.Request.InputStream.Flush(); context.Request.InputStream.Position = 0; context.Request.InputStream.Write(bytesNew, 0, bytesNew.Length); //Request.InputStream.Close(); //Request.InputStream.Dispose(); } } } } } } base.ProcessRequest(context); }

  Read the article

• div popup inside td

  - by sims

  I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

  Read the article

• basic operations for modifying a source document with XSLT

  - by SpliFF

  All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

  Read the article

• Calculate minimum moves to solve a puzzle

  - by Luke

  I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

  Read the article

• PHP array pointer craziness

  - by JMan

  I'm trying to create a "GetCurrentLevel" method that takes a point value as an input and returns what "Level" that corresponds to. I'm storing the Level = Points mapping in an array, but the array pointer is not moving logically when I use it a foreach loop. I've added echo statements for debugging. Here's my class definition: class Levels extends Model { protected $_map = array ( 'None' => 0, 'Bronze' => 50, 'Silver' => 200, 'Gold' => 500 ); public function __construct() { parent::__construct(); } public function GetCurrentLevel($points) { foreach ($this->_map as $name => $threshold) { echo "Level Name: $name<br/>"; echo "Level Threshold: $threshold<br/>"; echo "Current Level: " . key($this->_map) . "<br/>"; echo "Current Threshold: " . current($this->_map) . "<br/>"; if ($points < $threshold) /* Threshold is now above the points, so need to go back one level */ { $previousThreshold = prev($this->_map); echo "Previous Threshold: $previousThreshold<br/>"; echo "Final Level: " . key($this->_map) . "<br/>"; return key($this->_map); } echo "Go to next level <br/>"; } } And here is what I see when I call GetCurrentLevel(60): Level Name: None Level Threshold: 0 Current Level: Bronze //* Looks like foreach immediately moves the array pointer *// Current Threshold: 50 Go to next level Level Name: Bronze Level Threshold: 50 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Go to next level Level Name: Silver Level Threshold: 200 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Previous Threshold: 0 Final Level: None But the "Final Level" should be 'Bronze' since 60 points is above the 50 points needed for a Bronze medal, but below the 200 points needed for a Silver medal. Sorry for the long post. Thanks for your help!

  Read the article

• Generic Type constraint in .net

  - by Jose

  Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

  Read the article

• Android Notification with AlarmManager, Broadcast and Service

  - by user2435829

  this is my code for menage a single notification: myActivity.java public class myActivity extends Activity { protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.mylayout); cal = Calendar.getInstance(); // it is set to 10.30 cal.set(Calendar.HOUR, 10); cal.set(Calendar.MINUTE, 30); cal.set(Calendar.SECOND, 0); long start = cal.getTimeInMillis(); if(cal.before(Calendar.getInstance())) { start += AlarmManager.INTERVAL_FIFTEEN_MINUTES; } Intent mainIntent = new Intent(this, myReceiver.class); pIntent = PendingIntent.getBroadcast(this, 0, mainIntent, PendingIntent.FLAG_UPDATE_CURRENT); AlarmManager myAlarm = (AlarmManager)getSystemService(ALARM_SERVICE); myAlarm.setRepeating(AlarmManager.RTC_WAKEUP, start, AlarmManager.INTERVAL_FIFTEEN_MINUTES, pIntent); } } myReceiver.java public class myReceiver extends BroadcastReceiver { @Override public void onReceive(Context c, Intent i) { Intent myService1 = new Intent(c, myAlarmService.class); c.startService(myService1); } } myAlarmService.java public class myAlarmService extends Service { @Override public IBinder onBind(Intent arg0) { return null; } @Override public void onCreate() { super.onCreate(); } @SuppressWarnings("deprecation") @Override public void onStart(Intent intent, int startId) { super.onStart(intent, startId); displayNotification(); } @Override public void onDestroy() { super.onDestroy(); } public void displayNotification() { Intent mainIntent = new Intent(this, myActivity.class); PendingIntent pIntent = PendingIntent.getActivity(this, 0, mainIntent, PendingIntent.FLAG_UPDATE_CURRENT); NotificationManager nm = (NotificationManager) this.getSystemService(Context.NOTIFICATION_SERVICE); Notification.Builder builder = new Notification.Builder(this); builder.setContentIntent(pIntent) .setAutoCancel(true) .setSmallIcon(R.drawable.ic_noti) .setTicker(getString(R.string.notifmsg)) .setContentTitle(getString(R.string.app_name)) .setContentText(getString(R.string.notifmsg)); nm.notify(0, builder.build()); } } AndroidManifest.xml <uses-permission android:name="android.permission.WAKE_LOCK" /> ... ... ... <service android:name=".myAlarmService" android:enabled="true" /> <receiver android:name=".myReceiver"/> IF the time has NOT past yet everything works perfectly. The notification appears when it must appear. BUT if the time HAS past (let's assume it is 10.31 AM) the notification fires every time... when I close and re-open the app, when I click on the notification... it has a really strange behavior. I can't figure out what's wrong in it. Can you help me please (and explain why, if you find a solution), thanks in advance :)

  Read the article

• php connecting to mysql server(localhost) very slow

  - by Ahmad

  actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

  Read the article

• Creating multiple heads in remote repository

  - by Jab

  We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

  Read the article

• How does your team work together in a remote setup?

  - by Carl Rosenberger

  Hi, we are a distributed team working on the object database db4o. The way we work: We try to program in pairs only. We use Skype and VNC or SharedView to connect and work together. In our online Tuesday meeting every week (usually about 1 hour) we talk about the tasks done last week we create new pairs for the next week with a random generator so knowledge and friendship distribute evenly we set the priority for any new tasks or bugs that have come in each team picks the tasks it likes to do from the highest prioritized ones. From Tuesday to Wednesday we estimate tasks. We have a unit of work we call "Ideal Developer Session" (IDS), maybe 2 or 3 hours of working together as a pair. It's not perfectly well defined (because we know estimation always is inaccurate) but from our past shared experience we have a common sense of what an IDS is. If we can't estimate a task because it feels too long for a week we break it down into estimatable smaller tasks. During a short meeting on Wednesday we commit to a workload we feel is well doable in a week. We commit to complete. If a team runs out of committed tasks during the week, it can pick new ones from the prioritized queue we have in Jira. When we started working this way, some of us found that remote pair programming takes a lot of energy because you are so focussed. If you pair program for more than 5 or 6 hours per day, you get drained. On the other hand working like this has turned out to be very efficient. The knowledge about our codebase is evenly distributed and we have really learnt lots from eachother. I would be very interested to hear about the experiences from other teams working in a similar way. Things like: How often do you meet? Have you tried different sprint lengths (one week, two week, longer) ? Which tools do you use? Which issue tracker do you use? What do you do about time zone differences? How does it work for you to integrate new people into the team? How many hours do you usually work per week? How does your management interact with the way you are working? Do you get put on a waterfall with hard deadlines? What's your unit of work? What is your normal velocity? (units of work done per week) Programming work should be fun and for us it usually is great fun. I would be happy about any new ideas how to make it even more fun and/or more efficient.

  Read the article

• Maximum nametable char count exceeded

  - by doc

  I'm having issues with the maximum nametable char count quota, I followed a couple of answers here and it solved the problem for a while, but now I'm having the same issue. My Server side config is as follows: <system.serviceModel> <bindings> <netTcpBinding> <binding name="GenericBinding" maxBufferPoolSize="2147483647" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> <security mode="None" /> </binding> </netTcpBinding> </bindings> <behaviors> <serviceBehaviors> <behavior> <serviceMetadata httpGetEnabled="false" /> <serviceDebug includeExceptionDetailInFaults="true" /> <dataContractSerializer maxItemsInObjectGraph="1000000" /> </behavior> </serviceBehaviors> </behaviors> <services> <service name="REMWCF.RemWCFSvc"> <endpoint address="" binding="netTcpBinding" contract="REMWCF.IRemWCFSvc" bindingConfiguration="GenericBinding" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:9081/RemWCFSvc" /> </baseAddresses> </host> </service> </services> </system.serviceModel> I also have the same tcp binding on the devenv configuration. Have I reached the limit of contracts supported? Is there a way to turn off that quota? EDIT Error Message: Error: Cannot obtain Metadata from net.tcp://localhost:9081/RemWCFSvc/mex If this is a Windows (R) Communication Foundation service to which you have access, please check that you have enabled metadata publishing at the specified address. For help enabling metadata publishing, please refer to the MSDN documentation at http://go.microsoft.com/fwlink/?LinkId=65455.WS-Metadata Exchange Error URI: net.tcp://localhost:9081/RemWCFSvc/mex Metadata contains a reference that cannot be resolved: 'net.tcp://localhost:9081/RemWCFSvc/mex'. There is an error in the XML document. The maximum nametable character count quota (16384) has been exceeded while reading XML data. The nametable is a data structure used to store strings encountered during XML processing - long XML documents with non-repeating element names, attribute names and attribute values may trigger this quota. This quota may be increased by changing the MaxNameTableCharCount property on the XmlDictionaryReaderQuotas object used when creating the XML reader. I'm getting that error when trying to run the WCF (which is hosted in a windows service app).

  Read the article

< Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >