Search Results

Search found 18092 results on 724 pages for 'matt long'.

Page 670/724 | < Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >

  • weird performance in C++ (VC 2010)

    - by raicuandi
    Hello, I have this loop written in C++, that compiled with MSVC2010 takes a long time to run. (300ms) for (int i=0; i<h; i++) { for (int j=0; j<w; j++) { if (buf[i*w+j] > 0) { const int sy = max(0, i - hr); const int ey = min(h, i + hr + 1); const int sx = max(0, j - hr); const int ex = min(w, j + hr + 1); float val = 0; for (int k=sy; k < ey; k++) { for (int m=sx; m < ex; m++) { val += original[k*w + m] * ds[k - i + hr][m - j + hr]; } } heat_map[i*w + j] = val; } } } It seemed a bit strange to me, so I did some tests then changed a few bits to inline assembly: (specifically, the code that sums "val") for (int i=0; i<h; i++) { for (int j=0; j<w; j++) { if (buf[i*w+j] > 0) { const int sy = max(0, i - hr); const int ey = min(h, i + hr + 1); const int sx = max(0, j - hr); const int ex = min(w, j + hr + 1); __asm { fldz } for (int k=sy; k < ey; k++) { for (int m=sx; m < ex; m++) { float val = original[k*w + m] * ds[k - i + hr][m - j + hr]; __asm { fld val fadd } } } float val1; __asm { fstp val1 } heat_map[i*w + j] = val1; } } } Now it runs in half the time, 150ms. It does exactly the same thing, but why is it twice as quick? In both cases it was run in Release mode with optimizations on. Am I doing anything wrong in my original C++ code?

    Read the article

  • mysql: can't set max_allowed_package to anything grater than 16MB

    - by sas
    I'm not sure if this is the right place to post these kind of questions, if it's not so, please (politely) let me know... :-) I need to save files greater than 16MB on a mysql database from a php site... I've already changed the c:\xampp\mysql\bin\my.cnf and set max_allowed_packet to 16 MB, and everything worked fine then I set it to 32 MB but there´s no way I can handle a file bigger than 16 MB I get the following error: 'MySQL server has gone away' (the same error I had when max_allowed_packet was set to 1MB) there must be some other setting that doesn´t allow me to handle files bigger than 16MB maybe the php client, I guess, but I don't know where to edit it this is the code I'm running when file.txt is smaller than 16.776.192 bytes long, it works fine, but if file.txt has 16.777.216 bytes i get the aforementioned error oh, and the field download.content is a longblob... $file = 'file.txt'; $file_handle = fopen( $file, 'r' ); $content = fread( $file_handle, filesize( $file ) ); fclose( $file_handle ); db_execute( 'truncate table download', true ); $sql = "insert into download( code, title, name, description, original_name, mime_type, size, content, user_insert_id, date_insert, user_update_id, date_update ) values ( 'new file', 'new file', 'sas.jpg', 'new file', '$file', 'mime', " . filesize( $file ) . ", '" . addslashes( $content ) . "', 0, " . db_char_to_sql( now_char(), 'datetime' ) . ", 0, " . db_char_to_sql( now_char(), 'datetime' ) . " )"; db_execute( $sql, true ); (the db_execute funcion just opens the connections and executes the sql stuff) running on windows XP sp2 server version: 5.0.67-community PHP Version 4.4.9 mysql client API version: 3.23.49 using: ApacheFriends XAMPP (Basispaket) version 1.6.8 that comes with + Apache 2.2.9 + MySQL 5.0.67 (Community Server) + PHP 5.2.6 + PHP 4.4.9 + PEAR + phpMyAdmin 2.11.9.2 ... this is part of the content of c:\xampp\mysql\bin\my.cnf # The MySQL server [mysqld] port= 3306 socket= "C:/xampp/mysql/mysql.sock" basedir="C:/xampp/mysql" tmpdir="C:/xampp/tmp" datadir="C:/xampp/mysql/data" skip-locking key_buffer = 16M # max_allowed_packet = 1M max_allowed_packet = 32M table_cache = 128 sort_buffer_size = 512K net_buffer_length = 8K read_buffer_size = 256K read_rnd_buffer_size = 512K myisam_sort_buffer_size = 8M

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Loading the last related record instantly for multiple parent records using Entity framework

    - by Guillaume Schuermans
    Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • PHP Regex: How to match anything except a pattern between two tags

    - by Ryan
    Hello, I am attempting to match a string which is composed of HTML. Basically it is an image gallery so there is a lot of similarity in the string. There are a lot of <dl> tags in the string, but I am looking to match the last <dl>(.?)+</dl> combo that comes before a </div>. The way I've devised to do this is to make sure that there aren't any <dl's inside the <dl></dl> combo I'm matching. I don't care what else is there, including other tags and line breaks. I decided I had to do it with regular expressions because I can't predict how long this substring will be or anything that's inside it. Here is my current regex that only returns me an array with two NULL indicies: preg_match_all('/<dl((?!<dl).)+<\/dl>(?=<\/div>)/', $foo, $bar) As you can see I use negative lookahead to try and see if there is another <dl> within this one. I've also tried negative lookbehind here with the same results. I've also tried using +? instead of just + to no avail. Keep in mind that there's no pattern <dl><dl></dl> or anything, but that my regex is either matching the first <dl> and the last </dl> or nothing at all. Now I realize . won't match line breaks but I've tried anything I could imagine there and it still either provides me with the NULL indicies or nearly the whole string (from the very first occurance of <dl to </dl></div>, which includes several other occurances of <dl>, exactly what I didn't want). I honestly don't know what I'm doing incorrectly. Thanks for your help! I've spent over an hour just trying to straighten out this one problem and it's about driven me to pulling my hair out.

    Read the article

  • Accordion nonfunctional in Opera

    - by nona
    While working as expected in all other browsers, opera refuses to tween the height of content. oddly enough, as i sat annoyed rapidly clicking it over and over again, if it's closed, and you select some text, and keep clicking the same spot long enough, sometimes it pops open. lol. seriously. ahh, it seems to sometimes open the first time clicked after the page is loaded. wth? the javascript: window.addEvent('domready', function(){ var content_height = [];i=0; $$( '.bio_accordion' ).each(function(item){ i++; content_height.push(item.getElement('.moreInfo').offsetHeight); var thisSlider = new Fx.Slide( item.getElement( '.moreInfo' ), { mode: 'horizontal' } ); thisSlider.hide(); item.getElement('.moreInfo').set('tween').tween('height', '0px'); var morph = new Fx.Morph(item.getElement( '.divToggle' )); var selected = 0; item.getElement( '.divToggle' ).addEvents({ 'mouseenter': function(){ if(!selected) this.morph('.div_highlight'); }, 'mouseleave': function(){ if(!selected) { this.morph('.divToggle'); } }, 'click': function(){ if (!selected){ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; item.getElement('.moreInfo').set('tween', { duration: 1500, transition: Fx.Transitions.Bounce.easeOut }).tween('height', content_height[i]); selected = 1; thisSlider.slideIn(); } else{ if (this.getElement('.symbol').innerHTML == '+') this.getElement('.symbol').innerHTML = '-'; else this.getElement('.symbol').innerHTML = '+'; thisSlider.slideOut(); item.getElement('.moreInfo').set('tween', { duration: 1000, transition: Fx.Transitions.Bounce.easeOut }).tween('height', '0px'); selected = 0; } } }); } ); }); the html: <div class="bio_accordion"> <div class="divToggle">test<span class="symbol">-</span></div> <div class="moreInfo" style="margin-left:10px;"> aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa asdfasdfasdfasdfasdfasdfasdfasdfasdfasdfasdf aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa asdfasdfasdfasdfasdfasdfasdfasdfasdfasdfasdf aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa asdfasdfasdfasdfasdfasdfasdfasdfasdfasdfasdf </div> </div> the css: .bio_accordion { padding:0px; margin:0px; } .divToggle { cursor: pointer; color: #ffffff; background-color:#1089b5; padding: 8px; } .div_highlight { padding-left:30px; padding-right:30px; background-color:#096687; } .moreInfo { padding: 2px; padding-top:15px; padding-bottom:15px; overflow: hidden; } .symbol { float:right; }

    Read the article

  • Across process marhalling problem with an array of points

    - by ElMagn
    Hi All, We have what we think is a marshalling problem with a renderer object when called across process boundaries. The renderer is an ATL COM server with a COM object that implements the IPoints interface defined below: typedef [uuid(B0E01719-005A-427c-B9DD-B42A18E969AE)] struct Point { double X; double Y; } Point; [ object, uuid(3BFECFE3-B4FB-4f14-8257-6E065D02E3B3), helpstring("IPoints Interface"), dual, ] interface IPoints : IDispatch { HRESULT DrawPolyLine([in] long hDC, [in] short count, [in, size_is(count)] Point * points ); // many more like DrawLine } The count parameter represents the number of points and the points parameter represents an array of the actual points. We have two process running, a graphical display process (GDP) and a tabular (grid) display process (TDP). A factory in the GDP, written in C#, creates the renderer and the clients of the renderer in the GDP. When the clients call into the renderer, everything displays correctly. The renderer is created at start up BTW. There is another factory in the TDP, written in VB6, that calls into the factory in the GDP to create the clients. When the clients call into the renderer, only the first point in the array is marshaled correctly, all the other points are garbage. Seems that the rendering works only when the client creation is started from the same process as the renderer. Now, i am not sure what the solution to this problem is. It seems that if we can guarantee that the clients are always created from a thread in the same GDP process as the renderer then the points are marshaled correctly. We tried using a background thread from the Thread Pool in C# and it indeed worked. The problem is that Windows Forms created from the clients stopped working because accessing the form's controls from a thread other than the thread that created the control is not allowed. We might change the calls to access the forms but we have quite a few of them and are trying to look into a different solution that might involve making changes to the renderer. The other problem is that the renderer is legacy code and we can't just change the interface. I am wondering what can we do to the renderer's interface that would help with marshalling from across process calls. Any ideas would be greatly appreciated. Regards, ElMagn

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Sessions not persisting between requests

    - by klonq
    My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • How do I handle the Maybe result of at in Control.Lens.Indexed without a Monoid instance

    - by Matthias Hörmann
    I recently discovered the lens package on Hackage and have been trying to make use of it now in a small test project that might turn into a MUD/MUSH server one very distant day if I keep working on it. Here is a minimized version of my code illustrating the problem I am facing right now with the at lenses used to access Key/Value containers (Data.Map.Strict in my case) {-# LANGUAGE OverloadedStrings, GeneralizedNewtypeDeriving, TemplateHaskell #-} module World where import Control.Applicative ((<$>),(<*>), pure) import Control.Lens import Data.Map.Strict (Map) import qualified Data.Map.Strict as DM import Data.Maybe import Data.UUID import Data.Text (Text) import qualified Data.Text as T import System.Random (Random, randomIO) newtype RoomId = RoomId UUID deriving (Eq, Ord, Show, Read, Random) newtype PlayerId = PlayerId UUID deriving (Eq, Ord, Show, Read, Random) data Room = Room { _roomId :: RoomId , _roomName :: Text , _roomDescription :: Text , _roomPlayers :: [PlayerId] } deriving (Eq, Ord, Show, Read) makeLenses ''Room data Player = Player { _playerId :: PlayerId , _playerDisplayName :: Text , _playerLocation :: RoomId } deriving (Eq, Ord, Show, Read) makeLenses ''Player data World = World { _worldRooms :: Map RoomId Room , _worldPlayers :: Map PlayerId Player } deriving (Eq, Ord, Show, Read) makeLenses ''World mkWorld :: IO World mkWorld = do r1 <- Room <$> randomIO <*> (pure "The Singularity") <*> (pure "You are standing in the only place in the whole world") <*> (pure []) p1 <- Player <$> randomIO <*> (pure "testplayer1") <*> (pure $ r1^.roomId) let rooms = at (r1^.roomId) ?~ (set roomPlayers [p1^.playerId] r1) $ DM.empty players = at (p1^.playerId) ?~ p1 $ DM.empty in do return $ World rooms players viewPlayerLocation :: World -> PlayerId -> RoomId viewPlayerLocation world playerId= view (worldPlayers.at playerId.traverse.playerLocation) world Since rooms, players and similar objects are referenced all over the code I store them in my World state type as maps of Ids (newtyped UUIDs) to their data objects. To retrieve those with lenses I need to handle the Maybe returned by the at lens (in case the key is not in the map this is Nothing) somehow. In my last line I tried to do this via traverse which does typecheck as long as the final result is an instance of Monoid but this is not generally the case. Right here it is not because playerLocation returns a RoomId which has no Monoid instance. No instance for (Data.Monoid.Monoid RoomId) arising from a use of `traverse' Possible fix: add an instance declaration for (Data.Monoid.Monoid RoomId) In the first argument of `(.)', namely `traverse' In the second argument of `(.)', namely `traverse . playerLocation' In the second argument of `(.)', namely `at playerId . traverse . playerLocation' Since the Monoid is required by traverse only because traverse generalizes to containers of sizes greater than one I was now wondering if there is a better way to handle this that does not require semantically nonsensical Monoid instances on all types possibly contained in one my objects I want to store in the map. Or maybe I misunderstood the issue here completely and I need to use a completely different bit of the rather large lens package?

    Read the article

  • Calculate minimum moves to solve a puzzle

    - by Luke
    I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

    Read the article

  • How can I combine xsl:attribute and xsl:use-attribute-sets to conditionally use an attribute set?

    - by Peter
    We have an xml node "item" with an attribute "style", which is "Header1". This style can change however. We have an attribute set named Header1 which defines how this should look in a PDF, generated through xsl:fo. This works (the use-attribute-sets is mentioned inline, in the fo:table-cell node): <xsl:template match="item[@type='label']"> <fo:table-row> <fo:table-cell xsl:use-attribute-sets="Header1"> <fo:block> <fo:inline font-size="8pt" > <xsl:value-of select="." /> </fo:inline> </fo:block> </fo:table-cell> </fo:table-row> </xsl:template> But this doesn't (using xsl:attribute, because the attribute @style can also be Header2 for example). It doesn't generate an error, the PDF is created, but the attributes aren't applied. <xsl:template match="item[@type='label']"> <fo:table-row> <fo:table-cell> <xsl:attribute name="xsl:use-attribute-sets"> <xsl:value-of select="@style" /> </xsl:attribute> <fo:block> <fo:inline font-size="8pt" > <xsl:value-of select="." /> </fo:inline> </fo:block> </fo:table-cell> </fo:table-row> </xsl:template> Does anyone know why? And how we could achieve this, preferably without long xsl:if or xsl:when stuff?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

    - by Pickels
    Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

    Read the article

  • Recommended ASP.NET Shared Hosting

    - by coffeeaddict
    Ok, I have to admit I'm getting fed up with www.discountasp.net's pricing model and this annoyance has built up over the past 8 years or so. I've been with them for years and absolutely love them on the technical side, however it's getting ridiculously expensive for so little that you get. I mean here's my scenario: 1) I am running 2 SQL Server databases which costs me $10/ea per month so that's $20/month for 2 and I only get 500 mb disk space which is horrible 2) I am paying $10/mo just for the hosting itself which I only get 1 gig of disk space! I mean common! 3) I am simply running 2 small apps (Screwturn Wiki & Subtext Blog)...so I don't really care if it's up 99% or not, it's not worth paying a total of $300 just to keep these 2 apps running over discountasp.net Anyone else feel the same? Yes, I know they have great support, probably have great servers running behind this but in the end I really don't care as long as my site is up 95% or better. Yes, the hosting toolset rocks. But you know I bet you I can find a similar set somewhere else. I like how I can totally control IIS 7 at discountasp and I can control my own app pool etc. That's very powerful and essential. But anyone have any good alternatives to discountasp that gives me close to the same at a much more reasonable cost point? I mean http://www.m6.net/prices.aspx gives you 10 SQL Databases for $7 and 200 gigs disk space! I don't know about their tools or support but just looking at those numbers and some other hosts I've seen, I feel that discountasp.net is way out of line. They don't even offer any purchasing discounts such as it would be nice if my 2nd SQL Server is only $5/month not $10...stuff like this, to make it much more realistic and fair. Opinions (people who do have discountasp.net, people who have left them, or people who have another host they like)??? But geez $300 just to host a couple DBs and lightweight open source apps? Not worth the price they are charging. I'm almost at a price point that enables me to get a decent dedicated server! I really don't care about beta support. Not a big deal to me.

    Read the article

  • How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

    - by Paul Chernoch
    I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

    Read the article

  • Jquery-UI tabs : Double loading of the default tab with

    - by Stephane
    I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

    Read the article

  • PHP array pointer craziness

    - by JMan
    I'm trying to create a "GetCurrentLevel" method that takes a point value as an input and returns what "Level" that corresponds to. I'm storing the Level = Points mapping in an array, but the array pointer is not moving logically when I use it a foreach loop. I've added echo statements for debugging. Here's my class definition: class Levels extends Model { protected $_map = array ( 'None' => 0, 'Bronze' => 50, 'Silver' => 200, 'Gold' => 500 ); public function __construct() { parent::__construct(); } public function GetCurrentLevel($points) { foreach ($this->_map as $name => $threshold) { echo "Level Name: $name<br/>"; echo "Level Threshold: $threshold<br/>"; echo "Current Level: " . key($this->_map) . "<br/>"; echo "Current Threshold: " . current($this->_map) . "<br/>"; if ($points < $threshold) /* Threshold is now above the points, so need to go back one level */ { $previousThreshold = prev($this->_map); echo "Previous Threshold: $previousThreshold<br/>"; echo "Final Level: " . key($this->_map) . "<br/>"; return key($this->_map); } echo "Go to next level <br/>"; } } And here is what I see when I call GetCurrentLevel(60): Level Name: None Level Threshold: 0 Current Level: Bronze //* Looks like foreach immediately moves the array pointer *// Current Threshold: 50 Go to next level Level Name: Bronze Level Threshold: 50 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Go to next level Level Name: Silver Level Threshold: 200 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Previous Threshold: 0 Final Level: None But the "Final Level" should be 'Bronze' since 60 points is above the 50 points needed for a Bronze medal, but below the 200 points needed for a Silver medal. Sorry for the long post. Thanks for your help!

    Read the article

< Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >