Search Results

Search found 31578 results on 1264 pages for 'javascript functions'.

Page 673/1264 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • How to get exactly typeof is object/array/null..?

    - by 3gwebtrain
    var obj = {},ar = [],nothing=null,empty=undefined,word ='string',headorTail = true; console.log(typeof obj) //object console.log(typeof ar)//object console.log(typeof nothing)//object console.log(typeof empty)//undefined console.log(typeof word)//string console.log(typeof headorTail)//boolean But how can i get the type of obj,ar,nothing as "object, array,null" - what is the best way to achieve this?

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • jQuery: Writing jquery in an object oriented way

    - by anoopkattodi
    Hi all, I am trying to write all my query code in an object oriented way. But I don't know how to implement this for each click function and hover function etc. I also wanted to know: What are the advantages of writing query in object oriented way? For query what is better the object oriented way or in the ordinary way?

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • Setting CSS attributes on Change using jQuery

    - by Nick B
    I want to change css visibility and display attributes using jQuery on click when the state of another div's visibility attribute changes. (Many apologies for the obfuscated markup, but needing to manipulate someone else's construction): There are four instances of [data-label="Checkbox"] [data-label="Checked"] in this page. I want to set [data-label="trash"] and [data-label="Sort Options"] to visibility: visible; display: [empty value] when any of the [data-label="Checkbox"] [data-label="Checked"]'s attributes changes to 'visibility', 'visible'. Else, if none of [data-label="Checkbox"] [data-label="Checked"]'s have the attribute 'visibility', 'visible', I want to set [data-label="trash"] and [data-label="Sort Options"] back to their initial states: display: none; visibility: hidden;. Here's the markup: <div data-label="Sort Options" style="display: none; visibility: hidden;"> <div data-label="trash" style="display: none; visibility: hidden;"></div> </div> <div data-label="Checkbox"> <div data-label="Unchecked"></div> <div data-label="Checked" style="display: none; visibility: hidden;"></div> </div> Here is what I have tried unsuccessfully: $('[data-label="Checkbox"]').click(function() { if ('[data-label="Checkbox"] [data-label="Checked"]').css('visibility', 'visible') { $('[data-label="trash"], [data-label="Sort Options"]').css({'display': '', 'visibility': 'visible'}); } else { $('[data-label="trash"], [data-label="Sort Options"]').css({'display': 'none', 'visibility': 'hidden'}); } }); Any help would be greatly appreciated! Thanks

    Read the article

  • ANy way to fix the position of image

    - by Mirage
    I have an image on the left hand side and text on right side. Like two column layout. I want that when i scroll the text then the image should stay at center of page. I tried using position:fixed But then the problem , sometimes when i resize the IE window to small size then the image stay at same position and it comes out of the main content area when i scroll down. I want that image should scroll but should stay within the content area . It should not move outsid ethe main content aqrea

    Read the article

  • Disregard a particular TD element

    - by RussellDias
    Below I have the code that allows me to edit a table row inline. However it edits ALL of the TDs within that row. My problem, along with the code, are stated below. Any help is appreciated. <tbody> <tr> <th scope="row">Test</th> <td class="amount">$124</td> <td class="amount" id="" >$154</td> <td class="diff">- 754</td> </tr> </tbody> The above table is just a sample. What I have been trying to accomplish is, to simply edit the TDs within that particular row, but I need it to disregard the diff TD. I'm fairly new to jQuery and have got the following code via the help of a jQuery book. $(document).ready(function() { TABLE.formwork('#current-expenses'); }); var TABLE = {}; TABLE.formwork = function(table){ var $tables = $(table); $tables.each(function () { var _table = $(this); _table.find('thead tr').append($('<th class="edit">&nbsp;</th>')); _table.find('tbody tr').append($('<td class="edit"><input type="button" value="Edit"/></td>')) }); $tables.find('.edit :button').live('click', function(e) { TABLE.editable(this); e.preventDefault(); }); } TABLE.editable = function(button) { var $button = $(button); var $row = $button.parents('tbody tr'); var $cells = $row.children('td').not('.edit'); if($row.data('flag')) { // in edit mode, move back to table // cell methods $cells.each(function () { var _cell = $(this); _cell.html(_cell.find('input').val()); }) $row.data('flag',false); $button.val('Edit'); } else { // in table mode, move to edit mode // cell methods $cells.each(function() { var _cell = $(this); _cell.data('text', _cell.html()).html(''); if($('td.diff')){ var $input = $('<input type="text" />') .val(_cell.data('text')) .width(_cell.width() - 16); _cell.append($input); } }) $row.data('flag', true); $button.val('Save'); } } I have attempted to alter the code so that it would disregard the diff class TD, but have had no luck so far.

    Read the article

  • ADO Execute not reading a line of SQL code?

    - by llaskin
    My code is below: var statement = "test_oracle.sql"; F = aqFile.OpenTextFile(statement, aqFile.faRead, aqFile.ctANSI); F.Cursor = 0; while(! F.IsEndOfFile()){ s = F.ReadLine(); oResult = Project.Variables.oConnection.Execute_(s); CheckResult(oResult, "Unable to run SQL script to add documents"); The first line that "s" reads is: set serverout on size 10000 An error is returned as "ORA-00922: missing or invalid option" Can anyone provide guidance?

    Read the article

  • jQuery code works in Chrome, not in IE9

    - by Francis Ducharme
    Pretty new to jQuery here, I've got a chunk of code that works OK in Chrome, but fails in IE9 (have not tried FF yet). Here's the code: var textColor = $('#navmenu-body').css('color'); textColor = textColor.slice(4); In IE9, I get an error to the effect that slice can't be called because textColor is undefined. I was not sure if it's because jQuery just can't find the #navmenu-body element or that it can't find the CSS attribute color. So I did: var j = $('#navmenu-body'); var textColor = $('#navmenu-body').css('color'); textColor = textColor.slice(4); In IE9's console, j.length returns 0. So the selector is indeed, not working Here's the #navmenu-body HTML DOM <div id="navmenu-body" class="x-panel-body x-panel-body-cssmenu x-layout-fit x-panel-body-cssmenu" style="height: 398px; left: 0px; top: 0px; width: 200px;"> </div> Do I need to do something else for IE9 support ?

    Read the article

  • "Zooming" elements on a page while keeping the centre of enlargement in the centre of the window

    - by Acorn
    I'm trying to work out how to enlarge all elements on a page, but keep the centre of enlargement in the centre of the window. Example Page (up and down arrows to resize the image, you can also drag the image around) On this page, once the image reaches the top or the left side of the window the centre of enlargement changes. It also changes when you move the image. (exactly what you would expect) I'm thinking I'd need to take a completely different approach to achieve what I want. But I'm not sure what that approach is.. Any ideas?

    Read the article

  • require.js - How can I set a version on required modules as part of the URL?

    - by Ovesh
    I am using require.js to require JS modules in my application. I need a way to bust client cache on new JS modules, by way of a different requested URL. i.e., if the file hello/there.js has already been cached on the client, I can change the file name to force the browser to get the new file. In other words, for the module hello/there, I'd like require.js to request the url hello/there___v1234___.js (the file name can look different, it's just an example), according to a version string which is accessible on the client. What is the best way to achieve that?

    Read the article

  • Is it possible (and how) to remove unutilized widgets from Ext JS library?

    - by Kabeer
    Hello. Ext JS base and widgets together offer me the solution I've been looking for. The Ext JS library is somewhat heavy w.r.t. conventional standards. There are several widgets in the library that I am not using. So I want to know if it is possible to remove the corresponding code (of widgets not being used) from the ext-all.js ? To put it in other words, is it possible to compose a master Java Script of Ext JS that comprises of only the widgets of my interest? If there is a way I'd love to know.

    Read the article

  • How do i Convert a Select to a Checkbox

    - by streetparade
    That sounds pretty odd but i have this cod and i need to convert it to checkbox, with the same functionalities <select onchange="document.getElementById('reasonDiv{$test->id}').style.display = ''; document.getElementById('reason{$test->id}').value = this.value;" name='reasonId{$test->id}' id='reasonId{$test->id}'> <option value=''>Test</option> {foreach item=test from=$testtmp.6} <input type="checkbox" value='{include file='testen.tpl' blog=$test1 member=$test2 contents=$test->contents replyId=$test->predefinedreplyid }' label='{$test->predefinedreplyid}' {if $test->predefinedreplyid==$test1->declineId}selected="selected"{/if}>{$test->subject}</option> {/foreach} </select> How can i do that? Thanks for help

    Read the article

  • How to focus next field if user clicked on the link?

    - by LA_
    I have a number of fields with labels-links like below: <div class="control-group"> <label class="control-label" for="some-id-1"><a href="http://example.com/some-id-1" target="_blank">Text1</a></label> <div class="controls"> <input type="text" id="some-id-1" name="some-id-1"><br> </div> </div> <div class="control-group"> <label class="control-label" for="some-id-2"><a href="http://example.com/some-id-2" target="_blank">Text2</a></label> <div class="controls"> <input type="text" id="some-id-2" name="some-id-2"><br> </div> </div> If user clicks on the link, how can I focus according field (without preventing default action)? I.e. if user clicks on Text1, then I should open http://example.com/some-id-1 in new window and set focus at input with id some-id-1.

    Read the article

  • How to determine magnitude of trigonometric function? C++

    - by seaworthy
    > if (((test>=0) && (test<=90)) || ((test>270) && (test<=360))){n_y=1;} > else {n_y=-1;} I need the magnitude of trigonometric function in order to determine the sign of the trigonometric function for an angle falling into a particular quadrant. My plan is to replace the code above with something equivalent. Here is what I want to do in pseudo-code. n_y = cos(test) / (magnitude of cos (test)); This will give me same thing. Abs() only takes integers. Any help is appreciated.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Hide 'Would you like to remember password' iFrame

    - by nsilva
    Basically I have a website called http://yellow-taxis.uk/ which features an online booking system that is placed on the web site within an iFrame. On the online booking, it automatically logs the user in as a 'Guest' for credit card payments. When the site loads it comes up with a window asking the viewer if they 'would like to remember the password'. I was wondering if there was anyway possible to not display this window as it would be a much simpler option than changing a lot of the code within the online booking. Just to add, the iFrame is hosted on the same server as the web site (not sure if this makes a difference) Any help would be much appreciated.

    Read the article

  • Retrieving an element by array index in jQuery vs the each() function.

    - by Alex Ciminian
    I was writing a "pluginable" function when I noticed the following behavior (tested in FF 3.5.9 with Firebug 1.5.3). $.fn.computerMove = function () { var board = $(this); var emptySquares = board.find('div.clickable'); var randPosition = Math.floor(Math.random() * emptySquares.length); emptySquares.each(function (index) { if (index === randPosition) { // logs a jQuery object console.log($(this)); } }); target = emptySquares[randPosition]; // logs a non-jQuery object console.log(target); // throws error: attr() not a function for target board.placeMark({'position' : target.attr('id')}); } I noticed the problem when the script threw an error at target.attr('id') (attr not a function). When I checked the log, I noticed that the output (in Firebug) for target was: <div style="width: 97px; height: 97px;" class="square clickable" id="8"></div> If I output $(target), or $(this) from the each() function, I get a nice jQuery object: [ div#8.square ] Now here comes my question: why does this happen, considering that find() seems to return an array of jQuery objects? Why do I have to do $() to target all over again? [div#0.square, div#1.square, div#2.square, div#3.square, div#4.square, div#5.square, div#6.square, div#7.square, div#8.square] Just a curiosity :).

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >