Search Results

Search found 31578 results on 1264 pages for 'javascript functions'.

Page 673/1264 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • Prevent initial array from sorting

    - by George
    I have an array where the order of the objects is important for when I finally output the array in a document. However, I'm also sorting the array in a function to find the highest value. The problem is that I after I run the function to find the highest value, I can't get the original sort order of the array back. // html document var data = [75,300,150,500,200]; createGraph(data); // js document function createGraph(data) { var maxRange = getDataRange(data); // simpleEncode() = google encoding function for graph var dataSet = simpleEncode(data,maxRange); } function getDataRange(dataArray) { var num = dataArray.sort(sortNumber); return num[0]; } I've also tried setting data to dataA and dataB and using dataB in the getDataRange function and dataA in the simpleEncode function. Either way, data always end up being sorted from highest to lowest.

    Read the article

  • What is XML good for and when should i be using it?

    - by Haroldo
    I'm curious, I've been developing pretty powerful websites/web apps, and I've never learnt XML, even odder I've never really felt the need to. It's not like Curl or Prepared Statements where before knowing what they did and how they worked I had a feeling 'there's got to be an easier way to do this!' or 'there's got to be something designed for this!'. Currently I work with MySQL and JSON and I don't have this feeling of 'I need to learn that' (XML), this must be wrong! I'm really interested to hear some compelling arguments for XML, and learn about things which it can do beter than JSON or MySQL (or some other aspect of web dev) and when i should be using it!

    Read the article

  • How to dynamically set div size?

    - by Vafello
    I have a div container with a text that has been previously typed in by the user. I would like to adjust the size of the div to this text. I cannot have fixed size because I dont know the length of the text. If there is no size specified div takes the width of entire window. This cause some problems for me because I am using JQuery draggable plugin and the scrollbars appear immediately when the div is dragged. Any advice on that?

    Read the article

  • Expected Expression

    - by coffeeaddict
    I cannot figure out what I did or did not do here syntactically to cause this error. I don't see what's missing: function ShowWaitMessage(button) { var isValid; if (buttonSelected()) { showWaitMessage(button, "showMessage1"); isValid = true; } else { Page_ClientValidate(); if (Page_IsValid) { showWaitMessage(button, "showMessage2"); isValid = true; } } return isValid; }

    Read the article

  • How to get the innerHTML of a XML document (AJAX)?

    - by JCOC611
    After an AJAX query, a XML file is returned. I'm able to "parse" that file, but when it comes to getting the "innerHTML" (or in this case "innerXML" lol) of an element, I fail. If the XML element, let's say "content", only contained text I could do: content.childNodes[0].nodeValue (assuming that content references the XML element "content"). But that element contains other elements: <stackoverflow reason="tribute to this page"> <content> <div><span><p>Some more HTML elements</p></span></div> </content> </stackoverflow> I need to copy the content of <content> to an existing <div> in the page, how could I do that? Ex. myDiv.innerHTML = content.innerHTML;

    Read the article

  • XMLHttpRequest.status always returning 0

    - by Michael
    html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • jQuery if condition text contains

    - by olo
    I wrote a simple if condition, but not quite working. if text is 123 change to hi, if text is 456 change it to hi2 Could someone please give me a hand. <h1>123</h1> <h1>456</h1> <h1>789</h1>? $(document).ready(function() { var changeText1 = '123'; var changeText2 = '456'; var text = $(h1).text(); if (text == changeText) { $(this).text('hi'); } else if (text == changeText2 ) { $(this).text('hi2'); } }); ? http://jsfiddle.net/8P2ma/

    Read the article

  • A HREF URL won't work

    - by user3586248
    I am trying to get the following link to work. <a href='#' onclick='window.open(" | &ESPP_Info_URL | ");return false;'>Employee Stock Purchase Plan Information</a> Basically the &ESPP_Info_URL variable takes in a url so that the code below looks like... <a onclick="window.open(https://...);return false;" href="#">Employee Stock Purchase Plan Information</a> But when I click the url it just refreshes the page. Does anyone know how to get this to access the link within the window.open function?

    Read the article

  • check if foler exists in the root jquery

    - by Dimal Chandrasiri
    I'm trying to load an image to a div background using the following file structure in the root. WebContent -- | zharaimages -- | [ItemID] -- | Image.jpg This is done by jQuery and the file structure is inside the root. The ItemID folder is dynamic and I have to check whether the path exists using jQuery and if the path is not valid, I should go to a default path to fetch the default image. How can I check the path is valid using jQuery. I'm hoping to this can be done without an ajax call. Can any one help me on a tutorial or an API I can use for this! UPDATE The files are on the server. The concept I have is that I have 100s of item elements & I want to load an image for each item element. The images are saved in the server ( a local host ) and the folder hierarchy is divided using the item ID as shown. What I want to do is check whether the image file exists before appending it to the background of the item element div. Is this possible. This is a web application developed using spring.

    Read the article

  • allignment issue of div tag

    - by Quasar the space thing
    I am trying to create a web page where on click of a button I can add div tags. What I thought to do was that I'll create two div tags within a single div so that over all presentation will be uniform and similar to a table having two columns and multiple rows and the first column contains only label's and second column will contain textbox. Here is the JS file : var counter = 0; function create_div(type){ var dynDiv = document.createElement("div"); dynDiv.id = "divid_"+counter; dynDiv.class="main"; document.body.appendChild(dynDiv); question(); if(type == 'ADDTEXTBOX'){ ADDTEXTBOX(); } counter=counter+1; } function question(){ var question_div = document.createElement("div"); question_div.class="question"; question_div.id = "question_div_"+counter; var Question = prompt("Enter The Question here:", ""); var node=document.createTextNode(Question); question_div.appendChild(node); var element=document.getElementById("divid_"+counter); element.appendChild(question_div); } function ADDTEXTBOX(){ var answer_div = document.createElement("div"); answer_div.class="answer"; answer_div.id = "answer_div_"+counter; var answer_tag = document.createElement("input"); answer_tag.id = "answer_tag_"+counter; answer_tag.setAttribute("type", "text"); answer_tag.setAttribute("name", "textbox"); answer_div.appendChild(answer_tag); var element=document.getElementById("divid_"+counter); element.appendChild(answer_div); } Here is the css file : .question { width: 40%; height: auto; float: left; display: inline-block; text-align: justify; word-wrap:break-word; } .answer { padding-left:10%; width: 40%; height: auto; float: left; overflow: auto; word-wrap:break-word; } .main { width: auto; background-color:gray; height: auto; overflow: auto; word-wrap:break-word; } My problem is that the code is working properly but both the divisions are not coming in a straight line. after the first div prints on the screen the second divisions comes in another line. How can I make both the div's come in the same line ? Thank You. PS : should I stick with the current idea of using div or should I try some other approach ? like tables ?

    Read the article

  • Problem with running totals in jquery

    - by rshivers
    I'm having an issue trying to get an accurate running total for my calculations. When you enter numbers into the input field I get an accurate total for that line item, but the grand total comes out to a higher number. Note that this is a dynamic form and that the id's will change depending on how many form fields I have added to the form. Also, I have it set to make the calculations onKeyUp for each input field instead of a calculate button. The code that calculates a single item is this: function calcLineItem(id) { var id = $(id).attr("id"); var Item1 = $("#Item1" + id).val(); var Item2 = $("#Item2" + id).val(); var Item3 = $("#Item3" + id).val(); function calcTotal(Item1, Item2, Item3){ var total; total = Math.round((Item1 * Item2) * Item3); return total; } $("#total" + id).text(calcTotal(Item1, Item2, Item3)); calcAllFields(); } This will give me the total of this particular input field. The function at the end, calcAllFields(), is supposed to do the calculations for all items in my form to give me the grand total of all input fields: function calcAllFields(id) { var id = $(id).attr("id"); $('#target1').text($("#total" + id).map(function() { var currentValue = parseFloat(document.getElementById("currentTotal").value); var newValue = parseFloat($("#total" + id).text()); var newTotal = currentValue + newValue; document.getElementById("currentTotal").value = newTotal; return newTotal; }).get().join()); } The variable currentTotal is getting its value from a hidden field on my form: <input type="hidden" id="currentTotal" value="0"> As I enter numbers a field the calculation for that line will be accurate, but the grand total will be inaccurate because the value for currentTotal will continue to increment with every key stroke I make in the input field. Any ideas on how to avoid this from happening?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • jQuery scrollTop - animation stucks at the end of moving

    - by mobsteady
    i use jquery the scrollTop function to get my scrolling smooth while switching between different anchors. first, here is the url the problem this is my jquery script "ziel" is just the german word for "target", just to let you know why this variable is called "ziel" $(document).ready(function() { $('a[href*=#]').bind("click", function(event) { event.preventDefault(); var ziel = $(this).attr("href"); $('#portraitcontent').animate({ scrollTop: $(ziel).offset().top }, 3000 , function (){location.hash = ziel;}); }); return false; }); so how do i get a smooth scrolling without that ugly jumping at the end of the animation? any ideas? i really don't know what to do. spending hours with that bitch! thanks for your advices!

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • Substitution for display='table-cell' in IE 7

    - by Jeny
    Hi friends, document.getElementById(id).style.display ='table-cell'. This gives error message in IE, this is IE bug or any other solutions please give any other solutions. IE7 doesn't support this property. this is my coding. Even Firefox and Chrome are accepted. My problem is IE. Please friends give solution... var cont2 = document.createElement('div'); cont2.style.display = "table-cell"; cont2.style.verticalAlign = "middle"; cont2.style.lineHeight = 100+"%"; cont2.style.padding = 10+"px"; cont2.appendChild(body);

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >