Search Results

Search found 31578 results on 1264 pages for 'javascript functions'.

Page 673/1264 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • Checking for length of ul and removing an li element

    - by Legend
    I am trying to remove the last <li> element from a <ul> element only if it exceeds a particular length. For this, I am doing something like this: var selector = "#ulelement" if($(selector).children().length > threshold) { $(selector + " >:last").remove(); } I don't like the fact that I have to use the selector twice. Is there a shorter way to do this? Something like a "remove-if-length-greater-than-threshold" idea. I was thinking that maybe there is a way to do this using the live() function but I have no idea how.

    Read the article

  • How do i Convert a Select to a Checkbox

    - by streetparade
    That sounds pretty odd but i have this cod and i need to convert it to checkbox, with the same functionalities <select onchange="document.getElementById('reasonDiv{$test->id}').style.display = ''; document.getElementById('reason{$test->id}').value = this.value;" name='reasonId{$test->id}' id='reasonId{$test->id}'> <option value=''>Test</option> {foreach item=test from=$testtmp.6} <input type="checkbox" value='{include file='testen.tpl' blog=$test1 member=$test2 contents=$test->contents replyId=$test->predefinedreplyid }' label='{$test->predefinedreplyid}' {if $test->predefinedreplyid==$test1->declineId}selected="selected"{/if}>{$test->subject}</option> {/foreach} </select> How can i do that? Thanks for help

    Read the article

  • Highlighting search words like Chrome with jQuery

    - by ilkin
    I have recently done a very simple highlighting with jQuery and a highlight plugin. It looks like this: $('myButton').click(function() { $('body').highlight($('#myInputText').val()); }); But I wonder how can I do the Chrome like highlighting, I mean highlight the letters whenever I type in some letter in textbox without submitting. I think maybe use a keyup event... Any ideas?

    Read the article

  • jQuery UI Autocomplete IE Cursor Position Bug

    - by CountZero
    Heya, I have just implemented the excellent jQuery UI autocomplete. http://jqueryui.com/demos/autocomplete/ There is a strange bug in IE 8 (and maybe other versions). When you select an item from the box of suggestions in IE 8 the cursor moves to the begining of the textbox before the suggested word which has just been inserted. Firefox put the cursor after the inserted word. Does anyone know of a fix for this? Regards Steve

    Read the article

  • Redirect Using jQuery

    - by tshauck
    Hi, So I'm using jquerymobile for an app I'm creating. I have a link that if all the validation passes I'd like to go through, but if something fails I'd like to redirect. In the jquery something like this. Since it is jquerymobile the link will be a new div on the same index.html page - if that helps. $(#link).click(function(){ if(validation_fails) link_elsewhere; else return true; }

    Read the article

  • The SVG text node disappear after change its text content

    - by sureone
    svg: <text xml:space="preserve" y="228" x="349.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_b">cur_b</text> <text xml:space="preserve" y="222" x="103.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_a">cur_a</text> <text xml:space="preserve" y="229" x="590.0211" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_c">cur_c</text> NSString* theJS = @ "var theNode0 = document.getElementById('cur_a'); theNode0.textContent='200A'; theNode0.setAttribute('fill','#FF0000'); var theNode1 = document.getElementById('cur_c'); theNode1.textContent='200A'; theNode1.setAttribute('fill','#00FF00');" [self.webView stringByEvaluatingJavaScriptFromString:theJS]; The SVG text node value is changed but disappeared after about one second.

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • client-side vs server-side

    - by amalafrida
    In general, should one design in order to place processing load on client-side? More specifically, a search engine to locate subscriber information requires a fair amount of parsing (multiple phone numbers to sort and format, hour of day, timezone, comparisons for possible substitutions of user information, etc.). Again, in general, is it preferred that one have client-side do the work? It seems to me 'yes' in a situation in which one will have many thousands of hits per minute. Use php for quick database queries ... process retrieved data client-side. yes ... no?

    Read the article

  • Checking for multiple images loaded

    - by Stanni
    Hi, I'm using the canvas feature of html5. I've got some images to draw on the canvas and I need to check that they have all loaded before I can use them. I have declared them inside an array, I need a way of checking if they have all loaded at the same time but I am not sure how to do this. Here is my code: var color = new Array(); color[0] = new Image(); color[0].src = "green.png"; color[1] = new Image(); color[1].src = "blue.png"; Currently to check if the images have loaded, I would have to do it one by one like so: color[0].onload = function(){ //code here } color[1].onload = function(){ //code here } If I had a lot more images, Which I will later in in development, This would be a really inefficient way of checking them all. How would I check them all at the same time?

    Read the article

  • Get backreferences values and modificate these values

    - by roasted
    Could you please explain why im not able to get values of backreferences from a matched regex result and apply it some modification before effective replacement? The expected result is replacing for example string ".coord('X','Y')" by "X * Y". But if X to some value, divide this value by 2 and then use this new value in replacement. Here the code im currently testing: See /*>>1<<*/ & /*>>2<<*/ & /*>>3<<*/, this is where im stuck! I would like to be able to apply modification on backrefrences before replacement depending of backreferences values. Difference between /*>>2<<*/ & /*>>3<<*/ is just the self call anonymous function param The method /*>>2<<*/ is the expected working solution as i can understand it. But strangely, the replacement is not working correctly, replacing by alias $1 * $2 and not by value...? You can test the jsfiddle //string to test ".coord('125','255')" //array of regex pattern and replacement //just one for the example //for this example, pattern matching alphanumerics is not necessary (only decimal in coord) but keep it as it var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { /*==>**1**/ //this one works as usual but dont let me get backreferences values $output.val(inputText.replace(regexes[i][0], regexes[i][2])); /*==>**2**/ //this one should works as i understand it $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][3]; })); /*==>**3**/ //this one is just a test by self call anonymous function $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { $1 = checkReplace(match, $1, $2, $3, $4); //here want using $1 modified value in replacement return regexes[i][4]; }())); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); //HERE i should be able if lets say $1 > 200 divide it by 2 //then returning $1 value if($1 > 200) $1 = parseInt($1 / 2); return $1; }? Sure I'm missing something, but cannot get it! Thanks for your help, regards. EDIT WORKING METHOD: Finally get it, as mentionned by Eric: The key thing is that the function returns the literal text to substitute, not a string which is parsed for backreferences.?? JSFIDDLE So complete working code: (please note as pattern replacement will change for each matched pattern and optimisation of speed code is not an issue here, i will keep it like that) $('#btn').click(function() { testReg($('#input').val(), $('#output')); }); //array of regex pattern and replacement //just one for the example var regexes = [ //FORMAT is array of [PATTERN,REPLACEMENT] /*.coord("X","Y")*/ [/\.coord\(['"]([\w]+)['"],['"]?([\w:\.\\]+)['"]?\)/g, '$1 * $2'] ]; function testReg(inputText, $output) { //using regex for (var i = 0; i < regexes.length; i++) { $output.val(inputText.replace(regexes[i][0], function(match, $1, $2, $3, $4) { var checkedValues = checkReplace(match, $1, $2, $3, $4); $1 = checkedValues[0]; $2 = checkedValues[1]; regexes[i][1] = regexes[i][1].replace('$1', $1).replace('$2', $2); return regexes[i][1]; })); inputText = $output.val(); } } function checkReplace(match, $1, $2, $3, $4) { console.log(match + ':::' + $1 + ':::' + $2 + ':::' + $3 + ':::' + $4); if ($1 > 200) $1 = parseInt($1 / 2); if ($2 > 200) $2 = parseInt($2 / 2); return [$1,$2]; }

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Call a method on Browser closure [X]

    - by Gaurav
    I am facing an issue in my application user directly clicked on browser close [X] button. Browser can be IE, Chrome, Mozilla, Firefox and many more. What I want to do : 1. as soon as User hits [X] button of browser, need to set there status as logged off in database for which we have a method in Login.aspx file which is within the masterpage. 2. We do not have any Logoff feature in the application I will be thanlful if anyone suggest a solution to call the method which sets the user status as logged off from master page. Thanks in advance.

    Read the article

  • IE firing anything else but click

    - by shabunc
    I just wonder is there's any way to fire any event via IE's event-triggering implementation - fireEvent. I've tried to use it but failed with all event except click. The only reason i've get interested with this issue it curiousity, thus, any answers like "just do not trigger events, it is a bad idea" - all such answers would be considered, well...not full))) thanks in advance

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • A better and faster way for eval?

    - by user1707250
    I want to build my queries dynamically and use the following snippet: --snip-- module.exports = { get : function(req, res, next) { var queryStr = "req.database.table('locations').get(parseInt(req.params.id))"; if (req.params.id) { if (req.fields) { queryStr += '.pick(' + req.fieldsStr + ')'; } console.log(queryStr); eval(queryStr).run(function(result) { console.log(result); res.send(result); }); } else if (!req.params.id) { --snip-- However introducing eval opens up my code to injection (req.fields is filled with url parameters) and I see the response time of my app increase from 7 to 11ms Is there a smarter way to accomplish what I did here? Please advice.

    Read the article

  • How to achieve jQuery scrolling/overlay effect (video in description)

    - by waffl
    I have two columns. The left column contains text of dynamic lengths. The right column is of fixed height and will contain a set of images selected at random per page load. I am trying to create an effect where while the user scrolls, the Image 2 scrolls above Image 1. When it reaches the top, the Image 1 begins to scroll up until it disappears, then Image 3 comes in and repeats the process. As this is rather confusing, I made a short video describing the desired effect. Video - MP4 I have begun trying to get it working in this jsbin but am at a loss for when the user scrolls back down and also when more images are required. I am thinking my current path is not the right direction. I'm thinking that employing something like jQuery waypoints is more the direction I should be pursuing?

    Read the article

  • Function to get the font and calculate the width of the string not working on first instance

    - by user3627265
    I'm trying to calculate the width of the string based on the font style and size. The user will provide the string, the font style and the font size, and then after giving all the data the user will hit the submit button and the function will trigger. Basically this script works but only when the submit button is hit twice or the font is selected twice,. I mean if you selec DNBlock as a font, it will not work for first time, but the second time you hit submit, it will then work. I'm not sure where is the problem here, but when I used the default font style like Arial, times new roman etc it works perfectly fine. Any Idea on this? I suspected that the font style is not being rendered by the script or something. Correct me if I'm wrong. Thanks //Repeat String String.prototype.repeat = function( num ) { return new Array( num + 1 ).join( this ); } //Calculate the width of string String.prototype.textWidth = function() { var fntStyle = document.getElementById("fntStyle").value; if(fntStyle == "1") { var fs = "DNBlock"; } else if(fntStyle == "2") { var fs = "DNBlockDotted"; } else if(fntStyle == "3") { var fs = "DNCursiveClassic"; } else if(fntStyle == "4") { var fs = "DNCursiveDotted"; } else if(fntStyle == "5") { var fs = "FoundationCursiveDots-Regul"; } var f = document.getElementById("fntSize").value.concat('px ', fs), o = $('<div>' + this + '</div>') .css({'position': 'absolute', 'float': 'left', 'white-space': 'nowrap', 'visibility': 'hidden', 'font': f}) .appendTo($('body')), w = o.width(); o.remove(); return w; } //Trigger the event $("#handwriting_gen").submit(function () { var rptNO = parseInt($('#rptNO').val()); $("[name='txtLine[]']").each(function(){ alert(this.value.repeat(rptNO).textWidth()); if(this.value.repeat(rptNO).textWidth() > 1000) { $(this).focus(); $(this).css({"background-color":"#f6d9d4"}).siblings('span.errorMsg').text('Text is too long.'); event.preventDefault(); } }); });

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Disable a form and all contained elements until an ajax query completes (or another solution to prev

    - by Max Williams
    I have a search form with inputs and selects, and when any input/select is changed i run some js and then make an ajax query with jquery. I want to stop the user from making further changes to the form while the request is in progress, as at the moment they can initiate several remote searches at once, effectively causing a race between the different searches. It seems like the best solution to this is to prevent the user from interacting with the form while waiting for the request to come back. At the moment i'm doing this in the dumbest way possible by hiding the form before making the ajax query and then showing it again on success/error. This solves the problem but looks horrible and isn't really acceptable. Is there another, better way to prevent interaction with the form? To make things more complicated, to allow nice-looking selects, the user actually interacts with spans which have js hooked up to them to tie them to the actual, hidden, selects. So, even though the spans aren't inputs, they are contained in the form and represent the actual interactive elements of the form. Grateful for any advice - max. Here's what i'm doing now: function submitQuestionSearchForm(){ //bunch of irrelevant stuff var questionSearchForm = jQuery("#searchForm"); questionSearchForm.addClass("searching"); jQuery.ajax({ async: true, data: jQuery.param(questionSearchForm.serializeArray()), dataType: 'script', type: 'get', url: "/questions", success: function(msg){ //more irrelevant stuff questionSearchForm.removeClass("searching"); }, error: function(msg){ questionSearchForm.removeClass("searching"); } }); return true; }

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >