Search Results

Search found 31578 results on 1264 pages for 'javascript functions'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 675/1264 | < Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >

  • jquery integrate form parameter in one object

    - by jesse
    There are many forms in my page. I want to merge them in one object and submit them in one object. But I find serializeArray() or serialize() do not match my request, the serializeArray function will generate a array object and serialize is used by get model, it is not an object. is there a jquery or local function can merge them in one object. I have one solution but it is not perfect, loop the array object generated by serializeArray, use $.extend to merge them in one object. is there a better method? kindly help, thanks.

    Read the article

  • Some pro regular expressions help needed here

    - by Camran
    I need a special regular expression, have no experience in them whatsoever so I am turning to you guys on this one: I need to validate a classifieds title field so it doesn't have any special characters in it, almost. Only letters and numbers should be allowed, and also the swedish three letters å, ä, ö, and also not case sensitive. Besides the above, these should also be allowed: The "&" sign. Parenthesis sign "()" Mathematical signs "-", "+", "%", "/", "*" Dollar and Euro signs Accent sign or whatever it's called, for example in "coupé" the apostrophe above the "e". Double quote and singel quote signs. The comma "," and point "." signs Thanks

    Read the article

  • jQuery code works in Chrome, not in IE9

    - by Francis Ducharme
    Pretty new to jQuery here, I've got a chunk of code that works OK in Chrome, but fails in IE9 (have not tried FF yet). Here's the code: var textColor = $('#navmenu-body').css('color'); textColor = textColor.slice(4); In IE9, I get an error to the effect that slice can't be called because textColor is undefined. I was not sure if it's because jQuery just can't find the #navmenu-body element or that it can't find the CSS attribute color. So I did: var j = $('#navmenu-body'); var textColor = $('#navmenu-body').css('color'); textColor = textColor.slice(4); In IE9's console, j.length returns 0. So the selector is indeed, not working Here's the #navmenu-body HTML DOM <div id="navmenu-body" class="x-panel-body x-panel-body-cssmenu x-layout-fit x-panel-body-cssmenu" style="height: 398px; left: 0px; top: 0px; width: 200px;"> </div> Do I need to do something else for IE9 support ?

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • appendChild + createElement

    - by user317005
    what's the difference between var div = document.createElement('div');//output -> [object HTMLDivElement] document.getElementById('container').appendChild(div); and var div = '<div></div>'; document.getElementById('container').appendChild(div);//output -> <div></div> shouldn't both be the same? and if not, how do i get the 2nd version to work?

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • Find word using JQuery

    - by tinti
    I need a little piece of advice. I have a test page with 2 fields: word number and URL Also i have a button Push. When i push the button i want to open the specified URL (it's local html files) and highlight the word at the "word number" position Of course the code must ignore element nodes (<p>,<b>,<table> and so on)

    Read the article

  • Fancybox - getting html from element based on id?

    - by kastru
    I have the following snippet; $("a.lightbox_image").each(function () { $(this).fancybox({ 'transitionIn': 'elastic', 'transitionOut': 'elastic', 'speedIn': 600, 'speedOut': 200, 'content': $('#lightbox_image_content_'+this.id.replace('lightbox_image_','')).html() }); }); But the above does not get the content from the element referenced to in the content property - what am i doing wrong?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • SO style alert header

    - by Zachary
    I apologize if this question is vague, but I want to build a drop down header, very similar to the one on StackOverflow that alerts you whenever you have earned a new badge, or on Twitter whenever a new tweet comes in. I've been looking around on the internet for a tutorial, but I'm having trouble googling exactly what I'm looking for. I assume there is a way to do this in jQuery, or there may be a jQuery plugin for it, but I haven't had any luck finding one. The idea would probably be to make an AJAX request every so many seconds, and if a new alert-worthy item is found, display it for the user. If someone could point me to a resource to learn how to build one, and/or an existing plugin, that would be great.

    Read the article

  • What ways are there to edit a function in R?

    - by Tal Galili
    Let's say we have the following function: foo <- function(x) { line1 <- x line2 <- 0 line3 <- line1 + line2 return(line3) } And that we want to change the second line to be: line2 <- 2 How would you do that? One way is to use fix(foo) And change the function. Another way is to just write the function again. Is there another way? (Remember, the task was to change just the second line)

    Read the article

  • How do i Convert a Select to a Checkbox

    - by streetparade
    That sounds pretty odd but i have this cod and i need to convert it to checkbox, with the same functionalities <select onchange="document.getElementById('reasonDiv{$test->id}').style.display = ''; document.getElementById('reason{$test->id}').value = this.value;" name='reasonId{$test->id}' id='reasonId{$test->id}'> <option value=''>Test</option> {foreach item=test from=$testtmp.6} <input type="checkbox" value='{include file='testen.tpl' blog=$test1 member=$test2 contents=$test->contents replyId=$test->predefinedreplyid }' label='{$test->predefinedreplyid}' {if $test->predefinedreplyid==$test1->declineId}selected="selected"{/if}>{$test->subject}</option> {/foreach} </select> How can i do that? Thanks for help

    Read the article

  • Is canvas security model ignoring access-control-allow-origin headers?

    - by luklatlug
    It seems that even if you set the access-control-allow-origin header to allow access from mydomain.org to an image hosted on domain example.org, the canvas' origin-clean flag gets set to false, and trying to manipulate that image's pixel data will trigger a security exception. Shouldn't canvas' obey the access-control-allow-origin header and allow access to image's data without throwing an exception?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • Check checkbox checked property using jQuery

    - by Prasad
    I need to check the checked property of a checkbox and perform an action based on the checked property using jQuery. For example, if the age checkbox is checked, then I need to show a textbox to enter age, else hide the textbox. But the following code returns false by default: if($('#isAgeSelected').attr('checked')) { $("#txtAge").show(); } else { $("#txtAge").hide(); } How do I successfully query the checked property?

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >