Search Results

Search found 18096 results on 724 pages for 'let'.

Page 673/724 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • [Reloaded] Error while sorting filtered data from a GridView

    - by Bogdan M
    Hello guys, I have an error I cannot solve, on a ASP.NET website. One of its pages - Countries.aspx, has the following controls: a CheckBox called "CheckBoxNAME": < asp:CheckBox ID="CheckBoxNAME" runat="server" Text="Name" /> a TextBox called "TextBoxName": < asp:TextBox ID="TextBoxNAME" runat="server" Width="100%" Wrap="False"> < /asp:TextBox> a SQLDataSource called "SqlDataSourceCOUNTRIES", that selects all records from a Table with 3 columns - ID (Number, PK), NAME (Varchar2(1000)), and POPULATION (Number) called COUNTRIES < asp:SqlDataSource ID="SqlDataSourceCOUNTRIES" runat="server" ConnectionString="< %$ ConnectionStrings:myDB %> " ProviderName="< %$ ConnectionStrings:myDB.ProviderName %> " SelectCommand="SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES ORDER BY COUNTRIES.NAME, COUNTRIES.ID"> < /asp:SqlDataSource> a GridView called GridViewCOUNTRIES: < asp:GridView ID="GridViewCOUNTRIES" runat="server" AllowPaging="True" AllowSorting="True" AutoGenerateColumns="False" DataSourceID="SqlDataSourceCOUNTRIES" DataKeyNames="ID" DataMember="DefaultView"> < Columns> < asp:CommandField ShowSelectButton="True" /> < asp:BoundField DataField="ID" HeaderText="Id" SortExpression="ID" /> < asp:BoundField DataField="NAME" HeaderText="Name" SortExpression="NAME" /> < asp:BoundField DataField="POPULATION" HeaderText="Population" SortExpression="POPULATION" /> < /Columns> < /asp:GridView> a Button called ButtonFilter: < asp:Button ID="ButtonFilter" runat="server" Text="Filter" onclick="ButtonFilter_Click"/> This is the onclick event: protected void ButtonFilter_Click(object sender, EventArgs e) { Response.Redirect("Countries.aspx?" + (this.CheckBoxNAME.Checked ? string.Format("NAME={0}", this.TextBoxNAME.Text) : string.Empty)); } Also, this is the main onload event of the page: protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack == false) { if (Request.QueryString.Count != 0) { Dictionary parameters = new Dictionary(); string commandTextFormat = string.Empty; if (Request.QueryString["NAME"] != null) { if (commandTextFormat != string.Empty && commandTextFormat.EndsWith("AND") == false) { commandTextFormat += "AND"; } commandTextFormat += " (UPPER(COUNTRIES.NAME) LIKE '%' || :NAME || '%') "; parameters.Add("NAME", Request.QueryString["NAME"].ToString()); } this.SqlDataSourceCOUNTRIES.SelectCommand = string.Format("SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES WHERE {0} ORDER BY COUNTRIES.NAME, COUNTRIES.ID", commandTextFormat); foreach (KeyValuePair parameter in parameters) { this.SqlDataSourceCOUNTRIES.SelectParameters.Add(parameter.Key, parameter.Value.ToUpper()); } } } } Basicly, the page displays in the GridViewCOUNTRIES all the records of table COUNTRIES. The scenario is the following: - the user checks the CheckBox; - the user types a value in the TextBox (let's say "ch"); - the user presses the Button; - the page loads displaying only the records that match the filter criteria (in this case, all the countries that have names containing "Ch"); - the user clicks on the header of the column called "Name" in order to sort the data in the GridView Then, I get the following error: ORA-01036: illegal variable name/number. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.OracleClient.OracleException: ORA-01036: illegal variable name/number Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Any help is greatly appreciated, tnks. PS: I'm using ASP.NET 3.5, under Visual Studio 2008, with an OracleXE database.

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • Spring's JdbcDaoSupport (using MySQL Connector/J) fails after executing sql that adds FK

    - by John
    I am using Spring's JdbcDaoSupport class with a DriverManagerDataSource using the MySQL Connector/J 5.0 driver (driverClassName=com.mysql.jdbc.driver). allowMultiQueries is set to true in the url. My application is an in-house tool we recently developed that executes sql scripts in a directory one-by-one (allows us to re-create our schema and reference table data for a given date, etc, but I digress). The sql scripts sometime contain multiple statements (hence allowMultiQueries), so one script can create a table, add indexes for that table, etc. The problem happens when including a statement to add a foreign key constraint in one of these files. If I have a file that looks like... --(column/constraint names are examples) CREATE TABLE myTable ( fk1 BIGINT(19) NOT NULL, fk2 BIGINT(19) NOT NULL, PRIMARY KEY (fk1, fk2) ); ALTER TABLE myTable ADD CONSTRAINT myTable_fk1 FOREIGN KEY (fk1) REFERENCES myOtherTable (id) ; ALTER TABLE myTable ADD CONSTRAINT myTable_fk2 FOREIGN KEY (fk2) REFERENCES myOtherOtherTable (id) ; then JdbcTemplate.execute throws an UncategorizedSqlException with the following error message and stack trace: Exception in thread "main" org.springframework.jdbc.UncategorizedSQLException: StatementCallback; uncategorized SQLException for SQL [ THE SQL YOU SEE ABOVE LISTED HERE ]; SQL state [HY000]; error code [1005]; Can't create table 'myDatabase.myTable' (errno: 150); nested exception is java.sql.SQLException: Can't create table 'myDatabase.myTable' (errno: 150) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:83) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) at org.springframework.jdbc.support.AbstractFallbackSQLExceptionTranslator.translate(AbstractFallbackSQLExceptionTranslator.java:80) and the table and foreign keys are not inserted. Also, especially weird: if I take the foreign key statements out of the script I showed above and then place them in their own script that executes after (so I now have 1 script with just the create table statement, and 1 script with the add foreign key statements that executes after that) then what happens is: tool executes create table script, works fine, table is created tool executes add fk script, throws the same exception as seen above (except errno=121 this time), but the FKs actually get added (!!!) In other words, when the create table/FK statements are in the same script then the exception is thrown and nothing is created, but when they are different scripts a nearly identical exception is thrown but both things get created. Any help on this would be greatly appreciated. Please let me know if you'd like me to clarify anything more.

    Read the article

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Setting default values for inherited property without using accessor in Objective-C?

    - by Ben Stock
    I always see people debating whether or not to use a property's setter in the -init method. I don't know enough about the Objective-C language yet to have an opinion one way or the other. With that said, lately I've been sticking to ivars exclusively. It seems cleaner in a way. I don't know. I digress. Anyway, here's my problem … Say we have a class called Dude with an interface that looks like this: @interface Dude : NSObject { @private NSUInteger _numberOfGirlfriends; } @property (nonatomic, assign) NSUInteger numberOfGirlfriends; @end And an implementation that looks like this: @implementation Dude - (instancetype)init { self = [super init]; if (self) { _numberOfGirlfriends = 0; } } @end Now let's say I want to extend Dude. My subclass will be called Playa. And since a playa should have mad girlfriends, when Playa gets initialized, I don't want him to start with 0; I want him to have 10. Here's Playa.m: @implementation Playa - (instancetype)init { self = [super init]; if (self) { // Attempting to set the ivar directly will result in the compiler saying, // "Instance variable `_numberOfGirlfriends` is private." // _numberOfGirlfriends = 10; <- Can't do this. // Thus, the only way to set it is with the mutator: self.numberOfGirlfriends = 10; // Or: [self setNumberOfGirlfriends:10]; } } @end So what's a Objective-C newcomer to do? Well, I mean, there's only one thing I can do, and that's set the property. Unless there's something I'm missing. Any ideas, suggestions, tips, or tricks? Sidenote: The other thing that bugs me about setting the ivar directly — and what a lot of ivar-proponents say is a "plus" — is that there are no KVC notifications. A lot of times, I want the KVC magic to happen. 50% of my setters end in [self setNeedsDisplay:YES], so without the notification, my UI doesn't update unless I remember to manually add -setNeedsDisplay. That's a bad example, but the point stands. I utilize KVC all over the place, so without notifications, things can act wonky. Anyway, any info is much appreciated. Thanks!

    Read the article

  • Openlayers and Bing Maps (POLYGONS)

    - by Jordan
    When trying to draw polygons onto a bing map, the initial marker is set differently on the map. How can I fix this? OpenLayers Bing Example <script src="OpenLayers.js"></script> <script> var map; function init(){ map = new OpenLayers.Map("map"); map.addControl(new OpenLayers.Control.LayerSwitcher()); var shaded = new OpenLayers.Layer.VirtualEarth("Shaded", { type: VEMapStyle.Shaded }); var hybrid = new OpenLayers.Layer.VirtualEarth("Hybrid", { type: VEMapStyle.Hybrid }); var aerial = new OpenLayers.Layer.VirtualEarth("Aerial", { type: VEMapStyle.Aerial }); var POLY_LAYER = new OpenLayers.Layer.Vector(); map.addLayers([shaded, hybrid, aerial, POLY_LAYER]); map.setCenter(new OpenLayers.LonLat(-110, 45), 3); var polygon = new OpenLayers.Control.DrawFeature(POLY_LAYER, OpenLayers.Handler.Polygon); map.addControl(polygon); polygon.activate(); } </script> Bing Example <div id="tags"> Bing, Microsoft, Virtual Earth </div> <p id="shortdesc"> Demonstrates the use of Bing layers. </p> <div id="map" class="smallmap"></div> <div id="docs">This example demonstrates the ability to create layers using tiles from Bing maps.</div> Of course the above is being initialized and page works. You can draw the polygon shapes. Notice if you zoom in or out one time, the markers are set at the correct coordinates. My app I was testing this on is really using the bing maps API keys and not VirtualEarth. But it's doing a similar thing. Is this an Openlayers bug? The below source came directly from the open layers example site, I just added and activated polygons to the map. Please let me know how I can fix this for using the Bing Map API.. I've been stuck on this for HOURS! :(

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • How to solve High Load average issue in Linux systems?

    - by RoCkStUnNeRs
    The following is the different load with cpu time in different time limit . The below output has parsed from the top command. TIME LOAD US SY NICE ID WA HI SI ST 12:02:27 208.28 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:23:22 195.48 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:34:55 199.15 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 13:41:50 203.66 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st 13:42:58 278.63 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st Following is the additional Information of the system? cat /proc/cpuinfo processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 0 cpu cores : 4 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4658.69 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 1 cpu cores : 4 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 2 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 2 cpu cores : 4 apicid : 2 initial apicid : 2 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 3 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 3 cpu cores : 4 apicid : 3 initial apicid : 3 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4654.99 clflush size : 64 power management: Memory: total used free shared buffers cached Mem: 2 1 1 0 0 0 Swap: 5 0 5 let me know why the system is getting abnormally this much high load?

    Read the article

  • Best way to return result from business layer to presentation layer when using LINQ-to-SQL

    - by samsur
    I have a business layer that has DTOs that are used in the presentation layer. This application uses entity framework. Here is an example of a class called RoleDTO: public class RoleDTO { public Guid RoleId { get; set; } public string RoleName { get; set; } public string RoleDescription { get; set; } public int? OrganizationId { get; set; } } In the BLL I want to have a method that returns a list of DTO. I would like to know which is the better approach: returning IQueryable or list of DTOs. Although I feel that returning IQueryable is not a good idea because the connection needs to be open. Here are the 2 different methods using the different approaches: First approach public class RoleBLL { private servicedeskEntities sde; public RoleBLL() { sde = new servicedeskEntities(); } public IQueryable<RoleDTO> GetAllRoles() { IQueryable<RoleDTO> role = from r in sde.Roles select new RoleDTO() { RoleId = r.RoleID, RoleName = r.RoleName, RoleDescription = r.RoleDescription, OrganizationId = r.OrganizationId }; return role; } Note: in the above method the DataContext is a private attribute and set in the constructor, so that the connection stays opened. Second approach public static List<RoleDTO> GetAllRoles() { List<RoleDTO> roleDTO = new List<RoleDTO>(); using (servicedeskEntities sde = new servicedeskEntities()) { var roles = from pri in sde.Roles select new { pri.RoleID, pri.RoleName, pri.RoleDescription }; //Add the role entites to the DTO list and return. This is necessary as anonymous types can be returned acrosss methods foreach (var item in roles) { RoleDTO roleItem = new RoleDTO(); roleItem.RoleId = item.RoleID; roleItem.RoleDescription = item.RoleDescription; roleItem.RoleName = item.RoleName; roleDTO.Add(roleItem); } return roleDTO; } } Please let me know, if there is a better approach.

    Read the article

  • NHibernate and objects with value-semantics

    - by Groo
    Problem: If I pass a class with value semantics (Equals method overridden) to NHibernate, NHibernate tries to save it to db even though it just saved an entity equal by value (but not by reference) to the database. What am I doing wrong? Here is a simplified example model for my problem: Let's say I have a Person entity and a City entity. One thread (producer) is creating new Person objects which belong to a specific existing City, and another thread (consumer) is saving them to a repository (using NHibernate as DAL). Since there is lot of objects being flushed at a time, I am using Guid.Comb id's to ensure that each insert is made using a single SQL command. City is an object with value-type semantics (equal by name only -- for this example purposes only): public class City : IEquatable<City> { public virtual Guid Id { get; private set; } public virtual string Name { get; set; } public virtual bool Equals(City other) { if (other == null) return false; return this.Name == other.Name; } public override bool Equals(object obj) { return Equals(obj as City); } public override int GetHashCode() { return this.Name.GetHashCode(); } } Fluent NH mapping is something like: public class PersonMap : ClassMap<Person> { public PersonMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); References(x => x.City) .Cascade.SaveUpdate(); } } public class CityMap : ClassMap<City> { public CityMap() { Id(x => x.Id) .GeneratedBy.GuidComb(); Map(x => x.Name); } } Right now (with my current NHibernate mapping config), my consumer thread maintains a dictionary of cities and replaces their references in incoming person objects (otherwise NHibernate will see a new, non-cached City object and try to save it as well), and I need to do it for every produced Person object. Since I have implemented City class to behave like a value type, I hoped that NHibernate would compare Cities by value and not try to save them each time -- i.e. I would only need to do a lookup once per session and not care about them anymore. Is this possible, and if yes, what am I doing wrong here?

    Read the article

  • Are Objective-C initializers allowed to share the same name?

    - by NattKatt
    I'm running into an odd issue in Objective-C when I have two classes using initializers of the same name, but differently-typed arguments. For example, let's say I create classes A and B: A.h: #import <Cocoa/Cocoa.h> @interface A : NSObject { } - (id)initWithNum:(float)theNum; @end A.m: #import "A.h" @implementation A - (id)initWithNum:(float)theNum { self = [super init]; if (self != nil) { NSLog(@"A: %f", theNum); } return self; } @end B.h: #import <Cocoa/Cocoa.h> @interface B : NSObject { } - (id)initWithNum:(int)theNum; @end B.m: #import "B.h" @implementation B - (id)initWithNum:(int)theNum { self = [super init]; if (self != nil) { NSLog(@"B: %d", theNum); } return self; } @end main.m: #import <Foundation/Foundation.h> #import "A.h" #import "B.h" int main (int argc, const char * argv[]) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; A *a = [[A alloc] initWithNum:20.0f]; B *b = [[B alloc] initWithNum:10]; [a release]; [b release]; [pool drain]; return 0; } When I run this, I get the following output: 2010-04-26 20:44:06.820 FnTest[14617:a0f] A: 20.000000 2010-04-26 20:44:06.823 FnTest[14617:a0f] B: 1 If I reverse the order of the imports so it imports B.h first, I get: 2010-04-26 20:45:03.034 FnTest[14635:a0f] A: 0.000000 2010-04-26 20:45:03.038 FnTest[14635:a0f] B: 10 For some reason, it seems like it's using the data type defined in whichever @interface gets included first for both classes. I did some stepping through the debugger and found that the isa pointer for both a and b objects ends up the same. I also found out that if I no longer make the alloc and init calls inline, both initializations seem to work properly, e.g.: A *a = [A alloc]; [a initWithNum:20.0f]; If I use this convention when I create both a and b, I get the right output and the isa pointers seem to be different for each object. Am I doing something wrong? I would have thought multiple classes could have the same initializer names, but perhaps that is not the case.

    Read the article

  • How do we simplify this kind of code in Java? Something like macros in C?

    - by Terry Li
    public static boolean diagonals(char[][] b, int row, int col, int l) { int counter = 1; // because we start from the current position char charAtPosition = b[row][col]; int numRows = b.length; int numCols = b[0].length; int topleft = 0; int topright = 0; int bottomleft = 0; int bottomright = 0; for (int i=row-1,j=col-1;i>=0 && j>=0;i--,j--) { if (b[i][j]==charAtPosition) { topleft++; } else { break; } } for (int i=row-1,j=col+1;i>=0 && j<=numCols;i--,j++) { if (b[i][j]==charAtPosition) { topright++; } else { break; } } for (int i=row+1,j=col-1;i<=numRows && j>=0;i++,j--) { if (b[i][j]==charAtPosition) { bottomleft++; } else { break; } } for (int i=row+1,j=col+1;i<=numRows && j<=numCols;i++,j++) { if (b[i][j]==charAtPosition) { bottomright++; } else { break; } } return topleft + bottomright + 1 >= l || topright + bottomleft + 1 >= l; //in this case l is 5 } After I was done posting the code above here, I couldn't help but wanted to simplify the code by merging the four pretty much the same loops into one method. Here's the kind of method I want to have: public int countSteps(char horizontal, char vertical) { } Two parameters horizontal and vertical can be either + or - to indicate the four directions to walk in. What I want to see if possible at all is i++; is generalized to i horizontal horizontal; when horizontal taking the value of +. What I don't want to see is if or switch statements, for example: public int countSteps(char horizontal, char vertical) { if (horizontal == '+' && vertical == '-') { for (int i=row-1,j=col+1;i>=0 && j<=numCols;i--,j++) { if (b[i][j]==charAtPosition) { topright++; } else { break; } } } else if (horizontal == '+' && vertical == '+') { for (int i=row+1,j=col+1;i>=0 && j<=numCols;i++,j++) { if (b[i][j]==charAtPosition) { topright++; } else { break; } } } else if () { } else { } } Since it is as tedious as the original one. Note also that the comparing signs for the loop condition i>=0 && j<=numCols; for example, >= && <= have correspondence with the value combination of horizontal and vertical. Sorry for my bad wording, please let me know if anything is not clear.

    Read the article

  • How to dynamically change the content of a facet in a custom component?

    - by romaintaz
    Hello, Let's consider that I want to extend an existing JSF component, such as the <rich:datatable/>. My main requirement is to dynamically modify the content of a <f:facet>, to change its content. What is the best way to achieve that? Or where is the best place in the code to achieve that? In my faces-config.xml, I have the following declaration: <faces-config> ... <component> <component-type>my.component.dataTable</component-type> <component-class>my.project.component.table.MyHtmlDataTable</component-class> </component> ... <render-kit> <render-kit-id>HTML_BASIC</render-kit-id> <renderer> <component-family>org.richfaces.DataTable</component-family> <renderer-type>my.renderkit.dataTable</renderer-type> <renderer-class>my.project.component.table.MyDataTableRenderer</renderer-class> </renderer> ... Also, my my-project.taglib.xml file (as I use Facelets) looks like: <facelet-taglib> <namespace>http://my.project/jsf</namespace> <tag> <tag-name>dataTable</tag-name> <component> <component-type>my.component.dataTable</component-type> <renderer-type>my.renderkit.dataTable</renderer-type> </component> </tag> So as you can see, I have two classes in my project for my custom datatable: MyHtmlDataTable and MyDataTableRenderer. One of my idea is to modify the content of the <f:facet> directly in the doEncodeBegin() method of my renderer. This is working (in fact almost working), but I don't really think that's the better place to achieve my modification. What do you think? Technical information: JSF 1.2, Facelets, Richfaces 3.3.2, Java 1.6

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • MySQL LEFT OUTER JOIN virtual table

    - by user1707323
    I am working on a pretty complicated query let me try to explain it to you. Here is the tables that I have in my MySQL database: students Table --- `students` --- student_id first_name last_name current_status status_change_date ------------ ------------ ----------- ---------------- -------------------- 1 John Doe Active NULL 2 Jane Doe Retread 2012-02-01 students_have_courses Table --- `students_have_courses` --- students_student_id courses_course_id s_date e_date int_date --------------------- ------------------- ---------- ---------- ----------- 1 1 2012-01-01 2012-01-04 2012-01-05 1 2 2012-01-05 NULL NULL 2 1 2012-01-10 2012-01-11 NULL students_have_optional_courses Table --- `students_have_optional_courses` --- students_student_id optional_courses_opcourse_id s_date e_date --------------------- ------------------------------ ---------- ---------- 1 1 2012-01-02 2012-01-03 1 1 2012-01-06 NULL 1 5 2012-01-07 NULL Here is my query so far SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_have_optional_courses`.optional_courses_opcourse_id, `students_have_optional_courses`.s_date, `students_have_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN `students_have_optional_courses` ON ( `students_have_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_have_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_have_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id; What I want to be returned is the student_id, first_name, and last_name for all Active or Retread students and then LEFT JOIN the highest course_id, s_date, e_date, and int_date for the those students where the s_date is since the status_change_date if status is 'Retread'. Then LEFT JOIN the highest optional_courses_opcourse_id, s_date, and e_date from the students_have_optional_courses TABLE where the students_have_optional_courses.s_date is greater or equal to the students_have_courses.s_date and the students_have_optional_courses.e_date IS NULL Here is what is being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 1 2012-01-06 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Here is what I want being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 5 2012-01-07 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Everything is working except one thing, I cannot seem to get the highest students_have_optional_courses.optional_courses_opcourse_id no matter how I form the query Sorry, I just solved this myself after writing this all out I think it helped me think of the solution. Here is the solution query: SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_optional_courses`.optional_courses_opcourse_id, `students_optional_courses`.s_date, `students_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN ( SELECT * FROM `students_have_optional_courses` ORDER BY `students_have_optional_courses`.optional_courses_opcourse_id DESC ) `students_optional_courses` ON ( `students_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id;

    Read the article

  • SQL query - choosing 'last updated' record in a group, better db design?

    - by Jimmy
    Hi, Let's say I have a MySQL database with 3 tables: table 1: Persons, with 1 column ID (int) table 2: Newsletters, with 1 column ID (int) table 3: Subscriptions, with columns Person_ID (int), Newsletter_ID (int), Subscribed (bool), Updated (Datetime) Subscriptions.Person_ID points to a Person, and Subscription.Newsletter_ID points to a Newsletter. Thus, each person may have 0 or more subscriptions to 0 or more magazines at once. The table Subscriptions will also store the entire history of each person's subscriptions to each newsletter. If a particular Person_ID-Newsletter_ID pair doesn't have a row in the Subscriptions table, then it's equivalent to that pair having a subscription status of 'false'. Here is a sample dataset Persons ID 1 2 3 Newsletters ID 4 5 6 Subscriptions Person_ID Newsletter_ID Subscribed Updated 2 4 true 2010-05-01 3 4 true 2010-05-01 3 5 true 2010-05-10 3 4 false 2010-05-15 Thus, as of 2010-05-16, Person 1 has no subscription, Person 2 has a subscription to Newsletter 4, and Person 3 has a subscription to Newsletter 5. Person 3 had a subscription to Newsletter 4 for a while, but not anymore. I'm trying to do 2 kinds of query. A query that shows everyone's active subscriptions as of query time (we can assume that updated will never be in the future -- thus, this means returning the record with the latest 'updated' value for each Person_ID-Newsletter_ID pair, as long as Subscribed is true (if the latest record for a Person_ID-Newsletter_ID pair has a Subscribed status of false, then I don't want that record returned)). A query that returns all active subscriptions for a specific newsletter - same qualification as in 1. regarding records with 'false' in the Subscribed column. I don't use SQL/databases often enough to tell if this design is good, or if the SQL queries needed would be slow on a database with, say, 1M records in the Subscriptions table. I was using the Visual query builder tool in Visual Studio 2010 but I can't even get the query to return the latest updated record for each Person_ID-Newsletter_ID pair. Is it possible to come up with SQL queries that don't involve using subqueries (presumably because they would become too slow with a larger data set)? If not, would it be a better design to have a separate Subscriptions_History table, and every time a subscription status for a Person_ID-Newsletter-ID pair is added to Subscriptions, any existing record for that pair is moved to Subscriptions_History (that way the Subscriptions table only ever contains the latest status update for any Person_ID-Newsletter_ID pair)? I'm using .net on Windows, so would it be easier (or the same, or harder) to do this kind of queries using Linq? Entity Framework? Thanks!

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • How do I handle the Maybe result of at in Control.Lens.Indexed without a Monoid instance

    - by Matthias Hörmann
    I recently discovered the lens package on Hackage and have been trying to make use of it now in a small test project that might turn into a MUD/MUSH server one very distant day if I keep working on it. Here is a minimized version of my code illustrating the problem I am facing right now with the at lenses used to access Key/Value containers (Data.Map.Strict in my case) {-# LANGUAGE OverloadedStrings, GeneralizedNewtypeDeriving, TemplateHaskell #-} module World where import Control.Applicative ((<$>),(<*>), pure) import Control.Lens import Data.Map.Strict (Map) import qualified Data.Map.Strict as DM import Data.Maybe import Data.UUID import Data.Text (Text) import qualified Data.Text as T import System.Random (Random, randomIO) newtype RoomId = RoomId UUID deriving (Eq, Ord, Show, Read, Random) newtype PlayerId = PlayerId UUID deriving (Eq, Ord, Show, Read, Random) data Room = Room { _roomId :: RoomId , _roomName :: Text , _roomDescription :: Text , _roomPlayers :: [PlayerId] } deriving (Eq, Ord, Show, Read) makeLenses ''Room data Player = Player { _playerId :: PlayerId , _playerDisplayName :: Text , _playerLocation :: RoomId } deriving (Eq, Ord, Show, Read) makeLenses ''Player data World = World { _worldRooms :: Map RoomId Room , _worldPlayers :: Map PlayerId Player } deriving (Eq, Ord, Show, Read) makeLenses ''World mkWorld :: IO World mkWorld = do r1 <- Room <$> randomIO <*> (pure "The Singularity") <*> (pure "You are standing in the only place in the whole world") <*> (pure []) p1 <- Player <$> randomIO <*> (pure "testplayer1") <*> (pure $ r1^.roomId) let rooms = at (r1^.roomId) ?~ (set roomPlayers [p1^.playerId] r1) $ DM.empty players = at (p1^.playerId) ?~ p1 $ DM.empty in do return $ World rooms players viewPlayerLocation :: World -> PlayerId -> RoomId viewPlayerLocation world playerId= view (worldPlayers.at playerId.traverse.playerLocation) world Since rooms, players and similar objects are referenced all over the code I store them in my World state type as maps of Ids (newtyped UUIDs) to their data objects. To retrieve those with lenses I need to handle the Maybe returned by the at lens (in case the key is not in the map this is Nothing) somehow. In my last line I tried to do this via traverse which does typecheck as long as the final result is an instance of Monoid but this is not generally the case. Right here it is not because playerLocation returns a RoomId which has no Monoid instance. No instance for (Data.Monoid.Monoid RoomId) arising from a use of `traverse' Possible fix: add an instance declaration for (Data.Monoid.Monoid RoomId) In the first argument of `(.)', namely `traverse' In the second argument of `(.)', namely `traverse . playerLocation' In the second argument of `(.)', namely `at playerId . traverse . playerLocation' Since the Monoid is required by traverse only because traverse generalizes to containers of sizes greater than one I was now wondering if there is a better way to handle this that does not require semantically nonsensical Monoid instances on all types possibly contained in one my objects I want to store in the map. Or maybe I misunderstood the issue here completely and I need to use a completely different bit of the rather large lens package?

    Read the article

  • Avoiding explicit recursion in Haskell

    - by Travis Brown
    The following simple function applies a given monadic function iteratively until it hits a Nothing, at which point it returns the last non-Nothing value. It does what I need, and I understand how it works. lastJustM :: (Monad m) => (a -> m (Maybe a)) -> a -> m a lastJustM g x = g x >>= maybe (return x) (lastJustM g) As part of my self-education in Haskell I'm trying to avoid explicit recursion (or at least understand how to) whenever I can. It seems like there should be a simple non-explicitly recursive solution in this case, but I'm having trouble figuring it out. I don't want something like a monadic version of takeWhile, since it could be expensive to collect all the pre-Nothing values, and I don't care about them anyway. I checked Hoogle for the signature and nothing shows up. The m (Maybe a) bit makes me think a monad transformer might be useful here, but I don't really have the intuitions I'd need to come up with the details (yet). It's probably either embarrassingly easy to do this or embarrassingly easy to see why it can't or shouldn't be done, but this wouldn't be the first time I've used self-embarrassment as a pedagogical strategy. Background: Here's a simplified working example for context: suppose we're interested in random walks in the unit square, but we only care about points of exit. We have the following step function: randomStep :: (Floating a, Ord a, Random a) => a -> (a, a) -> State StdGen (Maybe (a, a)) randomStep s (x, y) = do (a, gen') <- randomR (0, 2 * pi) <$> get put gen' let (x', y') = (x + s * cos a, y + s * sin a) if x' < 0 || x' > 1 || y' < 0 || y' > 1 then return Nothing else return $ Just (x', y') Something like evalState (lastJustM (randomStep 0.01) (0.5, 0.5)) <$> newStdGen will give us a new data point.

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >