Search Results

Search found 5842 results on 234 pages for 'break'.

Page 68/234 | < Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >

  • Anonymous comments not saved in Drupal

    - by Marco
    For some reason I can no longer post a comment as an Anonymous user in my Drupal installation. I haven't tried in a while, so I'm not quite sure when this functionality was broken. I have Services installed, and I can post anonymous comments using comment.save. I have altered the Input Formats if that could break something. I have enabled both post comments and access comments on the anonymous user. The comments does not show up in the database. In fact, the native Drupal function comment_save isn't called when I try to comment as Anonymous (I check this by adding print_r($edit);die(); at the top of the comment_save function in comment.module. Also I read something that not having a User with the UID 0 would break the Anonymous commenting, this user exists (obviously, since commenting through Services works) I have tried out the AntiSpam module, and posted a comment as Anonymous that would get caught(and did) in the spamfilter, but this module is now disabled. I'm really running out of ideas here, does anyone have any other suggestions on what to do? In the meanwhile I'm going to attempt to backtrack the code to figure out why comment_save() isn't being called. Edit: Anonymous users also don't have to submit email and such to post, if that matters in any way.

    Read the article

  • Contingent Header Category Label

    - by poindexter
    Right now the header has a bit of code in it that queries the section name and then uses that section name as the h1 title in the page. It works fine. However, I want to selectively break that operation in certain categories and give myself the ability to manually enter the h1 title for a given section. Here's what I'm struggling with: how can I maintain the automatic query and title selection in most instances, but selectively break it in a given category (the 'blog' category, for starters)? Thanks for taking a look, I appreciate your help! Here's the code that drives the existing function (it's the get_the_section_name part): <?php if(!is_home()){?> <div class="section <?php echo get_the_section_name();?>"> <?php $sectitle = get_the_section_name(); $sectitle = str_ireplace("-"," ",$sectitle); echo '<h1>' . $sectitle . '</h1>';?> <p class="breadcrumbs"> <?php if(function_exists('bcn_display')) { bcn_display(); } ?> </p> </div> <div class="columns"> <?php } ?> Here's a page that shows what it looks like displayed (see the title in the blue graphic underneath the main nav near the top of the page): http://69.20.59.228/category/blog/

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Creating reusable chunks of Linq to SQL

    - by tia
    Hi, I am trying to break up horrible linq to sql queries to make them a bit more readable. Say I want to return all orders for product which in the previous year had more than 100 orders. So, original query is: from o in _context.Orders where (from o1 in _context.Orders where o1.Year == o.Year - 1 && o1.Product == o.Product select o1).Count() > 100 select o; Messy. What I'd like to be able to do is to be able to break it down, eg: private IEnumerable<Order> LastSeasonOrders(Order order) { return (from o in _context.Orders where o.Year == order.Year - 1 && o.Product == order.Product select o); } which then lets me change the original query to: from o in _context.Orders where LastSeasonOrders(o).Count() > 100 select o; This doesn't seem to work, as I get method Blah has no supported translation to SQL when the query is run. Any quick tips on the correct way to achieve this?

    Read the article

  • Operating on rows and then on columns of a matrix produces code duplication

    - by Chetan
    I have the following (Python) code to check if there are any rows or columns that contain the same value: # Test rows -> # Check each row for a win for i in range(self.height): # For each row ... firstValue = None # Initialize first value placeholder for j in range(self.width): # For each value in the row if (j == 0): # If it's the first value ... firstValue = b[i][j] # Remember it else: # Otherwise ... if b[i][j] != firstValue: # If this is not the same as the first value ... firstValue = None # Reset first value break # Stop checking this row, there's no win here if (firstValue != None): # If first value has been set # First value placeholder now holds the winning player's code return firstValue # Return it # Test columns -> # Check each column for a win for i in range(self.width): # For each column ... firstValue = None # Initialize first value placeholder for j in range(self.height): # For each value in the column if (j == 0): # If it's the first value ... firstValue = b[j][i] # Remember it else: # Otherwise ... if b[j][i] != firstValue: # If this is not the same as the first value ... firstValue = None # Reset first value break # Stop checking this column, there's no win here if (firstValue != None): # If first value has been set # First value placeholder now holds the winning player's code return firstValue # Return it Clearly, there is a lot of code duplication here. How do I refactor this code? Thanks!

    Read the article

  • Why notify listeners in a content provider query method?

    - by cbrulak
    Vegeolla has this blog post about content providers and the snippet below (at the bottom) with this line: cursor.setNotificationUri(getContext().getContentResolver(), uri); I'm curious as to why one would want to notify listeners about a query operation. Am I missing something? Thanks @Override public Cursor query(Uri uri, String[] projection, String selection, String[] selectionArgs, String sortOrder) { // Uisng SQLiteQueryBuilder instead of query() method SQLiteQueryBuilder queryBuilder = new SQLiteQueryBuilder(); // Check if the caller has requested a column which does not exists checkColumns(projection); // Set the table queryBuilder.setTables(TodoTable.TABLE_TODO); int uriType = sURIMatcher.match(uri); switch (uriType) { case TODOS: break; case TODO_ID: // Adding the ID to the original query queryBuilder.appendWhere(TodoTable.COLUMN_ID + "=" + uri.getLastPathSegment()); break; default: throw new IllegalArgumentException("Unknown URI: " + uri); } SQLiteDatabase db = database.getWritableDatabase(); Cursor cursor = queryBuilder.query(db, projection, selection, selectionArgs, null, null, sortOrder); // Make sure that potential listeners are getting notified cursor.setNotificationUri(getContext().getContentResolver(), uri); return cursor; }

    Read the article

  • Visual Studio 2008 Installer, Custom Action. Breakpoint not firing.

    - by Snake
    Hi, I've got an installer with a custom action project. I want the action to fire at install. The action fires, when I write something to the event log, it works perfectly. But I really need to debug the file since the action is quite complicated. So I've got the following installer class: namespace InstallerActions { using System; using System.Collections; using System.Collections.Generic; using System.ComponentModel; using System.Configuration.Install; using System.Diagnostics; using System.IO; [RunInstaller(true)] // ReSharper disable UnusedMember.Global public partial class DatabaseInstallerAction : Installer // ReSharper restore UnusedMember.Global { public DatabaseInstallerAction() { InitializeComponent(); } public override void Install(IDictionary stateSaver) { base.Install(stateSaver); System.Diagnostics.Debugger.Launch(); System.Diagnostics.Debugger.Break(); // none of these work Foo(); } private static void Foo() { } } } The installer just finalizes without warning me, it doesn't break, it doesn't ask me to attach a debugger. I've tried debug and release mode. Am I missing something? Thanks -Snake

    Read the article

  • Chrome extension sendRequest from async callback not working?

    - by Eugene
    Can't figure out what's wrong. onRequest not triggered on call from async callback method, the same request from content script works. The sample code below. background.js ============= ... makeAsyncRequest(); ... chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { switch (request.id) { case "from_content_script": // This works console.log("from_content_script"); sendResponse({}); // clean up break; case "from_async": // Not working! console.log("from_async"); sendResponse({}); // clean up break; } }); methods.js ========== makeAsyncRequest = function() { ... var xhr = new XMLHttpRequest(); xhr.onreadystatechange = function() { if (xhr.readyState == 4) { ... // It works console.log("makeAsyncRequest callback"); chrome.extension.sendRequest({id: "from_async"}, function(response) { }); } } ... }; UPDATE: manifest configuration file. Don't no what's wrong here. { "name": "TestExt", "version": "0.0.1", "icons": { "48": "img/icon-48-green.gif" }, "description": "write it later", "background_page": "background.html", "options_page": "options.html", "browser_action": { "default_title": "TestExt", "default_icon": "img/icon-48-green.gif" }, "permissions": [ "tabs", "http://*/*", "https://*/*", "file://*/*", "webNavigation" ] }

    Read the article

  • How to start/stop/restart jQuery animation

    - by Emin
    I have the following function that when I call displays a message to the user for a certain amount of time (5 secs in my case). During this "period" if I call the function again to display another message, practically it should hide, then re-appear with the new message for another 5 seconds. What happens with my code below, I call the function to display the message. Then, lets say on the 4th second, I call it again to display another message, the new message is displayed for 1 second. I need to somehow -reset- the time but can't figure out how. Tried stopping the animation, checking if the element was visible and hiding it if it was, and many other things. I believe the solution is a simple chaining issue but can't get it right. So any help would be appreciated! function display_message(msgType, message) { var elem = $('#ur_messagebox'); switch (msgType) { case 'confirm': elem.addClass('msg_confirm'); break; case 'error': elem.addClass('msg_error'); break; } elem.html(message); elem.show().delay(5000).fadeOut(1000); } thanks in advance...

    Read the article

  • Debug formatting code

    - by Arcadian
    I'm trying to debug my code here: private void CheckFormatting() { StringReader objReaderf = new StringReader(txtInput.Text); List<String> formatTextList = new List<String>(); do { formatTextList.Add(objReaderf.ReadLine()); } while (objReaderf.Peek() != -1); objReaderf.Close(); for (int i = 0; i < formatTextList.Count; i++) { if (!Regex.IsMatch(formatTextList[i], "G[0-9]{2}:[0-9]{2}:[0-9]{2}:[0-9]{2} JG[0-9]{2")) { MessageBox.Show("Line " + formatTextList[i] + " is not formatted correctly.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error); break; } else { this.WriteToFile(); MessageBox.Show("Your entries have been saved.", "Saved", MessageBoxButtons.OK, MessageBoxIcon.Information); } } } what it is supposed to do is to check each line in the list. if one of them isn't formatted correctly, then break the loop and display a message box, if all the lines are formatted properly then it should call the WriteToFile method. However, when testing it using input that WAS correctly formatted it displayed the error message and broke the loop. Anyone figure out why? There's some rep points in it for you :) Thanks in advance

    Read the article

  • Query String to Object with strongly typed properties

    - by Kamar
    Let’s say we track 20 query string parameters in our site. Each request which comes will have only a subset of those 20 parameters. But we definitely look for all/most of the parameters which comes in each request. We do not want to loop through the collection each time we are looking for a particular parameter initially or somewhere down the pipeline in the code. So we loop once through the query string collection, convert string values to their respective types (enums, int, string etc.), populate to QueryString object which is added to the context. After that wherever its needed we will have a strongly typed properties in the QueryString object which is easy to use and we maintain a standard. public class QueryString { public int Key1{ get; private set; } public SomeType Key2{ get; private set; } private QueryString() { } public static QueryString GetQueryString() { QueryString l_QS = new QueryString(); foreach (string l_Key in HttpContext.Current.Request.QueryString.AllKeys) { switch (l_Key) { case "key1": l_QS.Key1= DoSomething(l_Key, HttpContext.Current.Request.QueryString[l_Key]); break; case "key2": l_QS.Key2 = DoAnotherThing(l_Key, HttpContext.Current.Request.QueryString[l_Key]); break; } } return l_QS; } } Any other solution to achieve this?

    Read the article

  • Wrapping text and div as a unit

    - by mathee
    I have the following that I would like wrapped as units. <div class='tag-box'> <a href=#>Axe Committee</a> <div class='circle'><a href=#>x</a></div> </div> The CSS for these classes are: .tag-box { display:inline; } .circle { display:inline; padding-left:4px; padding-right:4px; background:rgb(196,15,24); /*dark red*/ -moz-border-radius:10px; -webkit-border-radius:10px; } .circle a { font-size:10px; text-decoration:none; color:#fff; position:relative; top:-2px; } I can have upwards of 20 or 30 of these tag-boxes displayed inline. The problem is that the wrapping will break the words from each other or even break the red circle from the link. This makes it hard to differentiate which circle belongs to which link. (In the future, each circle corresponds to a different action with respect to the link.) See below. How do I prevent this kind of wrapping from occurring?

    Read the article

  • SSRS code variable resetting on new page

    - by edmicman
    In SSRS 2008 I am trying to maintain a SUM of SUMs on a group using custom Code. The reason is that I have a table of data, grouped and returning SUMs of the data. I have a filter on the group to remove lines where group sums are zero. Everything works except I'm running into problems with the group totals - it should be summing the visible group totals but is instead summing the entire dataset. There's tons of articles about how to work around this, usually using custom code. I've made custom functions and variables to maintain a counter: Public Dim GroupMedTotal as Integer Public Dim GrandMedTotal as Integer Public Function CalcMedTotal(ThisValue as Integer) as Integer GroupMedTotal = GroupMedTotal + ThisValue GrandMedTotal = GrandMedTotal + ThisValue Return ThisValue End Function Public Function ReturnMedSubtotal() as Integer Dim ThisValue as Integer = GroupMedTotal GroupMedTotal = 0 Return ThisValue End Function Basically CalcMedTotal is fed a SUM of a group, and maintains a running total of that sum. Then in the group total line I output ReturnMedSubtotal which is supposed to give me the accumulated total and reset it for the next group. This actually works great, EXCEPT - it is resetting the GroupMedTotal value on each page break. I don't have page breaks explicitly set, it's just the natural break in the SSRS viewer. And if I export the results to Excel everything works and looks correctly. If I output Code.GroupMedTotal on each group row, I see it count correctly, and then if a group spans multiple pages on the next page GroupMedTotal is reset and begins counting from zero again. Any help in what's going on or how to work around this? Thanks!

    Read the article

  • How to get address of va_arg?

    - by lionbest
    I hack some old C API and i got a compile error with the following code: void OP_Exec( OP* op , ... ) { int i; va_list vl; va_start(vl,op); for( i = 0; i < op->param_count; ++i ) { switch( op->param_type[i] ) { case OP_PCHAR: op->param_buffer[i] = va_arg(vl,char*); // ok it works break; case OP_INT: op->param_buffer[i] = &va_arg(vl,int); // error here break; // ... more here } } op->pexec(op); va_end(vl); } The error with gcc version 4.4.1 (Ubuntu 4.4.1-4ubuntu9) was: main.c|55|error: lvalue required as unary ‘&’ operand So why exactly it's not possible here to get a pointer to argument? How to fix it? This code is executed very often with different OP*, so i prefer to not allocate extra memory. Is it possible to iterate over va_list knowing only the size of arguments?

    Read the article

  • Load images into separate movie clips from a XML, Flash, Actionscript 3.0

    - by James Dunay
    I have an xml image bank, pretty standard, and I have a loader, along with movie clips that I want the images loaded into, the problem that I am running into is I want the images to load into separate movie clips, so I’m using a case statement to specify where they go. However, I can only get them to load into a single movie clip, I assume they are loading ontop of each other and I don’t know how to get them to separate out. I’ll post my code. It doesn’t make any sense to me but if you have any suggestions that would be real great. I can make separate loaders and then just do 1 image per loader, but that just doesn’t sound right to me. var counterNumber:Number = 0; function callThumbs():void{ for (var i:Number = 0; i <3; i++){ thumbLoaded(); counterNumber++; } } function thumbLoaded(){ var photoLoader = new Loader(); switch (counterNumber){ case 1: photoLoader.load(new URLRequest(MovieClip(this.parent).xml.photos.imageOne.image.@url[0])); whole.boxOne.pictureLoader.addChild(photoLoader); trace("1Done"); break; case 2: photoLoader.load(new URLRequest(MovieClip(this.parent).xml.photos.imageTwo.image.@url[0])); whole.boxTwo.pictureLoader.addChild(photoLoader); trace("2Done"); break; } }

    Read the article

  • Python : How to close a UDP socket while is waiting for data in recv ?

    - by alexroat
    Hello, let's consider this code in python: import socket import threading import sys import select class UDPServer: def __init__(self): self.s=None self.t=None def start(self,port=8888): if not self.s: self.s=socket.socket(socket.AF_INET, socket.SOCK_DGRAM) self.s.bind(("",port)) self.t=threading.Thread(target=self.run) self.t.start() def stop(self): if self.s: self.s.close() self.t.join() self.t=None def run(self): while True: try: #receive data data,addr=self.s.recvfrom(1024) self.onPacket(addr,data) except: break self.s=None def onPacket(self,addr,data): print addr,data us=UDPServer() while True: sys.stdout.write("UDP server> ") cmd=sys.stdin.readline() if cmd=="start\n": print "starting server..." us.start(8888) print "done" elif cmd=="stop\n": print "stopping server..." us.stop() print "done" elif cmd=="quit\n": print "Quitting ..." us.stop() break; print "bye bye" It runs an interactive shell with which I can start and stop an UDP server. The server is implemented through a class which launches a thread in which there's a infinite loop of recv/*onPacket* callback inside a try/except block which should detect the error and the exits from the loop. What I expect is that when I type "stop" on the shell the socket is closed and an exception is raised by the recvfrom function because of the invalidation of the file descriptor. Instead, it seems that recvfrom still to block the thread waiting for data even after the close call. Why this strange behavior ? I've always used this patter to implements an UDP server in C++ and JAVA and it always worked. I've tried also with a "select" passing a list with the socket to the xread argument, in order to get an event of file descriptor disruption from select instead that from recvfrom, but select seems to be "insensible" to the close too. I need to have a unique code which maintain the same behavior on Linux and Windows with python 2.5 - 2.6. Thanks.

    Read the article

  • Why is this MySQL INSERT INTO running twice?

    - by stuboo
    I'm attempting to use the mysql insert statement below to add information to a database table. When I execute the script, however, the insert statement is run twice. Here's the URL mysite.com/save.php?Body=p220,c180 Thanks in advance. <?php //tipping fees application require('base.inc.php'); require('functions.inc.php'); // connect to the database & save this message there try { $dbh = new PDO("mysql:host=$dbhost;dbname=$dbname", $dbuser, $dbpass); //$number = formatPhone($_REQUEST['From']); //if($number != 'xxx-xxx-xxxx'){die('SMS from unknown number');} // kill this if from anyone but mike $message = $_REQUEST['Body']; //$Sid = $_REQUEST['SmsSid']; $now = time(); echo $message; $message = explode(",",$message); echo '<pre>'; print_r($message); echo 'message count = '.count($message); echo '</pre>'; $i = 0; $j = count($message); while($i<$j){ $quantity =$message[$i]; $material = substr($quantity, 0, 1); $amount = substr($quantity, 1); switch ($material) { case 'p': $m = "paper"; break; case 'c': $m = "containers"; break; default: $m = "other"; } $count = $dbh->exec("INSERT INTO tippingtotals(sid,time,material,weight) VALUES('$i+$j','$now','$m','$amount')"); echo $count; echo '<br />'; $i++; } //close the database connection $dbh = null; } catch(PDOException $e) { echo $e->getMessage(); } ?>

    Read the article

  • How to get child nodes after store load

    - by Azincourt
    Version: ExtJs 4.1 To change the child items I use this function: TreeStore (Ext.data.TreeStore) storeId : 'treeStore', ... constructor: function( oConfig ) { ... this.on( 'expand', function( oObj ) { oObj.eachChild(function(oNode) { switch(oNode.data.type) { case "report": oNode.set('icon', strIconReport); break; case "view": oNode.set('icon', strIconView); break; } }); }); Reload After removing or adding items in the tree, I reload the tree somewhere else with: var oStore = Ext.getStore('treeStore'); oStore.load({ node : oNode, params : { newpath : oNode.data.path, overwrite : true } }); Although it is the same store treeStore, after loading and expanding to the correct path, the icons are not changed since the .on( 'expand') function is not called. Why? Question How can I change the icons of this newly loaded store before it expands to the node path? What I tried Before calling .load() I tried to edit the children with oNode.eachChild(function(oChild) {} but no success.

    Read the article

  • anti-if campaign

    - by Andrew Siemer
    I recently ran against a very interesting site that expresses a very interesting idea - the anti-if campaign. You can see this here at www.antiifcampaign.com. I have to agree that complex nested IF statements are an absolute pain in the rear. I am currently on a project that up until very recently had some crazy nested IFs that scrolled to the right for quite a ways. We cured our issues in two ways - we used Windows Workflow Foundation to address routing (or workflow) concerns. And we are in the process of implementing all of our business rules utilizing ILOG Rules for .NET (recently purchased by IBM!!). This for the most part has cured our nested IF pains...but I find myself wondering how many people cure their pains in the manner that the good folks at the AntiIfCampaign suggest (see an example here) by creating numerous amounts of abstract classes to represent a given scenario that was originally covered by the nested IF. I wonder if another way to address the removal of this complexity might also be in using an IoC container such as StructureMap to move in and out of different bits of functionality. Either way... Question: Given a scenario where I have a nested complex IF or SWITCH statement that is used to evaluate a given type of thing (say evaluating an Enum) to determine how I want to handle the processing of that thing by enum type - what are some ways to do the same form of processing without using the IF or SWITCH hierarchical structure? public enum WidgetTypes { Type1, Type2, Type3, Type4 } ... WidgetTypes _myType = WidgetTypes.Type1; ... switch(_myType) { case WidgetTypes.Type1: //do something break; case WidgetTypes.Type2: //do something break; //etc... }

    Read the article

  • Good Replacement for User Control?

    - by David Lively
    I found user controls to be incredibly useful when working with ASP.NET webforms. By encapsulating the code required for displaying a control with the markup, creation of reusable components was very straightforward and very, very useful. While MVC provides convenient separation of concerns, this seems to break encapsulation (ie, you can add a control without adding or using its supporting code, leading to runtime errors). Having to modify a controller every time I add a control to a view seems to me to integrate concerns, not separate them. I'd rather break the purist MVC ideology than give up the benefits of reusable, packaged controls. I need to be able to include components similar to webforms user controls throughout a site, but not for the entire site, and not at a level that belongs in a master page. These components should have their own code not just markup (to interact with the business layer), and it would be great if the page controller didn't need to know about the control. Since MVC user controls don't have codebehind, I can't see a good way to do this. I've searched previous SO questions, and have yet to find a good answer. Options so far In an attempt to avoid turning the comments section into a discussion... RenderAction This allows the view to call another controller, which will be responsible for interacting with the BLL and whatever data is necessary to its corresponding view. The calling view needs to be aware of the sub controller. This seems to provide a nice way to encapsulate partial views and controls, without having to modify the calling controller. RenderPartial The calling controller is still responsible for executing whatever code is associated with the partial view, and making sure that the model passed to the partial view contains the data it expects. Effectively, modifying the partial view potentially means modifying the calling controller. Annoying especially if this is used in multiple places. Portable Areas Place each control in its own project/area?

    Read the article

  • Load random swf object with jquery

    - by Eggnog
    I'm working on a site that utilizes full screen background video. I have three flash videos I'd like to load into the page which would be displayed randomly on page refresh. I know you can achieve this through action script loading the movies into one main .swf, but I'm rubbish with Flash and am looking for an alternative solution. My search so far has uncovered a method using jquery. Unfortunately my attempts to implement it have failed. I'm hoping someone more knowledgeable than myself can tell me if this technique is valid or what I'm doing wrong. Here's my code to date: <script type="text/javascript" src="files/js/swfobject.js"></script> <script type="text/javascript"> $(document).ready(function() { var sPath; var i = Math.floor(Math.random()*2); switch(i) { case 0: sPath = "flash/homepage_video.swf"; break; case 1: sPath = "flash/homepage_video.swf"; break; } // load the flash version of the image var so = new SWFObject(sPath, "flash-background", "100%", "100%"); so.addParam("scale", "exactFit"); so.addParam("movie", sPath); // NOTE: the sPath variable is also used here so.addParam("quality", "high"); so.addParam("wmode", "transparent"); so.write("homeBackground"); // NOTE: The value in this call to write() MUST match the name of the // HTML element (<div>) you're expecting the swf to show up in }); </script> <body> <div id="homeBackground"> <p>This is alternative content</p> </div> </body> I'm open to other suggestions that don't involve jquery (php perhaps). Thanks.

    Read the article

  • Delphi: How to avoid EIntOverflow underflow when subtracting?

    - by Ian Boyd
    Microsoft already says, in the documentation for GetTickCount, that you could never compare tick counts to check if an interval has passed. e.g.: Incorrect (pseudo-code): DWORD endTime = GetTickCount + 10000; //10 s from now ... if (GetTickCount > endTime) break; The above code is bad because it is suceptable to rollover of the tick counter. For example, assume that the clock is near the end of it's range: endTime = 0xfffffe00 + 10000 = 0x00002510; //9,488 decimal Then you perform your check: if (GetTickCount > endTime) Which is satisfied immediatly, since GetTickCount is larger than endTime: if (0xfffffe01 > 0x00002510) The solution Instead you should always subtract the two time intervals: DWORD startTime = GetTickCount; ... if (GetTickCount - startTime) > 10000 //if it's been 10 seconds break; Looking at the same math: if (GetTickCount - startTime) > 10000 if (0xfffffe01 - 0xfffffe00) > 10000 if (1 > 10000) Which is all well and good in C/C++, where the compiler behaves a certain way. But what about Delphi? But when i perform the same math in Delphi, with overflow checking on ({Q+}, {$OVERFLOWCHECKS ON}), the subtraction of the two tick counts generates an EIntOverflow exception when the TickCount rolls over: if (0x00000100 - 0xffffff00) > 10000 0x00000100 - 0xffffff00 = 0x00000200 What is the intended solution for this problem? Edit: i've tried to temporarily turn off OVERFLOWCHECKS: {$OVERFLOWCHECKS OFF}] delta = GetTickCount - startTime; {$OVERFLOWCHECKS ON} But the subtraction still throws an EIntOverflow exception. Is there a better solution, involving casts and larger intermediate variable types?

    Read the article

  • ASP.NET Web Application: use 1 or multiple virtual directories

    - by tster
    I am working on a (largish) internal web application which has multiple modules (security, execution, features, reports, etc.). All the pages in the app share navigation, CSS, JS, controls, etc. I want to make a single "Web Application" project, which includes all the pages for the app, then references various projects which will have the database and business logic in them. However, some of the people on the project want to have separate projects for the pages of each module. To make this more clear, this is what I'm advocating to be the projects. /WebInterface* /SecurityLib /ExecutionLib etc... And here is what they are advocating: /SecurityInterface* /SecutiryLib /ExecutionInterface* /ExecutionLib etc... *project will be published to a virtual directory of IIS Basically What I'm looking for is the advantages of both approaches. Here is what I can think of so far: Single Virtual Directory Pros Modules can share a single MasterPage Modules can share UserControls (this will be common) Links to other modules are within the same Virtual directory, and thus don't need to be fully qualified. Less chance of having incompatible module versions together. Multiple Virtual Directories Pros Can publish a new version of a single module without disrupting other modules Module is more compartmentalized. Less likely that changes will break other modules. I don't buy those arguments though. First, using load balanced servers (which we will have) we should be able to publish new versions of the project with zero downtime assuming there are no breaking database changes. Second, If something "breaks" another module, then there is either an improper dependency or the break will show up eventually in the other module, when the developers copy over the latest version of the UserControl, MasterPage or dll. As a point of reference, there are about 10 developers on the project for about 50% of their time. The initial development will be about 9 months.

    Read the article

< Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >