Search Results

Search found 18191 results on 728 pages for 'single board'.

Page 680/728 | < Previous Page | 676 677 678 679 680 681 682 683 684 685 686 687  | Next Page >

  • Stepping into Ruby Meta-Programming: Generating proxy methods for multiple internal methods

    - by mstksg
    Hi all; I've multiply heard Ruby touted for its super spectacular meta-programming capabilities, and I was wondering if anyone could help me get started with this problem. I have a class that works as an "archive" of sorts, with internal methods that process and output data based on an input. However, the items in the archive in the class itself are represented and processed with integers, for performance purposes. The actual items outside of the archive are known by their string representation, which is simply number_representation.to_s(36). Because of this, I have hooked up each internal method with a "proxy method" that converts the input into the integer form that the archive recognizes, runs the internal method, and converts the output (either a single other item, or a collection of them) back into strings. The naming convention is this: internal methods are represented by _method_name; their corresponding proxy method is represented by method_name, with no leading underscore. For example: class Archive ## PROXY METHODS ## ## input: string representation of id's ## output: string representation of id's def do_something_with id result = _do_something_with id.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_pair id_1,id_2 result = _do_something_with_pair id_1.to_i(36), id_2.to_i(36) return nil if result == nil return result.to_s(36) end def do_something_with_these ids result = _do_something_with_these ids.map { |n| n.to_i(36) } return nil if result == nil return result.to_s(36) end def get_many_from id result = _get_many_from id return nil if result == nil # no sparse arrays returned return result.map { |n| n.to_s(36) } end ## INTERNAL METHODS ## ## input: integer representation of id's ## output: integer representation of id's def _do_something_with id # does something with one integer-represented id, # returning an id represented as an integer end def do_something_with_pair id_1,id_2 # does something with two integer-represented id's, # returning an id represented as an integer end def _do_something_with_these ids # does something with multiple integer ids, # returning an id represented as an integer end def _get_many_from id # does something with one integer-represented id, # returns a collection of id's represented as integers end end There are a couple of reasons why I can't just convert them if id.class == String at the beginning of the internal methods: These internal methods are somewhat computationally-intensive recursive functions, and I don't want the overhead of checking multiple times at every step There is no way, without adding an extra parameter, to tell whether or not to re-convert at the end I want to think of this as an exercise in understanding ruby meta-programming Does anyone have any ideas? edit The solution I'd like would preferably be able to take an array of method names @@PROXY_METHODS = [:do_something_with, :do_something_with_pair, :do_something_with_these, :get_many_from] iterate through them, and in each iteration, put out the proxy method. I'm not sure what would be done with the arguments, but is there a way to test for arguments of a method? If not, then simple duck typing/analogous concept would do as well.

    Read the article

  • php imap save massage to sent folder after sending

    - by user1108279
    I am stucked with this for two days. I am trying to use imap_append from PHP but no luck so far. I was able to to implement this code for single attachment but multiple attachments not working. <?php $authhost="{000.000.000.000:993/validate-cert/ssl}Sent"; $user="sadasd"; $pass="sadasd"; if ($mbox=imap_open( $authhost, $user, $pass)) { $dmy=date("d-M-Y H:i:s"); $filename="filename.pdf"; $attachment = chunk_split(base64_encode($filestring)); $boundary = "------=".md5(uniqid(rand())); $msg = ("From: Somebody\r\n" . "To: [email protected]\r\n" . "Date: $dmy\r\n" . "Subject: This is the subject\r\n" . "MIME-Version: 1.0\r\n" . "Content-Type: multipart/mixed; boundary=\"$boundary\"\r\n" . "\r\n\r\n" . "--$boundary\r\n" . "Content-Type: text/html;\r\n\tcharset=\"ISO-8859-1\"\r\n" . "Content-Transfer-Encoding: 8bit \r\n" . "\r\n\r\n" . "Hello this is a test\r\n" . "\r\n\r\n" . "--$boundary\r\n" . "Content-Transfer-Encoding: base64\r\n" . "Content-Disposition: attachment; filename=\"$filename\"\r\n" . "\r\n" . $attachment . "\r\n" . "\r\n\r\n\r\n" . "--$boundary--\r\n\r\n"); imap_append($mbox,$authhost,$msg); imap_close($mbox); } else { echo "<h1>FAIL!</h1>\n"; } ?> Now that raw code above is working but I am unable to add multiple attachments. In some cases I got message body base64 decoded and in message body lot of strange letters. Something like R0lGODlhkAEfAOYAAPSeZPONtdSIu+u2vv/La+5Rj8AhYPvWhOjtkfvi7MRImcjYse5DM6O+dOnl ..... I search all the web i still got no luck. Since I have dedicated server I also tried to implement some procmail+ postfix examples but also no luck. Can someone help?

    Read the article

  • Perl - Calling subclass constructor from superclass (OO)

    - by Emmel
    This may turn out to be an embarrassingly stupid question, but better than potentially creating embarrassingly stupid code. :-) This is an OO design question, really. Let's say I have an object class 'Foos' that represents a set of dynamic configuration elements, which are obtained by querying a command on disk, 'mycrazyfoos -getconfig'. Let's say that there are two categories of behavior that I want 'Foos' objects to have: Existing ones: one is, query ones that exist in the command output I just mentioned (/usr/bin/mycrazyfoos -getconfig`. Make modifications to existing ones via shelling out commands. Create new ones that don't exist; new 'crazyfoos', using a complex set of /usr/bin/mycrazyfoos commands and parameters. Here I'm not really just querying, but actually running a bunch of system() commands. Affecting changes. Here's my class structure: Foos.pm package Foos, which has a new($hashref-{name = 'myfooname',) constructor that takes a 'crazyfoo NAME' and then queries the existence of that NAME to see if it already exists (by shelling out and running the mycrazyfoos command above). If that crazyfoo already exists, return a Foos::Existing object. Any changes to this object requires shelling out, running commands and getting confirmation that everything ran okay. If this is the way to go, then the new() constructor needs to have a test to see which subclass constructor to use (if that even makes sense in this context). Here are the subclasses: Foos/Existing.pm As mentioned above, this is for when a Foos object already exists. Foos/Pending.pm This is an object that will be created if, in the above, the 'crazyfoo NAME' doesn't actually exist. In this case, the new() constructor above will be checked for additional parameters, and it will go ahead and, when called using -create() shell out using system() and create a new object... possibly returning an 'Existing' one... OR As I type this out, I am realizing it is perhaps it's better to have a single: (an alternative arrangement) Foos class, that has a -new() that takes just a name -create() that takes additional creation parameters -delete(), -change() and other params that affect ones that exist; that will have to just be checked dynamically. So here we are, two main directions to go with this. I'm curious which would be the more intelligent way to go.

    Read the article

  • How to handle environment-specific application configuration organization-wide?

    - by Stuart Lange
    Problem Your organization has many separate applications, some of which interact with each other (to form "systems"). You need to deploy these applications to separate environments to facilitate staged testing (for example, DEV, QA, UAT, PROD). A given application needs to be configured slightly differently in each environment (each environment has a separate database, for example). You want this re-configuration to be handled by some sort of automated mechanism so that your release managers don't have to manually configure each application every time it is deployed to a different environment. Desired Features I would like to design an organization-wide configuration solution with the following properties (ideally): Supports "one click" deployments (only the environment needs to be specified, and no manual re-configuration during/after deployment should be necessary). There should be a single "system of record" where a shared environment-dependent property is specified (such as a database connection string that is shared by many applications). Supports re-configuration of deployed applications (in the event that an environment-specific property needs to change), ideally without requiring a re-deployment of the application. Allows an application to be run on the same machine, but in different environments (run a PROD instance and a DEV instance simultaneously). Possible Solutions I see two basic directions in which a solution could go: Make all applications "environment aware". You would pass the environment name (DEV, QA, etc) at the command line to the app, and then the app is "smart" enough to figure out the environment-specific configuration values at run-time. The app could fetch the values from flat files deployed along with the app, or from a central configuration service. Applications are not "smart" as they are in #1, and simply fetch configuration by property name from config files deployed with the app. The values of these properties are injected into the config files at deploy-time by the install program/script. That install script takes the environment name and fetches all relevant configuration values from a central configuration service. Question How would/have you achieved a configuration solution that solves these problems and supports these desired features? Am I on target with the two possible solutions? Do you have a preference between those solutions? Also, please feel free to tell me that I'm thinking about the problem all wrong. Any feedback would be greatly appreciated.

    Read the article

  • (mySQL) Unable to query 2 tables properly for data

    - by Devner
    I have 2 tables. One is 'page_links' and the other is 'rpp'. Table page_links is the superset of table rpp. The following is the schema of my tables: -- Table structure for table `page_links` -- CREATE TABLE IF NOT EXISTS `page_links` ( `page` varchar(255) NOT NULL, `page_link` varchar(100) NOT NULL, `heading_id` tinyint(3) unsigned NOT NULL, PRIMARY KEY (`page`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `page_links` -- INSERT INTO `page_links` (`page`, `page_link`, `heading_id`) VALUES ('a1.php', 'A1', 8), ('b1.php', 'B1', 8), ('c1.php', 'C1', 5), ('d1.php', 'D1', 5), ('e1.php', 'E1', 8), ('f1.php', 'F1', 8), ('g1.php', 'G1', 8), ('h1.php', 'H1', 1), ('i1.php', 'I1', 1), ('j1.php', 'J1', 8), ('k1.php', 'K1', 8), ('l1.php', 'L1', 8), ('m1.php', 'M1', 8), ('n1.php', 'N1', 8), ('o1.php', 'O1', 8), ('p1.php', 'P1', 4), ('q1.php', 'Q1', 5), ('r1.php', 'R1', 4); -- Table structure for table `rpp` -- CREATE TABLE IF NOT EXISTS `rpp` ( `role_id` tinyint(3) unsigned NOT NULL, `page` varchar(255) NOT NULL, `is_allowed` tinyint(1) NOT NULL, PRIMARY KEY (`role_id`,`page`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `rpp` -- INSERT INTO `rpp` (`role_id`, `page`, `is_allowed`) VALUES (3, 'a1.php', 1), (3, 'b1.php', 1), (3, 'c1.php', 1), (3, 'd1.php', 1), (3, 'e1.php', 1), (3, 'f1.php', 1), (3, 'h1.php', 1), (3, 'i1.php', 1), (3, 'l1.php', 1), (3, 'm1.php', 1), (3, 'n1.php', 1), (4, 'a1.php', 1), (4, 'b1.php', 1), (4, 'q1.php', 1), (5, 'r1.php', 1); WHAT I AM TRYING TO DO: I am trying to query both the above tables (in a single query) in such a way that all the pages from page_links are displayed along with the is_allowed value from rpp for a particular role. For example, I want to get the is_allowed value of all the pages from rpp for role_id = 3 and at the same time, list all the available pages from page_links. A clear example of my expected result would be: page is_allowed role_id ---------------------------------------- a1.php 1 3 b1.php 1 3 c1.php 1 3 d1.php 1 3 e1.php 1 3 f1.php 1 3 g1.php NULL NULL h1.php 1 3 i1.php 1 3 j1.php NULL NULL k1.php NULL NULL l1.php 1 3 m1.php 1 3 n1.php 1 3 o1.php NULL NULL p1.php NULL NULL q1.php NULL NULL r1.php NULL NULL One more example of my desired result could be achieved by doing a LEFT JOIN rpp ON page_links.page = rpp.page but we need to omit using role_id = 3 (or any value) to be able to get that. But I do want to specify the role_id as well and get the results. I need the query to be able to get this result. I would appreciate any replies that could help me with this. If you can suggest me any changes as well to the table(s) design to be able to achieve the desired result, that's good as well. Thanks in advance.

    Read the article

  • android app crashes if keyboard was shown

    - by Jaume
    I have an activity that I force keyboard to appears using, InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.SHOW_FORCED, 0); keyboard appears properly and also obscured when needed. Problem is when I finish the activity, app crashes. If the activity never shows keyboard or shows it without start editing text, it is finished with no errors but if you just write one single character or more, app will crash. How to solve it? thank you. method used to finish activity, boto_back.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.HIDE_IMPLICIT_ONLY, 0); finish(); } }); @Override public void onDestroy() { if (adMob != null) { // Destroy the AdView. adMob.destroy(); } super.onDestroy(); } logcat, 07-07 19:04:25.191: E/AndroidRuntime(8443): FATAL EXCEPTION: main 07-07 19:04:25.191: E/AndroidRuntime(8443): java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.TabBar_iOSActivity}: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.handleDestroyActivity(ActivityThread.java:2711) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.access$2100(ActivityThread.java:121) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:976) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Handler.dispatchMessage(Handler.java:99) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Looper.loop(Looper.java:130) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.main(ActivityThread.java:3701) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invokeNative(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invoke(Method.java:507) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:866) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:624) 07-07 19:04:25.191: E/AndroidRuntime(8443): at dalvik.system.NativeStart.main(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): Caused by: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2603) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.LocalActivityManager.dispatchDestroy(LocalActivityManager.java:622) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityGroup.onDestroy(ActivityGroup.java:85) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.xxxx.projecte1.TabBar_iOSActivity.onDestroy(TabBar_iOSActivity.java:417) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2680) 07-07 19:04:25.191: E/AndroidRuntime(8443): ... 11 more

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • Hibernate3: Self-Referencing Objects

    - by monojohnny
    Need some help on understanding how to do this; I'm going to be running recursive 'find' on a file system and I want to keep the information in a single DB table - with a self-referencing hierarchial structure: This is my DB Table structure I want to populate. DirObject Table: id int NOT NULL, name varchar(255) NOT NULL, parentid int NOT NULL); Here is the proposed Java Class I want to map (Fields only shown): public DirObject { int id; String name; DirObject parent; ... For the 'root' directory was going to use parentid=0; real ids will start at 1, and ideally I want hibernate to autogenerate the ids. Can somebody provide a suggested mapping file for this please; as a secondary question I thought about doing the Java Class like this instead: public DirObject { int id; String name; List<DirObject> subdirs; Could I use the same data model for either of these two methods ? (With a different mapping file of course). --- UPDATE: so I tried the mapping file suggested below (thanks!), repeated here for reference: <hibernate-mapping> <class name="my.proj.DirObject" table="category"> ... <set name="subDirs" lazy="true" inverse="true"> <key column="parentId"/> <one-to-many class="my.proj.DirObject"/> </set> <many-to-one name="parent" class="my.proj.DirObject" column="parentId" cascade="all" /> </class> ...and altered my Java class to have BOTH 'parentid' and 'getSubDirs' [returning a 'HashSet']. This appears to work - thanks, but this is the test code I used to drive this - I think I'm not doing something right here, because I thought Hibernate would take care of saving the subordinate objects in the Set without me having to do this explicitly ? DirObject dirobject=new DirObject(); dirobject.setName("/files"); dirobject.setParent(dirobject); DirObject d1, d2; d1=new DirObject(); d1.setName("subdir1"); d1.setParent(dirobject); d2=new DirObject(); d2.setName("subdir2"); d2.setParent(dirobject); HashSet<DirObject> subdirs=new HashSet<DirObject>(); subdirs.add(d1); subdirs.add(d2); dirobject.setSubdirs(subdirs); session.save(dirobject); session.save(d1); session.save(d2);

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • What database table structure should I use for versions, codebases, deployables?

    - by Zac Thompson
    I'm having doubts about my table structure, and I wonder if there is a better approach. I've got a little database for version control repositories (e.g. SVN), the packages (e.g. Linux RPMs) built therefrom, and the versions (e.g. 1.2.3-4) thereof. A given repository might produce no packages, or several, but if there are more than one for a given repository then a particular version for that repository will indicate a single "tag" of the codebase. A particular version "string" might be used to tag a version of the source code in more than one repository, but there may be no relationship between "1.0" for two different repos. So if packages P and Q both come from repo R, then P 1.0 and Q 1.0 are both built from the 1.0 tag of repo R. But if package X comes from repo Y, then X 1.0 has no relationship to P 1.0. In my (simplified) model, I have the following tables (the x_id columns are auto-incrementing surrogate keys; you can pretend I'm using a different primary key if you wish, it's not really important): repository - repository_id - repository_name (unique) ... version - version_id - version_string (unique for a particular repository) - repository_id ... package - package_id - package_name (unique) - repository_id ... This makes it easy for me to see, for example, what are valid versions of a given package: I can join with the version table using the repository_id. However, suppose I would like to add some information to this database, e.g., to indicate which package versions have been approved for release. I certainly need a new table: package_version - version_id - package_id - package_version_released ... Again, the nature of the keys that I use are not really important to my problem, and you can imagine that the data column is "promotion_level" or something if that helps. My doubts arise when I realize that there's really a very close relationship between the version_id and the package_id in my new table ... they must share the same repository_id. Only a small subset of package/version combinations are valid. So I should have some kind of constraint on those columns, enforcing that ... ... I don't know, it just feels off, somehow. Like I'm including somehow more information than I really need? I don't know how to explain my hesitance here. I can't figure out which (if any) normal form I'm violating, but I also can't find an example of a schema with this sort of structure ... not being a DBA by profession I'm not sure where to look. So I'm asking: am I just being overly sensitive?

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • Sessions not persisting between requests

    - by klonq
    My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

    Read the article

  • What to Expect in Rails 4

    - by mikhailov
    Rails 4 is nearly there, we should be ready before it released. Most developers are trying hard to keep their application on the edge. Must see resources: 1) @sikachu talk: What to Expect in Rails 4.0 - YouTube 2) Rails Guides release notes: http://edgeguides.rubyonrails.org/4_0_release_notes.html There is a mix of all major changes down here: ActionMailer changes excerpt: Asynchronously send messages via the Rails Raise an ActionView::MissingTemplate exception when no implicit template could be found ActionPack changes excerpt Added controller-level etag additions that will be part of the action etag computation Add automatic template digests to all CacheHelper#cache calls (originally spiked in the cache_digests plugin) Add Routing Concerns to declare common routes that can be reused inside others resources and routes Added ActionController::Live. Mix it in to your controller and you can stream data to the client live truncate now always returns an escaped HTML-safe string. The option :escape can be used as false to not escape the result Added ActionDispatch::SSL middleware that when included force all the requests to be under HTTPS protocol ActiveModel changes excerpt AM::Validation#validates ability to pass custom exception to :strict option Changed `AM::Serializers::JSON.include_root_in_json' default value to false. Now, AM Serializers and AR objects have the same default behaviour Added ActiveModel::Model, a mixin to make Ruby objects work with AP out of box Trim down Active Model API by removing valid? and errors.full_messages ActiveRecord changes excerpt Use native mysqldump command instead of structure_dump method when dumping the database structure to a sql file. Attribute predicate methods, such as article.title?, will now raise ActiveModel::MissingAttributeError if the attribute being queried for truthiness was not read from the database, instead of just returning false ActiveRecord::SessionStore has been extracted from Active Record as activerecord-session_store gem. Please read the README.md file on the gem for the usage Fix reset_counters when there are multiple belongs_to association with the same foreign key and one of them have a counter cache Raise ArgumentError if list of attributes to change is empty in update_all Add Relation#load. This method explicitly loads the records and then returns self Deprecated most of the 'dynamic finder' methods. All dynamic methods except for find_by_... and find_by_...! are deprecated Added ability to ActiveRecord::Relation#from to accept other ActiveRecord::Relation objects Remove IdentityMap ActiveSupport changes excerpt ERB::Util.html_escape now escapes single quotes ActiveSupport::Callbacks: deprecate monkey patch of object callbacks Replace deprecated memcache-client gem with dalli in ActiveSupport::Cache::MemCacheStore Object#try will now return nil instead of raise a NoMethodError if the receiving object does not implement the method, but you can still get the old behavior by using the new Object#try! Object#try can't call private methods Add ActiveSupport::Deprecations.behavior = :silence to completely ignore Rails runtime deprecations What are the most important changes for you?

    Read the article

  • small scale web site - global javascript file style/format/pattern - improving maintainability

    - by yaya3
    I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

    - by Globalkeith
    Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

    Read the article

  • I'm searching for a messaging platform (like XMPP) that allows tight integration with a web applicat

    - by loxs
    Hi, At the company I work for, we are building a cluster of web applications for collaboration. Things like accounting, billing, CRM etc. We are using a RESTfull technique: For database we use CouchDB Different applications communicate with one another and with the database via http. Besides, we have a single sign on solution, so that when you login in one application, you are automatically logged to the other. For all apps we use Python (Pylons). Now we need to add instant messaging to the stack. We need to support both web and desktop clients. But just being able to chat is not enough. We need to be able to achieve all of the following (and more similar things). When somebody gets assigned to a task, they must receive a message. I guess this is possible with some system daemon. There must be an option to automatically group people in groups by lots of different properties. For example, there must be groups divided both by geographical location, by company division, by job type (all the programers from different cities and different company divisions must form a group), so that one can send mass messages to a group of choice. Rooms should be automatically created and destroyed. For example when several people visit the same invoice, a room for them must be automatically created (and they must auto-join). And when all leave the invoice, the room must be destroyed. Authentication and authorization from our applications. I can implement this using custom solutions like hookbox http://hookbox.org/docs/intro.html but then I'll have lots of problems in supporting desktop clients. I have no former experience with instant messaging. I've been reading about this lately. I've been looking mostly at things like ejabberd. But it has been a hard time and I can't find whether what I want is possible at all. So I'd be happy if people with experience in this field could help me with some advice, articles, tales of what is possible etc.

    Read the article

  • JavaScript code inside UpdatePanel

    - by Ed Woodcock
    Ok: I've got an UpdatePanel on an aspx page that contains a single Placeholder. Inside this placeholder I'm appending one of a selection of usercontrols depending on certain external conditions (this is a configuration page). In each of these usercontrols there is a bindUcEvents() javascript function that binds the various jQuery and javascript events to buttons and validators inside the usercontrol. The issue I'm having is that the usercontrol's javascript is not being recognised. Normally, javascript inside an updatepanel is executed when the updatepanel posts back, however none of this code can be found by the page (I've tried running the function manually via firebug's console, but it tells me it cannot find the function). Does anyone have any suggestions? Cheers, Ed. EDIT: cut down (but functional) example: Markup: <script src="/js/jquery-1.3.2.min.js"></script> <form id="form1" runat="server"> <div> <asp:ScriptManager ID="Script" runat="server" /> <asp:Button ID="Postback" runat="server" Text="Populate" OnClick="PopulatePlaceholder" /> <asp:UpdatePanel ID="UpdateMe" runat="server"> <Triggers> <asp:AsyncPostBackTrigger ControlID="Postback" EventName="Click" /> </Triggers> <ContentTemplate> <asp:Literal ID="Code" runat="server" /> <asp:PlaceHolder ID="PlaceMe" runat="server" /> </ContentTemplate> </asp:UpdatePanel> </div> </form> C#: protected void PopulatePlaceholder(object sender, EventArgs e) { Button button = new Button(); button.ID = "Push"; button.Text = "push"; button.OnClientClick = "javascript:return false;"; Code.Text = "<script type=\"text/javascript\"> function bindEvents() { $('#" + button.ClientID + "').click(function() { alert('hello'); }); } bindEvents(); </script>"; PlaceMe.Controls.Add(button); } You'll see that the button does not poput the alert message, even though the code is present on the page.

    Read the article

  • how to bind the image dynamically for datagrid in.cs

    - by prince23
    hi, this is my xaml code. <sdk:DataGrid x:Name="dgMarks" CanUserResizeColumns="False" SelectionMode="Single" AutoGenerateColumns="False" VerticalAlignment="Top" IsReadOnly="True" Margin="13,44,0,0" RowDetailsVisibilityChanged="dgMarks_RowDetailsVisibilityChanged" RowDetailsVisibilityMode="Collapsed" Height="391" HorizontalAlignment="Left" Width="965" SelectionChanged="dgMarks_SelectionChanged" VerticalScrollBarVisibility="Visible" > <sdk:DataGrid.Columns> <sdk:DataGridTemplateColumn> <sdk:DataGridTemplateColumn.CellTemplate> <DataTemplate> <Button x:Name="myButton" Click="ExpandMarks_Click"> <TextBlock Text="{Binding Level}" TextWrapping="NoWrap" ></TextBlock> <Image x:Name="imgMarks" Stretch="None"/> </Button> </DataTemplate> </sdk:DataGridTemplateColumn.CellTemplate> </sdk:DataGridTemplateColumn> <sdk:DataGridTemplateColumn Header="Name" Visibility="Collapsed"> <sdk:DataGridTemplateColumn.CellTemplate> <DataTemplate > <sdk:Label Content="{Binding Name}"/> </DataTemplate> </sdk:DataGridTemplateColumn.CellTemplate> </sdk:DataGridTemplateColumn> <sdk:DataGridTemplateColumn Header="Marks" Width="80"> <sdk:DataGridTemplateColumn.CellTemplate> <DataTemplate> <sdk:Label Content="{Binding Marks}"/> </DataTemplate> </sdk:DataGridTemplateColumn.CellTemplate> </sdk:DataGridTemplateColumn> </sdk:DataGrid.Columns> </sdk:DataGrid> from database i am getting these values name marks Level abc 23 0 xyz 67 1 yu 56 0 aa 89 1 here i am binding these values for datagrid. i have an tricky thing to be done .based on the level i should be binding image if level value is 1 then bind the image. if level value is 0 then do not bind the image for that row i know this is how we need to handle but where should i write this code in which events? Image imgLevel = (Image)templateTrendScore.FindName("imgMarks"); if (level1==1) { imgLevel .Source = new BitmapImage(new Uri("/Images/image1.JPG", UriKind.Relative)); } any help would be great thanks in advance

    Read the article

  • How do I remove elements from a jQuery wrapped set

    - by Bungle
    I'm a little confused about which jQuery method and/or selectors to use when trying to select an element, and then remove certain descendant elements from the wrapped set. For example, given the following HTML: <div id="article"> <div id="inset"> <ul> <li>This is bullet point #1.</li> <li>This is bullet point #2.</li> <li>This is bullet point #3.</li> </ul> </div> <p>This is the first paragraph of the article</p> <p>This is the second paragraph of the article</p> <p>This is the third paragraph of the article</p> </div> I want to select the article: var $article = $('#article'); but then remove <div id="inset"></div> and its descendants from the wrapped set. I tried the following: var $article = $('#article').not('#inset'); but that didn't work, and in retrospect, I think I can see why. I also tried using remove() unsuccessfully. What would be the correct way to do this? Ultimately, I need to set this up in such a way that I can define a configuration array, such as: var selectors = [ { select: '#article', exclude: ['#inset'] } ]; where select defines a single element that contains text content, and exclude is an optional array that defines one or more selectors to disregard text content from. Given the final wrapped set with the excluded elements removed, I would like to be able to call jQuery's text() method to end up with the following text: This is the first paragraph of the article.This is the second paragraph of the article.This is the third paragraph of the article. The configuration array doesn't need to work exactly like that, but it should provide roughly equivalent configuration potential. Thanks for any help you can provide!

    Read the article

  • What common routines do you put in your Program.cs for C#

    - by Rick
    I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • using a Singleton to pass credentials in a multi-tenant application a code smell?

    - by Hans Gruber
    Currently working on a multi-tenant application that employs Shared DB/Shared Schema approach. IOW, we enforce tenant data segregation by defining a TenantID column on all tables. By convention, all SQL reads/writes must include a Where TenantID = '?' clause. Not an ideal solution, but hindsight is 20/20. Anyway, since virtually every page/workflow in our app must display tenant specific data, I made the (poor) decision at the project's outset to employ a Singleton to encapsulate the current user credentials (i.e. TenantID and UserID). My thinking at the time was that I didn't want to add a TenantID parameter to each and every method signature in my Data layer. Here's what the basic pseudo-code looks like: public class UserIdentity { public UserIdentity(int tenantID, int userID) { TenantID = tenantID; UserID = userID; } public int TenantID { get; private set; } public int UserID { get; private set; } } public class AuthenticationModule : IHttpModule { public void Init(HttpApplication context) { context.AuthenticateRequest += new EventHandler(context_AuthenticateRequest); } private void context_AuthenticateRequest(object sender, EventArgs e) { var userIdentity = _authenticationService.AuthenticateUser(sender); if (userIdentity == null) { //authentication failed, so redirect to login page, etc } else { //put the userIdentity into the HttpContext object so that //its only valid for the lifetime of a single request HttpContext.Current.Items["UserIdentity"] = userIdentity; } } } public static class CurrentUser { public static UserIdentity Instance { get { return HttpContext.Current.Items["UserIdentity"]; } } } public class WidgetRepository: IWidgetRepository{ public IEnumerable<Widget> ListWidgets(){ var tenantId = CurrentUser.Instance.TenantID; //call sproc with tenantId parameter } } As you can see, there are several code smells here. This is a singleton, so it's already not unit test friendly. On top of that you have a very tight-coupling between CurrentUser and the HttpContext object. By extension, this also means that I have a reference to System.Web in my Data layer (shudder). I want to pay down some technical debt this sprint by getting rid of this singleton for the reasons mentioned above. I have a few thoughts on what an better implementation might be, but if anyone has any guidance or lessons learned they could share, I would be much obliged.

    Read the article

< Previous Page | 676 677 678 679 680 681 682 683 684 685 686 687  | Next Page >