Search Results

Search found 18329 results on 734 pages for 'interpret order'.

Page 681/734 | < Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >

  • Grid sorting with persistent master sort

    - by MikeWyatt
    I have a UI with a grid. Each record in the grid is sorted by a "master" sort column, let's call it a page number. Each record is a story in a magazine. I want the user to be able to drag and drop a record to a new position in the grid and automatically update the page number field to reflect the updated position. Easy enough, right? Now imagine that I also want to have the grid sortable by any other column (story title, section, author name, etc.). How does the drag and drop operation work now? Revert to page number sort during or after the drag and drop operation? This could confuse the user (why did my sort just change?). It would also result in arbitrary row positioning. Would the story now be before the row that was after it when the user dropped it? Or, would it be after the row that was before it? Those rows may now be widely separated after the master order sort. Disable the drag and drop feature if the grid isn't currently sorted by the page number? This would be easy, but the user might wonder why he can't drag and drop at certain times. Knowing to first sort by page number may not be very intuitive. Let the user rearrange his rows, but not make any changes to the page number? Require the user to enter a "Arrange Stories" mode, in which the grid sort is temporarily switched to page number and drag and drop is enabled? They would then exit the mode, and the previous sort would be reapplied. The big difference between this and the second option is that it would be more explicit than simply clicking on a column header. Any other ideas, or reasons why one of the above is the way to go? EDIT I'd like to point out that any of the above is technically possible, and easy to implement. My question is design-related. What is the most intuitive way to solve this problem, from the user's perspective?

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • Memory allocation and release for UIImage in iPhone?

    - by rkbang
    Hello all, I am using following code in iPhone to get smaller cropped image as follows: - (UIImage*) getSmallImage:(UIImage*) img { CGSize size = img.size; CGFloat ratio = 0; if (size.width < size.height) { ratio = 36 / size.width; } else { ratio = 36 / size.height; } CGRect rect = CGRectMake(0.0, 0.0, ratio * size.width, ratio * size.height); UIGraphicsBeginImageContext(rect.size); [img drawInRect:rect]; UIImage *tempImg = [UIGraphicsGetImageFromCurrentImageContext() retain]; UIGraphicsEndImageContext(); return [tempImg autorelease]; } - (UIImage*)imageByCropping:(UIImage *)imageToCrop toRect:(CGRect)rect { //create a context to do our clipping in UIGraphicsBeginImageContext(rect.size); CGContextRef currentContext = UIGraphicsGetCurrentContext(); //create a rect with the size we want to crop the image to //the X and Y here are zero so we start at the beginning of our //newly created context CGFloat X = (imageToCrop.size.width - rect.size.width)/2; CGFloat Y = (imageToCrop.size.height - rect.size.height)/2; CGRect clippedRect = CGRectMake(X, Y, rect.size.width, rect.size.height); //CGContextClipToRect( currentContext, clippedRect); //create a rect equivalent to the full size of the image //offset the rect by the X and Y we want to start the crop //from in order to cut off anything before them CGRect drawRect = CGRectMake(0, 0, imageToCrop.size.width, imageToCrop.size.height); CGContextTranslateCTM(currentContext, 0.0, drawRect.size.height); CGContextScaleCTM(currentContext, 1.0, -1.0); //draw the image to our clipped context using our offset rect //CGContextDrawImage(currentContext, drawRect, imageToCrop.CGImage); CGImageRef tmp = CGImageCreateWithImageInRect(imageToCrop.CGImage, clippedRect); //pull the image from our cropped context UIImage *cropped = [UIImage imageWithCGImage:tmp];//UIGraphicsGetImageFromCurrentImageContext(); CGImageRelease(tmp); //pop the context to get back to the default UIGraphicsEndImageContext(); //Note: this is autoreleased*/ return cropped; } I am using following line of code in cellForRowAtIndexPath to update the image of the cell: cell.img.image = [self imageByCropping:[self getSmallImage:[UIImage imageNamed:@"goal_image.png"]] toRect:CGRectMake(0, 0, 36, 36)]; Now when I add this table view and pop it from navigation controller, I see a memory hike.I see no leaks but memory keeps climbing. Please note that the images changes for each row and I am creating the controller using lazy initialization that is I create or alloc it whenever I need it. I saw on internet many people facing the same issue, but very rare good solutions. I have multiple views using the same way and I see almost memory raised to 4MB within 20-25 view transitions. What is the good solution to resolve this issue. tnx.

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

  • Publishing/subscribing multiple subsets of the same server collection

    - by matb33
    How does one go about publishing different subsets (or "views") of a single collection on the server as multiple collections on the client? Here is some pseudo-code to help illustrate my question: items collection on the server Assume that I have an items collection on the server with millions of records. Let's also assume that: 50 records have the enabled property set to true, and; 100 records have the processed property set to true. All others are set to false. items: { "_id": "uniqueid1", "title": "item #1", "enabled": false, "processed": false }, { "_id": "uniqueid2", "title": "item #2", "enabled": false, "processed": true }, ... { "_id": "uniqueid458734958", "title": "item #458734958", "enabled": true, "processed": true } Server code Let's publish two "views" of the same server collection. One will send down a cursor with 50 records, and the other will send down a cursor with 100 records. There are over 458 million records in this fictitious server-side database, and the client does not need to know about all of those (in fact, sending them all down would probably take several hours in this example): var Items = new Meteor.Collection("items"); Meteor.publish("enabled_items", function () { // Only 50 "Items" have enabled set to true return Items.find({enabled: true}); }); Meteor.publish("processed_items", function () { // Only 100 "Items" have processed set to true return Items.find({processed: true}); }); Client code In order to support the latency compensation technique, we are forced to declare a single collection Items on the client. It should become apparent where the flaw is: how does one differentiate between Items for enabled_items and Items for processed_items? var Items = new Meteor.Collection("items"); Meteor.subscribe("enabled_items", function () { // This will output 50, fine console.log(Items.find().count()); }); Meteor.subscribe("processed_items", function () { // This will also output 50, since we have no choice but to use // the same "Items" collection. console.log(Items.find().count()); }); My current solution involves monkey-patching _publishCursor to allow the subscription name to be used instead of the collection name. But that won't do any latency compensation. Every write has to round-trip to the server: // On the client: var EnabledItems = new Meteor.Collection("enabled_items"); var ProcessedItems = new Meteor.Collection("processed_items"); With the monkey-patch in place, this will work. But go into Offline mode and changes won't appear on the client right away -- we'll need to be connected to the server to see changes. What's the correct approach?

    Read the article

  • Spring transaction management breaks hibernate cascade

    - by TimmyJ
    I'm having a problem where the addition of spring's transaction management to an application causes Hibernate to throw the following error: org.hibernate.HibernateException: A collection with cascade="all-delete-orphan" was no longer referenced by the owning entity instance: org.fstrf.masterpk.domain.ReportCriteriaBean.treatmentArms org.hibernate.engine.Collections.processDereferencedCollection(Collections.java:96) org.hibernate.engine.Collections.processUnreachableCollection(Collections.java:39) org.hibernate.event.def.AbstractFlushingEventListener.flushCollections(AbstractFlushingEventListener.java:218) org.hibernate.event.def.AbstractFlushingEventListener.flushEverythingToExecutions(AbstractFlushingEventListener.java:77) org.hibernate.event.def.DefaultFlushEventListener.onFlush(DefaultFlushEventListener.java:26) org.hibernate.impl.SessionImpl.flush(SessionImpl.java:1000) org.springframework.orm.hibernate3.SpringSessionSynchronization.beforeCommit(SpringSessionSynchronization.java:135) org.springframework.transaction.support.TransactionSynchronizationUtils.triggerBeforeCommit(TransactionSynchronizationUtils.java:72) org.springframework.transaction.support.AbstractPlatformTransactionManager.triggerBeforeCommit(AbstractPlatformTransactionManager.java:905) org.springframework.transaction.support.AbstractPlatformTransactionManager.processCommit(AbstractPlatformTransactionManager.java:715) org.springframework.transaction.support.AbstractPlatformTransactionManager.commit(AbstractPlatformTransactionManager.java:701) org.springframework.transaction.interceptor.TransactionAspectSupport.commitTransactionAfterReturning(TransactionAspectSupport.java:321) org.springframework.transaction.interceptor.TransactionInterceptor.invoke(TransactionInterceptor.java:116) org.springframework.aop.framework.ReflectiveMethodInvocation.proceed(ReflectiveMethodInvocation.java:171) org.springframework.aop.framework.JdkDynamicAopProxy.invoke(JdkDynamicAopProxy.java:204) $Proxy92.saveNewReportCriteria(Unknown Source) org.fstrf.masterpk.domain.logic.MasterPkFacade.saveNewReportCriteria(MasterPkFacade.java:134) org.fstrf.masterpk.controllers.ReportCriteriaController.setupReportType(ReportCriteriaController.java:302) sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) java.lang.reflect.Method.invoke(Method.java:585) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.doInvokeMethod(HandlerMethodInvoker.java:413) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.invokeHandlerMethod(HandlerMethodInvoker.java:134) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.invokeHandlerMethod(AnnotationMethodHandlerAdapter.java:310) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.handle(AnnotationMethodHandlerAdapter.java:297) org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:875) org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:809) org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:571) org.springframework.web.servlet.FrameworkServlet.doPost(FrameworkServlet.java:511) javax.servlet.http.HttpServlet.service(HttpServlet.java:710) javax.servlet.http.HttpServlet.service(HttpServlet.java:803) org.jboss.web.tomcat.filters.ReplyHeaderFilter.doFilter(ReplyHeaderFilter.java:96) I'm using Spring 2.5 and annotations to implement this management. Here is the class containing the saveNewReportCriteria method (which, as can be seen by the stack trace, is causing the error) @Transactional( propagation = Propagation.REQUIRED, isolation = Isolation.DEFAULT, readOnly = false) public class HibernateReportCriteriaDao implements ReportCriteriaDao{ private HibernateTemplate hibernateTemplate; public Integer saveNewReportCriteria(ReportCriteriaBean reportCriteria) { hibernateTemplate.save(reportCriteria); List<Integer> maxIdList = hibernateTemplate.find("SELECT max(id) from ReportCriteriaBean"); logger.info("ID of newly saved list is: " + maxIdList.get(0)); return maxIdList.get(0); } public void setHibernateTemplate(HibernateTemplate hibernateTemplate) { this.hibernateTemplate = hibernateTemplate; } } Then I added the following sections to my configuration files to tell spring that I am using annotation driven transaction management: <bean id="actgDataSource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/actg" /> <property name="resourceRef" value="true" /> </bean> <bean id="transactionManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="actgDataSource" /> </bean> <tx:annotation-driven/> I'm pretty sure that the de-referencing error is being caused due to the proxy class that Spring AOP creates and uses in order to handle transaction management, but I have no idea how I'd go about fixing it.

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Java: Making concurrent MySQL queries from multiple clients synchronised

    - by Misha Gale
    I work at a gaming cybercafe, and we've got a system here (smartlaunch) which keeps track of game licenses. I've written a program which interfaces with this system (actually, with it's backend MySQL database). The program is meant to be run on a client PC and (1) query the database to select an unused license from the pool available, then (2) mark this license as in use by the client PC. The problem is, I've got a concurrency bug. The program is meant to be launched simultaneously on multiple machines, and when this happens, some machines often try and acquire the same license. I think that this is because steps (1) and (2) are not synchronised, i.e. one program determines that license #5 is available and selects it, but before it can mark #5 as in use another copy of the program on another PC tries to grab that same license. I've tried to solve this problem by using transactions and table locking, but it doesn't seem to make any difference - Am I doing this right? Here follows the code in question: public LicenseKey Acquire() throws SmartLaunchException, SQLException { Connection conn = SmartLaunchDB.getConnection(); int PCID = SmartLaunchDB.getCurrentPCID(); conn.createStatement().execute("LOCK TABLE `licensekeys` WRITE"); String sql = "SELECT * FROM `licensekeys` WHERE `InUseByPC` = 0 AND LicenseSetupID = ? ORDER BY `ID` DESC LIMIT 1"; PreparedStatement statement = conn.prepareStatement(sql); statement.setInt(1, this.id); ResultSet results = statement.executeQuery(); if (results.next()) { int licenseID = results.getInt("ID"); sql = "UPDATE `licensekeys` SET `InUseByPC` = ? WHERE `ID` = ?"; statement = conn.prepareStatement(sql); statement.setInt(1, PCID); statement.setInt(2, licenseID); statement.executeUpdate(); statement.close(); conn.commit(); conn.createStatement().execute("UNLOCK TABLES"); return new LicenseKey(results.getInt("ID"), this, results.getString("LicenseKey"), results.getInt("LicenseKeyType")); } else { throw new SmartLaunchException("All licenses of type " + this.name + "are in use"); } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Java threads not working correctly with linkedlist

    - by user69514
    Hi I am working on the sleeping barber problem. with the addition of having priority customer when they arrive they go in the front of the line and they are the next ones to get a haircut. I'm using a linkedlist and if I see a priority customer I put him in the beginning of the list, if the customer is not priority he goes to the end of the list. then I call the wantHaircut method getting the first element of the list. my problem is that the customer are being processed in the order they arrive, and the priority customer have to wait. here is the code where it all happens. any ideas what I am doing wrong? thanks public void arrivedBarbershop(Customer c){ if(waiting < numChairs && c.isPriority()){ System.out.println("Customer " + c.getID() + ": is a priority customer - SITTING -"); mutex.up(); customer_list.addFirst(c); } else if(waiting >= numChairs && c.isPriority()){ System.out.println("Customer " + c.getID() + ": is a priority customer - STANDING -"); mutex.up(); customer_list.addFirst(c); } else if(waiting < numChairs && !c.isPriority()){ waiting++; System.out.println("Customer " + c.getID() + ": arrived, sitting in the waiting room"); customer_list.addLast(c); customers.up(); // increment waiting customers } else if(waiting >= numChairs && !c.isPriority()) { System.out.println("Customer " + c.getID() + ": went to another barber because waiting room was full - " + waiting + " waiting"); mutex.up(); } if(!customer_list.isEmpty()){ this.wantHairCut(customer_list.removeFirst()); } } public void wantHairCut(Customer c) { mutex.up(); barber.down(); // waits for being allowed in barber chair System.out.println("Customer " + c.getID() + ": getting haircut"); try { /** haircut takes between 1 and 2 seconds **/ Thread.sleep(Barbershop.randomInt(1, 2) * 1000); } catch (InterruptedException e) { } System.out.println("Barber: finished cutting customer " + c.getID() + "'s hair"); c.gotHaircut = true; cutting.up(); // signals cutting has finished /** customer must pay now **/ this.wantToCashout(c); }

    Read the article

  • .NET threading: how can I capture an abort on an unstarted thread?

    - by Groxx
    I have a chunk of threads I wish to run in order, on an ASP site running .NET 2.0 with Visual Studio 2008 (no idea how much all that matters, but there it is), and they may have aborted-clean-up code which should be run regardless of how far through their task they are. So I make a thread like this: Thread t = new Thread(delegate() { try { /* do things */ System.Diagnostics.Debug.WriteLine("try"); } catch (ThreadAbortException) { /* cleanup */ System.Diagnostics.Debug.WriteLine("catch"); } }); Now, if I wish to abort the set of threads part way through, the cleanup may still be desirable later on down the line. Looking through MSDN implies you can .Abort() a thread that has not started, and then .Start() it, at which point it will receive the exception and perform normally. Or you can .Join() the aborted thread to wait for it to finish aborting. Presumably you can combine them. http://msdn.microsoft.com/en-us/library/ty8d3wta(v=VS.80).aspx To wait until a thread has aborted, you can call the Join method on the thread after calling the Abort method, but there is no guarantee the wait will end. If Abort is called on a thread that has not been started, the thread will abort when Start is called. If Abort is called on a thread that is blocked or is sleeping, the thread is interrupted and then aborted. Now, when I debug and step through this code: t.Abort(); // ThreadState == Unstarted | AbortRequested t.Start(); // throws ThreadStartException: "Thread failed to start." // so I comment it out, and t.Join(); // throws ThreadStateException: "Thread has not been started." At no point do I see any output, nor do any breakpoints on either the try or catch block get reached. Oddly, ThreadStartException is not listed as a possible throw of .Start(), from here: http://msdn.microsoft.com/en-us/library/a9fyxz7d(v=VS.80).aspx (or any other version) I understand this could be avoided by having a start parameter, which states if the thread should jump to cleanup code, and foregoing the Abort call (which is probably what I'll do). And I could .Start() the thread, and then .Abort() it. But as an indeterminate amount of time may pass between .Start and .Abort, I'm considering it unreliable, and the documentation seems to say my original method should work. Am I missing something? Is the documentation wrong? edit: ow. And you can't call .Start(param) on a non-parameterized Thread(Start). Is there a way to find out if a thread is parameterized or not, aside from trial and error? I see a private m_Delegate, but nothing public...

    Read the article

  • Is a Multi-DAL Approach the way to go here?

    - by Krisc
    Working on the data access / model layer in this little MVC2 project and trying to think things out to future projects. I have a database with some basic tables and I have classes in the model layer that represent them. I obviously need something to connect the two. The easiest is to provide some sort of 'provider' that can run operations on the database and return objects. But this is for a website that would potentially be used "a lot" (I know, very general) so I want to cache results from the data layer and keep the cache updated as new data is generated. This question deals with how best to approach this problem of dual DALS. One that returns cached data when possible and goes to the data layer when there is a cache miss. But more importantly, how to integrate the core provider (thing that goes into database) with the caching layer so that it too can rely on cached objects rather than creating new ones. Right now I have the following interfaces: IDataProvider is used to reach the database. It doesn't concern itself with the meaning of the objects it produces, but simply the way to produce them. interface IDataProvider{ // Select, Update, Create, et cetera access IEnumerable<Entry> GetEntries(); Entry GetEntryById(int id); } IDataManager is a layer that sits on top of the IDataProvider layer and manages the cache interface IDataManager : IDataProvider{ void ClearCache(); } Note that in practice the IDataManager implementation will have useful helper functions to add objects to their related cache stores. (In the future I may define other functions on the interface) I guess what I am looking for is the best way to approach a loop back from the IDataProvider implementations so that they can access the cache. Or a different approach entirely may be in order? I am not very interested in 3rd party products at the moment as I am interested in the design of these things much more than this specific implementation. Edit: I realize the title may be a bit misleading. I apologize for that... not sure what to call this question.

    Read the article

  • Displaying an Image in an activity using URI

    - by evkwan
    Hi, I'm writing an application that uses Intent(MediaStore.ACTION_IMAGE_CAPTURE) to capture and image. On the process of capturing the image, I noted the output of the image's URI. Right after finishing the camera activity, I wish to display the image using this specific URI. The method I used to capture images is: private void saveFullImage() { Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); File file = new File(Environment.getExternalStorageDirectory(), "test.jpg"); outputFileUri = Uri.fromFile(file); intent.putExtra(MediaStore.EXTRA_OUTPUT, outputFileUri); startActivityForResult(intent, TAKE_PICTURE); } Which is a method taken from Reto Meier's book Professional Android 2 Application Development. The method works fine, and I assume that the URI of the picture I just took is stored in the outputFileUri variable. Then at this point of the code is where I want to display the picture: @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { if (requestCode == TAKE_PICTURE) { //I want to display the picture I just took here //using the URI } } I'm not sure how to do it. I tried creating a new layout object and a new ImageView object using the method setImageURI(outputFileUri). My main layout (xml) did not have a ImageView object. But even when I set the contentView to the new layout with the ImageView attached to it, it doesn't display anything. I tried creating a Bitmap object from the URI and set it to the ImageView, but I get an unexpected error and forced exit. I have seen examples from here here which creates a Bitmap from URI, but it's not displaying it? My question is just how to display an image in the middle of a running activity? Do I need to get the File Path (like this) in order to display it? If I make a Bitmap out of the URI, how do I display the Bitmap? I'm just probably missing something simple...so any help would be a greatly appreciated! Also additional question for thought: If I were to take multiple pictures, would you recommend me to use the SimpleCursorAdapter instead? Thanks!

    Read the article

  • Zend Framework decorator subform add a class tag to DD wrapper tag

    - by Samuele
    I have this form: class Request_Form_Prova extends Zend_Form { public function init() { $this->setMethod('post'); $SubForm_Step = new Zend_Form_SubForm(); $SubForm_Step->setAttrib('class','Step'); $this->addSubform($SubForm_Step, 'Chicco'); $PrivacyCheck = $SubForm_Step->createElement('CheckBox', 'PrivacyCheck'); $PrivacyCheck->setLabel('I have read and I agre bla bla...') ->setRequired(true) ->setUncheckedValue(''); $PrivacyCheck->getDecorator('Label')->setOption('class', 'inline'); $SubForm_Step->addElement($PrivacyCheck); $SubForm_Step->addElement('submit', 'submit', array( 'ignore' => true, 'label' => 'OK', )); } } That generate this HTML: <form enctype="application/x-www-form-urlencoded" method="post" action=""> <dl class="zend_form"> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> <dt id="Chicco-PrivacyCheck-label"><label for="Chicco-PrivacyCheck" class="inline required">I have read and I agre bla bla...</label></dt> <dd id="Chicco-PrivacyCheck-element"> <input type="hidden" name="Chicco[PrivacyCheck]" value=""><input type="checkbox" name="Chicco[PrivacyCheck]" id="Chicco-PrivacyCheck" value="1"> </dd> <dt id="submit-label">&nbsp;</dt> <dd id="submit-element"> <input type="submit" name="Chicco[submit]" id="Chicco-submit" value="OK"> </dd> </dl> </fieldset> </dd> </dl> </form> How can I add a class="Test" to the <dd id="Chicco-element"> elemnt? In order to have it like that: <dd id="Chicco-element" class="Test"> I thought something like that but it don't work: $SubForm_Step->getDecorator('DdWrapper')->setOption('class', 'Test'); OR $SubForm_Step->getDecorator('DtDdWrapper')->setOption('class', 'Test'); How can I do it? And last question: How can I wrap that DD and DT element of a SubForm in another DL element? Like that: ( second line ) <dl class="zend_form"> <dl> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> .......

    Read the article

  • Can MySQL reasonably perform queries on billions of rows?

    - by haxney
    I am planning on storing scans from a mass spectrometer in a MySQL database and would like to know whether storing and analyzing this amount of data is remotely feasible. I know performance varies wildly depending on the environment, but I'm looking for the rough order of magnitude: will queries take 5 days or 5 milliseconds? Input format Each input file contains a single run of the spectrometer; each run is comprised of a set of scans, and each scan has an ordered array of datapoints. There is a bit of metadata, but the majority of the file is comprised of arrays 32- or 64-bit ints or floats. Host system |----------------+-------------------------------| | OS | Windows 2008 64-bit | | MySQL version | 5.5.24 (x86_64) | | CPU | 2x Xeon E5420 (8 cores total) | | RAM | 8GB | | SSD filesystem | 500 GiB | | HDD RAID | 12 TiB | |----------------+-------------------------------| There are some other services running on the server using negligible processor time. File statistics |------------------+--------------| | number of files | ~16,000 | | total size | 1.3 TiB | | min size | 0 bytes | | max size | 12 GiB | | mean | 800 MiB | | median | 500 MiB | | total datapoints | ~200 billion | |------------------+--------------| The total number of datapoints is a very rough estimate. Proposed schema I'm planning on doing things "right" (i.e. normalizing the data like crazy) and so would have a runs table, a spectra table with a foreign key to runs, and a datapoints table with a foreign key to spectra. The 200 Billion datapoint question I am going to be analyzing across multiple spectra and possibly even multiple runs, resulting in queries which could touch millions of rows. Assuming I index everything properly (which is a topic for another question) and am not trying to shuffle hundreds of MiB across the network, is it remotely plausible for MySQL to handle this? UPDATE: additional info The scan data will be coming from files in the XML-based mzML format. The meat of this format is in the <binaryDataArrayList> elements where the data is stored. Each scan produces = 2 <binaryDataArray> elements which, taken together, form a 2-dimensional (or more) array of the form [[123.456, 234.567, ...], ...]. These data are write-once, so update performance and transaction safety are not concerns. My naïve plan for a database schema is: runs table | column name | type | |-------------+-------------| | id | PRIMARY KEY | | start_time | TIMESTAMP | | name | VARCHAR | |-------------+-------------| spectra table | column name | type | |----------------+-------------| | id | PRIMARY KEY | | name | VARCHAR | | index | INT | | spectrum_type | INT | | representation | INT | | run_id | FOREIGN KEY | |----------------+-------------| datapoints table | column name | type | |-------------+-------------| | id | PRIMARY KEY | | spectrum_id | FOREIGN KEY | | mz | DOUBLE | | num_counts | DOUBLE | | index | INT | |-------------+-------------| Is this reasonable?

    Read the article

  • invalid postback event instead of dropdown to datagrid

    - by rima
    I faced with funny situation. I created a page which is having some value, I set these value and control my post back event also. The problem is happening when I change a component index(ex reselect a combobox which is not inside my datagrid) then I dont know why without my page call the Page_Load it goes to create a new row in grid function and all of my parameter are null! I am just receiving null exception. So in other word I try to explain the situation: when I load my page I am initializing some parameter. then everything is working fine. in my page when I change selected item of my combo box, page suppose to go and run function related to that combo box, and call page_load, but it is not going there and it goes to rowcreated function. I am trying to illustrate part of my page. Please help me because I am not receiving any error except null exception and it triger wrong even which seems so complicated for me. public partial class W_CM_FRM_02 : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack && !loginFail) return; InitializeItems(); } } private void InitializeItems() { cols = new string[] { "v_classification_code", "v_classification_name" }; arrlstCMMM_CLASSIFICATION = (ArrayList)db.Select(cols, "CMMM_CLASSIFICATION", "v_classification_code <> 'N'", " ORDER BY v_classification_name"); } } protected void DGV_RFA_DETAILS_RowCreated(object sender, GridViewRowEventArgs e) { //db = (Database)Session["oCon"]; foreach (DataRow dr in arrlstCMMM_CLASSIFICATION) ((DropDownList)DGV_RFA_DETAILS.Rows[index].Cells[4].FindControl("OV_RFA_CLASSIFICATION")).Items.Add(new ListItem(dr["v_classification_name"].ToString(), dr["v_classification_code"].ToString())); } protected void V_CUSTOMER_SelectedIndexChanged(object sender, EventArgs e) { if (V_CUSTOMER.SelectedValue == "xxx" || V_CUSTOMER.SelectedValue == "ddd") V_IMPACTED_FUNCTIONS.Enabled = true; } } my form: <%@ Page Language="C#" MasterPageFile="~/MasterPage.master" AutoEventWireup="true" CodeFile="W_CM_FRM_02.aspx.cs" Inherits="W_CM_FRM_02" Title="W_CM_FRM_02" enableeventvalidation="false" EnableViewState="true"%> <td>Project name*</td> <td><asp:DropDownList ID="V_CUSTOMER" runat="server" AutoPostBack="True" onselectedindexchanged="V_CUSTOMER_SelectedIndexChanged" /></td> <td colspan = "8"> <asp:GridView ID="DGV_RFA_DETAILS" runat="server" ShowFooter="True" AutoGenerateColumns="False" CellPadding="1" ForeColor="#333333" GridLines="None" OnRowDeleting="grvRFADetails_RowDeleting" Width="100%" Style="text-align: left" onrowcreated="DGV_RFA_DETAILS_RowCreated"> <RowStyle BackColor="#FFFBD6" ForeColor="#333333" /> <Columns> <asp:BoundField DataField="ON_RowNumber" HeaderText="SNo" /> <asp:TemplateField HeaderText="RFA/RAD/Ticket No*"> <ItemTemplate> <asp:TextBox ID="OV_RFA_NO" runat="server" Width="120"></asp:TextBox> </ItemTemplate> </asp:TemplateField>

    Read the article

  • Truth tables in code? How to structure state machine?

    - by HanClinto
    I have a (somewhat) large truth table / state machine that I need to implement in my code (embedded C). I anticipate the behavior specification of this state machine to change in the future, and so I'd like to keep this easily modifiable in the future. My truth table has 4 inputs and 4 outputs. I have it all in an Excel spreadsheet, and if I could just paste that into my code with a little formatting, that would be ideal. I was thinking I would like to access my truth table like so: u8 newState[] = decisionTable[input1][input2][input3][input4]; And then I could access the output values with: setOutputPin( LINE_0, newState[0] ); setOutputPin( LINE_1, newState[1] ); setOutputPin( LINE_2, newState[2] ); setOutputPin( LINE_3, newState[3] ); But in order to get that, it looks like I would have to do a fairly confusing table like so: static u8 decisionTable[][][][][] = {{{{ 0, 0, 0, 0 }, { 0, 0, 0, 0 }}, {{ 0, 0, 0, 0 }, { 0, 0, 0, 0 }}}, {{{ 0, 0, 1, 1 }, { 0, 1, 1, 1 }}, {{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}}}, {{{{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}, {{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}}, {{{ 0, 1, 1, 1 }, { 0, 1, 1, 1 }}, {{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}}}; Those nested brackets can be somewhat confusing -- does anyone have a better idea for how I can keep a pretty looking table in my code? Thanks! Edit based on HUAGHAGUAH's answer: Using an amalgamation of everyone's input (thanks -- I wish I could "accept" 3 or 4 of these answers), I think I'm going to try it as a two dimensional array. I'll index into my array using a small bit-shifting macro: #define SM_INPUTS( in0, in1, in2, in3 ) ((in0 << 0) | (in1 << 1) | (in2 << 2) | (in3 << 3)) And that will let my truth table array look like this: static u8 decisionTable[][] = { { 0, 0, 0, 0 }, { 0, 0, 0, 0 }, { 0, 0, 0, 0 }, { 0, 0, 0, 0 }, { 0, 0, 1, 1 }, { 0, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }, { 0, 1, 1, 1 }, { 0, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }}; And I can then access my truth table like so: decisionTable[ SM_INPUTS( line1, line2, line3, line4 ) ] I'll give that a shot and see how it works out. I'll also be replacing the 0's and 1's with more helpful #defines that express what each state means, along with /**/ comments that explain the inputs for each line of outputs. Thanks for the help, everyone!

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

  • Use HTTP PUT to create new cache (ehCache) running on the same Tomcat?

    - by socal_javaguy
    I am trying to send a HTTP PUT (in order to create a new cache and populate it with my generated JSON) to ehCache using my webservice which is on the same local tomcat instance. Am new to RESTful Web Services and am using JDK 1.6, Tomcat 7, ehCache, and JSON. I have my POJOs defined like this: Person POJO: import javax.xml.bind.annotation.XmlRootElement; @XmlRootElement public class Person { private String firstName; private String lastName; private List<House> houses; // Getters & Setters } House POJO: import javax.xml.bind.annotation.XmlRootElement; @XmlRootElement public class House { private String address; private String city; private String state; // Getters & Setters } Using a PersonUtil class, I hardcoded the POJOs as follows: public class PersonUtil { public static Person getPerson() { Person person = new Person(); person.setFirstName("John"); person.setLastName("Doe"); List<House> houses = new ArrayList<House>(); House house = new House(); house.setAddress("1234 Elm Street"); house.setCity("Anytown"); house.setState("Maine"); houses.add(house); person.setHouses(houses); return person; } } Am able to create a JSON response per a GET request: @Path("") public class MyWebService{ @GET @Produces(MediaType.APPLICATION_JSON) public Person getPerson() { return PersonUtil.getPerson(); } } When deploying the war to tomcat and pointing the browser to http://localhost:8080/personservice/ Generated JSON: { "firstName" : "John", "lastName" : "Doe", "houses": [ { "address" : "1234 Elmstreet", "city" : "Anytown", "state" : "Maine" } ] } So far, so good, however, I have a different app which is running on the same tomcat instance (and has support for REST): http://localhost:8080/ehcache/rest/ While tomcat is running, I can issue a PUT like this: echo "Hello World" | curl -S -T - http://localhost:8080/ehcache/rest/hello/1 When I "GET" it like this: curl http://localhost:8080/ehcache/rest/hello/1 Will yield: Hello World What I need to do is create a POST which will put my entire Person generated JSON and create a new cache: http://localhost:8080/ehcache/rest/person And when I do a "GET" on this previous URL, it should look like this: { "firstName" : "John", "lastName" : "Doe", "houses": [ { "address" : "1234 Elmstreet", "city" : "Anytown", "state" : "Maine" } ] } So, far, this is what my PUT looks like: @PUT @Path("/ehcache/rest/person") @Produces(MediaType.APPLICATION_JSON) @Consumes(MediaType.APPLICATION_JSON) public Response createCache() { ResponseBuilder response = Response.ok(PersonUtil.getPerson(), MediaType.APPLICATION_JSON); return response.build(); } Question(s): (1) Is this the correct way to write the PUT? (2) What should I write inside the createCache() method to have it PUT my generated JSON into: http://localhost:8080/ehcache/rest/person (3) What would the command line CURL comment look like to use the PUT? Thanks for taking the time to read this...

    Read the article

< Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >