Search Results

Search found 18329 results on 734 pages for 'interpret order'.

Page 681/734 | < Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >

  • highlighting search results in php error

    - by fusion
    i'm trying to figure out what is wrong in this code. it either doesn't highlight the search result OR it outputs html tags surrounding the highlighted text. . $search_result = ""; $search_result = trim($search_result); $special_cases = array( '%', '_', '+' ); $search_result = str_replace( $special_cases, '', $_GET["q"] ); //Check if the string is empty if ($search_result == "") { echo "<p>Search Error</p><p>Please enter a search...</p>" ; exit(); } $result = mysql_query('SELECT cQuotes, vAuthor, cArabic, vReference FROM thquotes WHERE cQuotes LIKE "%' . mysql_real_escape_string($search_result) .'%" ORDER BY idQuotes DESC', $conn) or die ('Error: '.mysql_error()); //eliminating special characters function h($s) { echo htmlspecialchars($s, ENT_QUOTES); } function highlightWords($string, $word) { $string = str_replace($word, "<span style='background-color: #FFE066;font-weight:bold;'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } ?> <div class="caption">Search Results</div> <div class="center_div"> <table> <?php while ($row= mysql_fetch_array($result, MYSQL_ASSOC)) { $cQuote = highlightWords($row['cQuotes'], $search_result); ?> <tr> <td style="text-align:right; font-size:15px;"><?php h($row['cArabic']); ?></td> <td style="font-size:16px;"><?php h($cQuote); ?></td> <td style="font-size:12px;"><?php h($row['vAuthor']); ?></td> <td style="font-size:12px; font-style:italic; text-align:right;"><?php h($row['vReference']); ?></td> </tr> <?php } ?> </table> </div> on the browser, it is outputted as: A good <span style='background-color: #FFE066;font-weight:bold;'>action</span> is an ever-remaining store and a pure yield or if a div is used with class: A good <div class='highlight'>action</div> is an ever-remaining store and a pure yield

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • Using Core Data Concurrently and Reliably

    - by John Topley
    I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Stored procedure optimization

    - by George Zacharia
    Hi, i have a stored procedure which takes lot of time to execure .Can any one suggest a better approch so that the same result set is achived. ALTER PROCEDURE [dbo].[spFavoriteRecipesGET] @USERID INT, @PAGENUMBER INT, @PAGESIZE INT, @SORTDIRECTION VARCHAR(4), @SORTORDER VARCHAR(4),@FILTERBY INT AS BEGIN DECLARE @ROW_START INT DECLARE @ROW_END INT SET @ROW_START = (@PageNumber-1)* @PageSize+1 SET @ROW_END = @PageNumber*@PageSize DECLARE @RecipeCount INT DECLARE @RESULT_SET_TABLE TABLE ( Id INT NOT NULL IDENTITY(1,1), FavoriteRecipeId INT, RecipeId INT, DateAdded DATETIME, Title NVARCHAR(255), UrlFriendlyTitle NVARCHAR(250), [Description] NVARCHAR(MAX), AverageRatingId FLOAT, SubmittedById INT, SubmittedBy VARCHAR(250), RecipeStateId INT, RecipeRatingId INT, ReviewCount INT, TweaksCount INT, PhotoCount INT, ImageName NVARCHAR(50) ) INSERT INTO @RESULT_SET_TABLE SELECT FavoriteRecipes.FavoriteRecipeId, Recipes.RecipeId, FavoriteRecipes.DateAdded, Recipes.Title, Recipes.UrlFriendlyTitle, Recipes.[Description], Recipes.AverageRatingId, Recipes.SubmittedById, COALESCE(users.DisplayName,users.UserName,Recipes.SubmittedBy) As SubmittedBy, Recipes.RecipeStateId, RecipeReviews.RecipeRatingId, COUNT(RecipeReviews.Review), COUNT(RecipeTweaks.Tweak), COUNT(Photos.PhotoId), dbo.udfGetRecipePhoto(Recipes.RecipeId) AS ImageName FROM FavoriteRecipes INNER JOIN Recipes ON FavoriteRecipes.RecipeId=Recipes.RecipeId AND Recipes.RecipeStateId <> 3 LEFT OUTER JOIN RecipeReviews ON RecipeReviews.RecipeId=Recipes.RecipeId AND RecipeReviews.ReviewedById=@UserId AND RecipeReviews.RecipeRatingId= ( SELECT MAX(RecipeReviews.RecipeRatingId) FROM RecipeReviews WHERE RecipeReviews.ReviewedById=@UserId AND RecipeReviews.RecipeId=FavoriteRecipes.RecipeId ) OR RecipeReviews.RecipeRatingId IS NULL LEFT OUTER JOIN RecipeTweaks ON RecipeTweaks.RecipeId = Recipes.RecipeId AND RecipeTweaks.TweakedById= @UserId LEFT OUTER JOIN Photos ON Photos.RecipeId = Recipes.RecipeId AND Photos.UploadedById = @UserId AND Photos.RecipeId = FavoriteRecipes.RecipeId AND Photos.PhotoTypeId = 1 LEFT OUTER JOIN users ON Recipes.SubmittedById = users.UserId WHERE FavoriteRecipes.UserId=@UserId GROUP BY FavoriteRecipes.FavoriteRecipeId, Recipes.RecipeId, FavoriteRecipes.DateAdded, Recipes.Title, Recipes.UrlFriendlyTitle, Recipes.[Description], Recipes.AverageRatingId, Recipes.SubmittedById, Recipes.SubmittedBy, Recipes.RecipeStateId, RecipeReviews.RecipeRatingId, users.DisplayName, users.UserName, Recipes.SubmittedBy; WITH SortResults AS ( SELECT ROW_NUMBER() OVER ( ORDER BY CASE WHEN @SORTDIRECTION = 't' AND @SORTORDER='a' THEN TITLE END ASC, CASE WHEN @SORTDIRECTION = 't' AND @SORTORDER='d' THEN TITLE END DESC, CASE WHEN @SORTDIRECTION = 'r' AND @SORTORDER='a' THEN AverageRatingId END ASC, CASE WHEN @SORTDIRECTION = 'r' AND @SORTORDER='d' THEN AverageRatingId END DESC, CASE WHEN @SORTDIRECTION = 'mr' AND @SORTORDER='a' THEN RecipeRatingId END ASC, CASE WHEN @SORTDIRECTION = 'mr' AND @SORTORDER='d' THEN RecipeRatingId END DESC, CASE WHEN @SORTDIRECTION = 'd' AND @SORTORDER='a' THEN DateAdded END ASC, CASE WHEN @SORTDIRECTION = 'd' AND @SORTORDER='d' THEN DateAdded END DESC ) RowNumber, FavoriteRecipeId, RecipeId, DateAdded, Title, UrlFriendlyTitle, [Description], AverageRatingId, SubmittedById, SubmittedBy, RecipeStateId, RecipeRatingId, ReviewCount, TweaksCount, PhotoCount, ImageName FROM @RESULT_SET_TABLE WHERE ((@FILTERBY = 1 AND SubmittedById= @USERID) OR ( @FILTERBY = 2 AND (SubmittedById <> @USERID OR SubmittedById IS NULL)) OR ( @FILTERBY <> 1 AND @FILTERBY <> 2)) ) SELECT RowNumber, FavoriteRecipeId, RecipeId, DateAdded, Title, UrlFriendlyTitle, [Description], AverageRatingId, SubmittedById, SubmittedBy, RecipeStateId, RecipeRatingId, ReviewCount, TweaksCount, PhotoCount, ImageName FROM SortResults WHERE RowNumber BETWEEN @ROW_START AND @ROW_END print @ROW_START print @ROW_END SELECT @RecipeCount=dbo.udfGetFavRecipesCount(@UserId) SELECT @RecipeCount AS RecipeCount SELECT COUNT(Id) as FilterCount FROM @RESULT_SET_TABLE WHERE ((@FILTERBY = 1 AND SubmittedById= @USERID) OR (@FILTERBY = 2 AND (SubmittedById <> @USERID OR SubmittedById IS NULL)) OR (@FILTERBY <> 1 AND @FILTERBY <> 2)) END

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Output from OouraFFT correct sometimes but completely false other times. Why ?

    - by Yan
    Hi I am using Ooura FFT to compute the FFT of the accelerometer data in windows of 1024 samples. The code works fine, but then for some reason it produces very strange outputs, i.e. continuous spectrum with amplitudes of the order of 10^200. Here is the code: OouraFFT *myFFT=[[OouraFFT alloc] initForSignalsOfLength:1024 NumWindows:10]; // had to allocate it UIAcceleration *tempAccel = nil; double *input=(double *)malloc(1024 * sizeof(double)); double *frequency=(double *)malloc(1024*sizeof(double)); if (input) { //NSLog(@"%d",[array count]); for (int u=0; u<[array count]; u++) { tempAccel = (UIAcceleration *)[array objectAtIndex:u]; input[u]=tempAccel.z; //NSLog(@"%g",input[u]); } } myFFT.inputData=input; // specifies input data to myFFT [myFFT calculateWelchPeriodogramWithNewSignalSegment]; // calculates FFT for (int i=0;i<myFFT.dataLength;i++) // loop to copy output of myFFT, length of spectrumData is half of input data, so copy twice { if (i<myFFT.numFrequencies) { frequency[i]=myFFT.spectrumData[i]; // } else { frequency[i]=myFFT.spectrumData[myFFT.dataLength-i]; // copy twice } } for (int i=0;i<[array count];i++) { TransformedAcceleration *NewAcceleration=[[TransformedAcceleration alloc]init]; tempAccel=(UIAcceleration*)[array objectAtIndex:i]; NewAcceleration.timestamp=tempAccel.timestamp; NewAcceleration.x=tempAccel.x; NewAcceleration.y=tempAccel.z; NewAcceleration.z=frequency[i]; [newcurrentarray addObject:NewAcceleration]; // this does not work //[self replaceAcceleration:NewAcceleration]; //[NewAcceleration release]; [NewAcceleration release]; } TransformedAcceleration *a=nil;//[[TransformedAcceleration alloc]init]; // object containing fft of x,y,z accelerations for(int i=0; i<[newcurrentarray count]; i++) { a=(TransformedAcceleration *)[newcurrentarray objectAtIndex:i]; //NSLog(@"%d,%@",i,[a printAcceleration]); fprintf(fp,[[a printAcceleration] UTF8String]); //this is going wrong somewhow } fclose(fp); [array release]; [myFFT release]; //[array removeAllObjects]; [newcurrentarray release]; free(input); free(frequency);

    Read the article

  • small scale web site - global javascript file style/format/pattern - improving maintainability

    - by yaya3
    I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

    Read the article

  • Get data from aspx.cs page to aspx page.

    - by Brad8118
    So I am using a jquery plug in that allows me to change the order of things in a list by dragging and dropping them. So my goal is to be able to grab a list of my objects (AlertInfo) and using it in a javascript function. I was able to use a json webservice call in a test project to pass the data to the page. But we don't have a webservice page now so I tried to grab it from a aspx.cs page and it hasn't worked. ///Aspx page: $.ajax({ type: "POST", url: "~/Alerts/GetAlerts", data: "{}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (msg) { var data = eval("(" + msg.d + ")"); jQuery.each(data, function (rec) { AlertList[AlertList.length] = new objAlert(this.id, this.title, this.details, JSONDateSerializationFix(this.startdate), JSONDateSerializationFix(this.enddate)); UpdateDisplayList(); }) }, error: function (msg) { alert("BRAD" + msg); } The issue is that the Alerts page in "URL /Alerts/GetAlerts" is Alerts.aspx.cs. I can't figure out if I can use this ajax command to call a method in a aspx.cs page. //Code behind page aspx.cs [WebMethod] //[ScriptMethod(ResponseFormat = ResponseFormat.Json)] public string GetAlerts() { List list = AlertInfo.GetTestAlerts(); return new JavaScriptSerializer().Serialize(list); } public List GetAlertsList() { List list = AlertInfo.GetTestAlerts(); return list; ; } So I was hoping that I could load data into an asp control (dataList) and then grab the data //code behind page protected void Page_Load(object sender, EventArgs e) { dataListAlertList.DataSource = GetAlertsList(); dataListAlertList.DataBind(); } public static List<AlertInfo> GetTestAlerts() { List<AlertInfo> list = new List<AlertInfo>(); list.Add(new AlertInfo("0", "Alert 1 Title", "Alert 1 Detail", "10/10/2010", "10/10/2011")); list.Add(new AlertInfo("1", "Alert 2 Title", "Alert 2 Detail", "10/10/2010", "10/10/2011")); return list; } //.aspx page $(document).ready(function () { var a1 = $("#dataListAlertList").val(); // do fun stuff now. } But I keep getting undefined....

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • .NET threading: how can I capture an abort on an unstarted thread?

    - by Groxx
    I have a chunk of threads I wish to run in order, on an ASP site running .NET 2.0 with Visual Studio 2008 (no idea how much all that matters, but there it is), and they may have aborted-clean-up code which should be run regardless of how far through their task they are. So I make a thread like this: Thread t = new Thread(delegate() { try { /* do things */ System.Diagnostics.Debug.WriteLine("try"); } catch (ThreadAbortException) { /* cleanup */ System.Diagnostics.Debug.WriteLine("catch"); } }); Now, if I wish to abort the set of threads part way through, the cleanup may still be desirable later on down the line. Looking through MSDN implies you can .Abort() a thread that has not started, and then .Start() it, at which point it will receive the exception and perform normally. Or you can .Join() the aborted thread to wait for it to finish aborting. Presumably you can combine them. http://msdn.microsoft.com/en-us/library/ty8d3wta(v=VS.80).aspx To wait until a thread has aborted, you can call the Join method on the thread after calling the Abort method, but there is no guarantee the wait will end. If Abort is called on a thread that has not been started, the thread will abort when Start is called. If Abort is called on a thread that is blocked or is sleeping, the thread is interrupted and then aborted. Now, when I debug and step through this code: t.Abort(); // ThreadState == Unstarted | AbortRequested t.Start(); // throws ThreadStartException: "Thread failed to start." // so I comment it out, and t.Join(); // throws ThreadStateException: "Thread has not been started." At no point do I see any output, nor do any breakpoints on either the try or catch block get reached. Oddly, ThreadStartException is not listed as a possible throw of .Start(), from here: http://msdn.microsoft.com/en-us/library/a9fyxz7d(v=VS.80).aspx (or any other version) I understand this could be avoided by having a start parameter, which states if the thread should jump to cleanup code, and foregoing the Abort call (which is probably what I'll do). And I could .Start() the thread, and then .Abort() it. But as an indeterminate amount of time may pass between .Start and .Abort, I'm considering it unreliable, and the documentation seems to say my original method should work. Am I missing something? Is the documentation wrong? edit: ow. And you can't call .Start(param) on a non-parameterized Thread(Start). Is there a way to find out if a thread is parameterized or not, aside from trial and error? I see a private m_Delegate, but nothing public...

    Read the article

  • 2nd Year College - Learning - Microsoft Server Products

    - by Ryan
    As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

    Read the article

  • Using $this when not in object context

    - by Ken
    I'm creating a function to show blog's. So I made a show blog function but it keeps giving "Using $this when not in object context" error Class Blog{ public function getLatestBlogsBig($cat = null){ $sqlString = "SELECT blog_id FROM jab_blog"; if($cat != null) $sqlString .= " WHERE blog_cat = " . $cat; $sqlString .= " ORDER BY blog_id DESC LIMIT 5"; $blog = mysql_query($sqlString); while($id = mysql_result($blog,"blog_id")){ $this->showBlog($id); //Error is on this line } } function showBlog($id,$small = false){ $sqlString = "SELECT blog_id FROM jab_blog WHERE blog_id=" . $id . ";"; $blog = mysql_query($sqlString); if($small = true){ echo "<ul>"; while($blogItem = mysql_fetch_array($blog)){ echo '<a href="' . $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']) .'">' . $blogItem['blog_title'] . '</a></li>'; } echo "</ul>"; }else{ while($blogItem = mysql_fetch_array($blog)){ ?> <div class="post"> <h2 class="title"><a href="<?php echo $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']);?>"><?php echo $blogItem['blog_title'];?></a></h2> <p class="meta"><span class="date">The date implement</span><span class="posted">Posted by <a href="#">Someone</a></span></p> <div style="clear: both;">&nbsp;</div> <div class="entry"> <?php echo $blogItem['blog_content'];?> </div> </div> <?php } } } }

    Read the article

  • Progress dialog getting dismissed before the thread gets finished - Android

    - by user264953
    Hi experts, I use the code provided by Fedor in the following link, in order to get the latitude and longitude from my simple demo app. I am trying to fetch the latitude and longitude using the MyLocation class provided by him in that link. What is the simplest and most robust way to get the user's current location in Android? I try to fetch the latitude and longitude on a button click. On the button click, I start an async task and delegate the location fetching work to the do in background method of my asynctask. pre execute - progressdialog initiated. post execute - progress dialog dismissed. This is how, the progress dialog in my code should work and here is the issue which I have. THe progress dialog gets initiated correctly, but even before the latitude and longitude gets printed in the doinbackground method, the progress dialog gets dismissed. I do not understand why this happens. Here is my front end activity public class LocationServices extends Activity { MyLocation myLocation = new MyLocation(); LocationResult locationResult; TextView tv1, tv2; Location location; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); tv1 = (TextView) findViewById(R.id.tv1); tv2 = (TextView) findViewById(R.id.tv2); Button btn = (Button) findViewById(R.id.Button01); btn.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { new LocationAsyncTasking().execute(); } }); } public class LocationAsyncTasking extends AsyncTask<String, Void, Void> { ProgressDialog dialog; int totalAvail; protected void onPreExecute() { // this.dialog.setMessage("Inserting data..."); dialog = new ProgressDialog(LocationServices.this); this.dialog.setMessage("Fetching data..."); this.dialog.show(); } protected Void doInBackground(String... args) { Looper.prepare(); locationResult = new LocationResult() { public void gotLocation(Location location) { // TODO Auto-generated method stub // LocationServices.this.location = location; System.out.println("Progress dialog should be present now - latitude"+location.getLatitude()); System.out.println("Progress dialog should be present now - longitude"+location.getLongitude()); } }; myLocation.getLocation(LocationServices.this, locationResult); return (null); } protected void onProgressUpdate(Integer... progress) { } protected void onPostExecute(Void unused) { dialog.dismiss(); } } } I am quite puzzled, thinking of what makes this progress dialog disappear even before the SOP in doinbackground is finished. Experts, please help me understand and resolve this issue. Any help in this regard is well appreciated. Looking forward, Best Regards, Rony

    Read the article

  • How to manipulate file paths intelligently in .Net 3.0?

    - by Hamish Grubijan
    Scenario: I am maintaining a function which helps with an install - copies files from PathPart1/pending_install/PathPart2/fileName to PathPart1/PathPart2/fileName. It seems that String.Replace() and Path.Combine() do not play well together. The code is below. I added this section: // The behavior of Path.Combine is weird. See: // http://stackoverflow.com/questions/53102/why-does-path-combine-not-properly-concatenate-filenames-that-start-with-path-dir while (strDestFile.StartsWith(@"\")) { strDestFile = strDestFile.Substring(1); // Remove any leading backslashes } Debug.Assert(!Path.IsPathRooted(strDestFile), "This will make the Path.Combine(,) fail)."); in order to take care of a bug (code is sensitive to a constant @"pending_install\" vs @"pending_install" which I did not like and changed (long story, but there was a good opportunity for constant reuse). Now the whole function: //You want to uncompress only the files downloaded. Not every file in the dest directory. private void UncompressFiles() { string strSrcDir = _application.Client.TempDir; ArrayList arrFiles = new ArrayList(); GetAllCompressedFiles(ref arrFiles, strSrcDir); IEnumerator enumer = arrFiles.GetEnumerator(); while (enumer.MoveNext()) { string strDestFile = enumer.Current.ToString().Replace(_application.Client.TempDir, String.Empty); // The behavior of Path.Combine is weird. See: // http://stackoverflow.com/questions/53102/why-does-path-combine-not-properly-concatenate-filenames-that-start-with-path-dir while (strDestFile.StartsWith(@"\")) { strDestFile = strDestFile.Substring(1); // Remove any leading backslashes } Debug.Assert(!Path.IsPathRooted(strDestFile), "This will make the Path.Combine(,) fail)."); strDestFile = Path.Combine(_application.Client.BaseDir, strDestFile); strDestFile = strDestFile.Replace(Path.GetExtension(strDestFile), String.Empty); ZSharpLib.ZipExtractor.ExtractZip(enumer.Current.ToString(), strDestFile); FileUtility.DeleteFile(enumer.Current.ToString()); } } Please do not laugh at the use of ArrayList and the way it is being iterated - it was pioneered by a C++ coder during a .Net 1.1 era. I will change it. What I am interested in: what is a better way of replacing PathPart1/pending_install/PathPart2/fileName with PathPart1/PathPart2/fileName within the current code. Note that _application.Client.TempDir is just _application.Client.BaseDir + @"\pending_install". While there are many ways to improve the code, I am mainly concerned with the part which has to do with String.Replace(...) and Path.Combine(,). I do not want to make changes outside of this function. I wish Path.Combine(,) took an optional bool flag, but it does not. So ... given my constraints, how can I rework this so that it starts to sucks less? Thanks!

    Read the article

  • Having a Link Only Appear If a Logged-In User Appears on a Dynamic List

    - by John
    Hello, For the function below, I would like the link <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> to only appear if the logged in user currently appears on editorlist.php. (I. e. if the loginid in the function corresponds to any of the usernames that currently appear in editorlist.php.) Appearing on editorlist.php is something that is dynamic. How can I do this? Thanks in advance, John function show_userbox() { // retrieve the session information $u = $_SESSION['username']; $uid = $_SESSION['loginid']; // display the user box echo '<div id="userbox"> <div class="username">'.$u.'</div> <div class="submit"><a href="http://www...com/.../submit.php">Submit an item.</a></div> <div class="changepassword"><a href="http://www...com/.../changepassword.php">Change Password</a></div> <div class="logout"><a href="http://www...com/.../logout.php">Logout</a></div> <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> </div>'; } On editorlist.php: $sqlStr = "SELECT l.loginid, l.username, l.created, DATEDIFF(NOW(), l.created) AS days, COALESCE(s.total, 0) AS countSubmissions, COALESCE(c.total, 0) AS countComments, COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore, DATEDIFF(NOW(), l.created) + COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore2 FROM login l LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM submission GROUP BY loginid ) s ON l.loginid = s.loginid LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM comment GROUP BY loginid ) c ON l.loginid = c.loginid GROUP BY l.loginid ORDER BY totalScore2 DESC LIMIT 10"; $result = mysql_query($sqlStr); $arr = array(); echo "<table class=\"samplesrec1edit\">"; while ($row = mysql_fetch_array($result)) { echo '<tr>'; echo '<td class="sitename1edit1"><a href="http://www...com/.../members/index.php?profile='.$row["username"].'">'.stripslashes($row["username"]).'</a></td>'; echo '<td class="sitename1edit2">'.($row["countSubmissions"]).'</td>'; echo '<td class="sitename1edit2">'.($row["countComments"]).'</td>'; echo '<td class="sitename1edit2">'.($row["days"]).'</td>'; echo '<td class="sitename1edit2">'.($row["totalScore2"]).'</td>'; echo '</tr>'; } echo "</table>";

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • How do I query delegation properties of an active directory user account?

    - by Mark J Miller
    I am writing a utility to audit the configuration of a WCF service. In order to properly pass credentials from the client, thru the WCF service back to the SQL back end the domain account used to run the service must be configured in Active Directory with the setting "Trust this user for delegation" (Properties - "Delegation" tab). Using C#, how do I access the settings on this tab in Active Directory. I've spent the last 5 hours trying to track this down on the web and can't seem to find it. Here's what I've done so far: using (Domain domain = Domain.GetCurrentDomain()) { Console.WriteLine(domain.Name); // get domain "dev" from MSSQLSERVER service account DirectoryEntry ouDn = new DirectoryEntry("LDAP://CN=Users,dc=dev,dc=mydomain,dc=lcl"); DirectorySearcher search = new DirectorySearcher(ouDn); // get sAMAccountName "dev.services" from MSSQLSERVER service account search.Filter = "(sAMAccountName=dev.services)"; search.PropertiesToLoad.Add("displayName"); search.PropertiesToLoad.Add("userAccountControl"); SearchResult result = search.FindOne(); if (result != null) { Console.WriteLine(result.Properties["displayName"][0]); DirectoryEntry entry = result.GetDirectoryEntry(); int userAccountControlFlags = (int)entry.Properties["userAccountControl"].Value; if ((userAccountControlFlags & (int)UserAccountControl.TRUSTED_FOR_DELEGATION) == (int)UserAccountControl.TRUSTED_FOR_DELEGATION) Console.WriteLine("TRUSTED_FOR_DELEGATION"); else if ((userAccountControlFlags & (int)UserAccountControl.TRUSTED_TO_AUTH_FOR_DELEGATION) == (int)UserAccountControl.TRUSTED_TO_AUTH_FOR_DELEGATION) Console.WriteLine("TRUSTED_TO_AUTH_FOR_DELEGATION"); else if ((userAccountControlFlags & (int)UserAccountControl.NOT_DELEGATED) == (int)UserAccountControl.NOT_DELEGATED) Console.WriteLine("NOT_DELEGATED"); foreach (PropertyValueCollection pvc in entry.Properties) { Console.WriteLine(pvc.PropertyName); for (int i = 0; i < pvc.Count; i++) { Console.WriteLine("\t{0}", pvc[i]); } } } } The "userAccountControl" does not seem to be the correct property. I think it is tied to the "Account Options" section on the "Account" tab, which is not what we're looking for but this is the closest I've gotten so far. The justification for all this is: We do not have permission to setup the service in QA or in Production, so along with our written instructions (which are notoriously only followed in partial) I am creating a tool that will audit the setup (WCF and SQL) to determine if the setup is correct. This will allow the person deploying the service to run this utility and verify everything is setup correctly - saving us hours of headaches and reducing downtime during deployment.

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

< Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >