Search Results

Search found 18329 results on 734 pages for 'interpret order'.

Page 681/734 | < Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >

  • Using Core Data Concurrently and Reliably

    - by John Topley
    I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • C++ string sort like a human being?

    - by Walter Nissen
    I would like to sort alphanumeric strings the way a human being would sort them. I.e., "A2" comes before "A10", and "a" certainly comes before "Z"! Is there any way to do with without writing a mini-parser? Ideally it would also put "A1B1" before "A1B10". I see the question "Natural (human alpha-numeric) sort in Microsoft SQL 2005" with a possible answer, but it uses various library functions, as does "Sorting Strings for Humans with IComparer". Below is a test case that currently fails: #include <set> #include <iterator> #include <iostream> #include <vector> #include <cassert> template <typename T> struct LexicographicSort { inline bool operator() (const T& lhs, const T& rhs) const{ std::ostringstream s1,s2; s1 << toLower(lhs); s2 << toLower(rhs); bool less = s1.str() < s2.str(); std::cout<<s1.str()<<" "<<s2.str()<<" "<<less<<"\n"; return less; } inline std::string toLower(const std::string& str) const { std::string newString(""); for (std::string::const_iterator charIt = str.begin(); charIt!=str.end();++charIt) { newString.push_back(std::tolower(*charIt)); } return newString; } }; int main(void) { const std::string reference[5] = {"ab","B","c1","c2","c10"}; std::vector<std::string> referenceStrings(&(reference[0]), &(reference[5])); //Insert in reverse order so we know they get sorted std::set<std::string,LexicographicSort<std::string> > strings(referenceStrings.rbegin(), referenceStrings.rend()); std::cout<<"Items:\n"; std::copy(strings.begin(), strings.end(), std::ostream_iterator<std::string>(std::cout, "\n")); std::vector<std::string> sortedStrings(strings.begin(), strings.end()); assert(sortedStrings == referenceStrings); }

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • highlighting search results in php error

    - by fusion
    i'm trying to figure out what is wrong in this code. it either doesn't highlight the search result OR it outputs html tags surrounding the highlighted text. . $search_result = ""; $search_result = trim($search_result); $special_cases = array( '%', '_', '+' ); $search_result = str_replace( $special_cases, '', $_GET["q"] ); //Check if the string is empty if ($search_result == "") { echo "<p>Search Error</p><p>Please enter a search...</p>" ; exit(); } $result = mysql_query('SELECT cQuotes, vAuthor, cArabic, vReference FROM thquotes WHERE cQuotes LIKE "%' . mysql_real_escape_string($search_result) .'%" ORDER BY idQuotes DESC', $conn) or die ('Error: '.mysql_error()); //eliminating special characters function h($s) { echo htmlspecialchars($s, ENT_QUOTES); } function highlightWords($string, $word) { $string = str_replace($word, "<span style='background-color: #FFE066;font-weight:bold;'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } ?> <div class="caption">Search Results</div> <div class="center_div"> <table> <?php while ($row= mysql_fetch_array($result, MYSQL_ASSOC)) { $cQuote = highlightWords($row['cQuotes'], $search_result); ?> <tr> <td style="text-align:right; font-size:15px;"><?php h($row['cArabic']); ?></td> <td style="font-size:16px;"><?php h($cQuote); ?></td> <td style="font-size:12px;"><?php h($row['vAuthor']); ?></td> <td style="font-size:12px; font-style:italic; text-align:right;"><?php h($row['vReference']); ?></td> </tr> <?php } ?> </table> </div> on the browser, it is outputted as: A good <span style='background-color: #FFE066;font-weight:bold;'>action</span> is an ever-remaining store and a pure yield or if a div is used with class: A good <div class='highlight'>action</div> is an ever-remaining store and a pure yield

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Get data from aspx.cs page to aspx page.

    - by Brad8118
    So I am using a jquery plug in that allows me to change the order of things in a list by dragging and dropping them. So my goal is to be able to grab a list of my objects (AlertInfo) and using it in a javascript function. I was able to use a json webservice call in a test project to pass the data to the page. But we don't have a webservice page now so I tried to grab it from a aspx.cs page and it hasn't worked. ///Aspx page: $.ajax({ type: "POST", url: "~/Alerts/GetAlerts", data: "{}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (msg) { var data = eval("(" + msg.d + ")"); jQuery.each(data, function (rec) { AlertList[AlertList.length] = new objAlert(this.id, this.title, this.details, JSONDateSerializationFix(this.startdate), JSONDateSerializationFix(this.enddate)); UpdateDisplayList(); }) }, error: function (msg) { alert("BRAD" + msg); } The issue is that the Alerts page in "URL /Alerts/GetAlerts" is Alerts.aspx.cs. I can't figure out if I can use this ajax command to call a method in a aspx.cs page. //Code behind page aspx.cs [WebMethod] //[ScriptMethod(ResponseFormat = ResponseFormat.Json)] public string GetAlerts() { List list = AlertInfo.GetTestAlerts(); return new JavaScriptSerializer().Serialize(list); } public List GetAlertsList() { List list = AlertInfo.GetTestAlerts(); return list; ; } So I was hoping that I could load data into an asp control (dataList) and then grab the data //code behind page protected void Page_Load(object sender, EventArgs e) { dataListAlertList.DataSource = GetAlertsList(); dataListAlertList.DataBind(); } public static List<AlertInfo> GetTestAlerts() { List<AlertInfo> list = new List<AlertInfo>(); list.Add(new AlertInfo("0", "Alert 1 Title", "Alert 1 Detail", "10/10/2010", "10/10/2011")); list.Add(new AlertInfo("1", "Alert 2 Title", "Alert 2 Detail", "10/10/2010", "10/10/2011")); return list; } //.aspx page $(document).ready(function () { var a1 = $("#dataListAlertList").val(); // do fun stuff now. } But I keep getting undefined....

    Read the article

  • .NET threading: how can I capture an abort on an unstarted thread?

    - by Groxx
    I have a chunk of threads I wish to run in order, on an ASP site running .NET 2.0 with Visual Studio 2008 (no idea how much all that matters, but there it is), and they may have aborted-clean-up code which should be run regardless of how far through their task they are. So I make a thread like this: Thread t = new Thread(delegate() { try { /* do things */ System.Diagnostics.Debug.WriteLine("try"); } catch (ThreadAbortException) { /* cleanup */ System.Diagnostics.Debug.WriteLine("catch"); } }); Now, if I wish to abort the set of threads part way through, the cleanup may still be desirable later on down the line. Looking through MSDN implies you can .Abort() a thread that has not started, and then .Start() it, at which point it will receive the exception and perform normally. Or you can .Join() the aborted thread to wait for it to finish aborting. Presumably you can combine them. http://msdn.microsoft.com/en-us/library/ty8d3wta(v=VS.80).aspx To wait until a thread has aborted, you can call the Join method on the thread after calling the Abort method, but there is no guarantee the wait will end. If Abort is called on a thread that has not been started, the thread will abort when Start is called. If Abort is called on a thread that is blocked or is sleeping, the thread is interrupted and then aborted. Now, when I debug and step through this code: t.Abort(); // ThreadState == Unstarted | AbortRequested t.Start(); // throws ThreadStartException: "Thread failed to start." // so I comment it out, and t.Join(); // throws ThreadStateException: "Thread has not been started." At no point do I see any output, nor do any breakpoints on either the try or catch block get reached. Oddly, ThreadStartException is not listed as a possible throw of .Start(), from here: http://msdn.microsoft.com/en-us/library/a9fyxz7d(v=VS.80).aspx (or any other version) I understand this could be avoided by having a start parameter, which states if the thread should jump to cleanup code, and foregoing the Abort call (which is probably what I'll do). And I could .Start() the thread, and then .Abort() it. But as an indeterminate amount of time may pass between .Start and .Abort, I'm considering it unreliable, and the documentation seems to say my original method should work. Am I missing something? Is the documentation wrong? edit: ow. And you can't call .Start(param) on a non-parameterized Thread(Start). Is there a way to find out if a thread is parameterized or not, aside from trial and error? I see a private m_Delegate, but nothing public...

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • Passing variables from PHP to Javascript back to PHP using Ajax.

    - by ObjectiveJ
    I hope this makes sesne, please bare with me. So I have a PHP page that contains variables, I have some radial boxes, and on click of them, it calculates a price for the item you have clicked on. I do this by activating a js function that I have passed some variables to. Like so. PHP: <?php $result = mssql_query("SELECT * FROM Segments ORDER BY 'Squares'"); if (!$result) { echo 'query failed'; exit; } while ($row = mssql_fetch_array($result)) { ?> <span><?php echo $row["Squares"]; ?></span><input name="squares" type="radio" onclick="ajaxCases('<?php echo $row["Squares"]; ?>', '<?php echo $row["StartCaseID"]; ?>', '<?php echo $row["StartMatrixPrice"]; ?>')" value="<?php echo $row["Squares"]; ?>"<?php if ($row["Squares"] == "1") { ?> checked="checked" <?php }else{ ?> checked="" <?php } ?>/> <?php } ?> As you can see onclick it goes to a function called ajaxcases, this function looks like this. function ajaxCases(squares,start,price){ $('#step1').html('<p style="margin:100px 0px 0px 100px"><img src="images/ajax-loader-bigindic.gif" width="32" height="32" alt="" /></p>'); $('#step1').load("ajax-styles.php?squares="+squares); prevId1 = ""; document.varsForm.caseid.value=start; $('#step1price').html('<span style="margin:0px 0px 0px 30px"><img src="images/ajax-loader-price.gif" width="24" height="24" alt="" /></span>'); $('#step1price').load("ajax-step1-price.php?Squares="+Squares); return true; } This then goes to a php page called ajax-step1-price.php and I try to recall the variable Squares. However it doesn't work, I thought it was a GET however that returns undefined. In Summary: I would like to know how to pass a variable from PHP to JS then back to PHP, or if someone could just tell me where I am going wrong that would be greatly appreciated.

    Read the article

  • Stored procedure optimization

    - by George Zacharia
    Hi, i have a stored procedure which takes lot of time to execure .Can any one suggest a better approch so that the same result set is achived. ALTER PROCEDURE [dbo].[spFavoriteRecipesGET] @USERID INT, @PAGENUMBER INT, @PAGESIZE INT, @SORTDIRECTION VARCHAR(4), @SORTORDER VARCHAR(4),@FILTERBY INT AS BEGIN DECLARE @ROW_START INT DECLARE @ROW_END INT SET @ROW_START = (@PageNumber-1)* @PageSize+1 SET @ROW_END = @PageNumber*@PageSize DECLARE @RecipeCount INT DECLARE @RESULT_SET_TABLE TABLE ( Id INT NOT NULL IDENTITY(1,1), FavoriteRecipeId INT, RecipeId INT, DateAdded DATETIME, Title NVARCHAR(255), UrlFriendlyTitle NVARCHAR(250), [Description] NVARCHAR(MAX), AverageRatingId FLOAT, SubmittedById INT, SubmittedBy VARCHAR(250), RecipeStateId INT, RecipeRatingId INT, ReviewCount INT, TweaksCount INT, PhotoCount INT, ImageName NVARCHAR(50) ) INSERT INTO @RESULT_SET_TABLE SELECT FavoriteRecipes.FavoriteRecipeId, Recipes.RecipeId, FavoriteRecipes.DateAdded, Recipes.Title, Recipes.UrlFriendlyTitle, Recipes.[Description], Recipes.AverageRatingId, Recipes.SubmittedById, COALESCE(users.DisplayName,users.UserName,Recipes.SubmittedBy) As SubmittedBy, Recipes.RecipeStateId, RecipeReviews.RecipeRatingId, COUNT(RecipeReviews.Review), COUNT(RecipeTweaks.Tweak), COUNT(Photos.PhotoId), dbo.udfGetRecipePhoto(Recipes.RecipeId) AS ImageName FROM FavoriteRecipes INNER JOIN Recipes ON FavoriteRecipes.RecipeId=Recipes.RecipeId AND Recipes.RecipeStateId <> 3 LEFT OUTER JOIN RecipeReviews ON RecipeReviews.RecipeId=Recipes.RecipeId AND RecipeReviews.ReviewedById=@UserId AND RecipeReviews.RecipeRatingId= ( SELECT MAX(RecipeReviews.RecipeRatingId) FROM RecipeReviews WHERE RecipeReviews.ReviewedById=@UserId AND RecipeReviews.RecipeId=FavoriteRecipes.RecipeId ) OR RecipeReviews.RecipeRatingId IS NULL LEFT OUTER JOIN RecipeTweaks ON RecipeTweaks.RecipeId = Recipes.RecipeId AND RecipeTweaks.TweakedById= @UserId LEFT OUTER JOIN Photos ON Photos.RecipeId = Recipes.RecipeId AND Photos.UploadedById = @UserId AND Photos.RecipeId = FavoriteRecipes.RecipeId AND Photos.PhotoTypeId = 1 LEFT OUTER JOIN users ON Recipes.SubmittedById = users.UserId WHERE FavoriteRecipes.UserId=@UserId GROUP BY FavoriteRecipes.FavoriteRecipeId, Recipes.RecipeId, FavoriteRecipes.DateAdded, Recipes.Title, Recipes.UrlFriendlyTitle, Recipes.[Description], Recipes.AverageRatingId, Recipes.SubmittedById, Recipes.SubmittedBy, Recipes.RecipeStateId, RecipeReviews.RecipeRatingId, users.DisplayName, users.UserName, Recipes.SubmittedBy; WITH SortResults AS ( SELECT ROW_NUMBER() OVER ( ORDER BY CASE WHEN @SORTDIRECTION = 't' AND @SORTORDER='a' THEN TITLE END ASC, CASE WHEN @SORTDIRECTION = 't' AND @SORTORDER='d' THEN TITLE END DESC, CASE WHEN @SORTDIRECTION = 'r' AND @SORTORDER='a' THEN AverageRatingId END ASC, CASE WHEN @SORTDIRECTION = 'r' AND @SORTORDER='d' THEN AverageRatingId END DESC, CASE WHEN @SORTDIRECTION = 'mr' AND @SORTORDER='a' THEN RecipeRatingId END ASC, CASE WHEN @SORTDIRECTION = 'mr' AND @SORTORDER='d' THEN RecipeRatingId END DESC, CASE WHEN @SORTDIRECTION = 'd' AND @SORTORDER='a' THEN DateAdded END ASC, CASE WHEN @SORTDIRECTION = 'd' AND @SORTORDER='d' THEN DateAdded END DESC ) RowNumber, FavoriteRecipeId, RecipeId, DateAdded, Title, UrlFriendlyTitle, [Description], AverageRatingId, SubmittedById, SubmittedBy, RecipeStateId, RecipeRatingId, ReviewCount, TweaksCount, PhotoCount, ImageName FROM @RESULT_SET_TABLE WHERE ((@FILTERBY = 1 AND SubmittedById= @USERID) OR ( @FILTERBY = 2 AND (SubmittedById <> @USERID OR SubmittedById IS NULL)) OR ( @FILTERBY <> 1 AND @FILTERBY <> 2)) ) SELECT RowNumber, FavoriteRecipeId, RecipeId, DateAdded, Title, UrlFriendlyTitle, [Description], AverageRatingId, SubmittedById, SubmittedBy, RecipeStateId, RecipeRatingId, ReviewCount, TweaksCount, PhotoCount, ImageName FROM SortResults WHERE RowNumber BETWEEN @ROW_START AND @ROW_END print @ROW_START print @ROW_END SELECT @RecipeCount=dbo.udfGetFavRecipesCount(@UserId) SELECT @RecipeCount AS RecipeCount SELECT COUNT(Id) as FilterCount FROM @RESULT_SET_TABLE WHERE ((@FILTERBY = 1 AND SubmittedById= @USERID) OR (@FILTERBY = 2 AND (SubmittedById <> @USERID OR SubmittedById IS NULL)) OR (@FILTERBY <> 1 AND @FILTERBY <> 2)) END

    Read the article

  • Having a Link Only Appear If a Logged-In User Appears on a Dynamic List

    - by John
    Hello, For the function below, I would like the link <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> to only appear if the logged in user currently appears on editorlist.php. (I. e. if the loginid in the function corresponds to any of the usernames that currently appear in editorlist.php.) Appearing on editorlist.php is something that is dynamic. How can I do this? Thanks in advance, John function show_userbox() { // retrieve the session information $u = $_SESSION['username']; $uid = $_SESSION['loginid']; // display the user box echo '<div id="userbox"> <div class="username">'.$u.'</div> <div class="submit"><a href="http://www...com/.../submit.php">Submit an item.</a></div> <div class="changepassword"><a href="http://www...com/.../changepassword.php">Change Password</a></div> <div class="logout"><a href="http://www...com/.../logout.php">Logout</a></div> <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> </div>'; } On editorlist.php: $sqlStr = "SELECT l.loginid, l.username, l.created, DATEDIFF(NOW(), l.created) AS days, COALESCE(s.total, 0) AS countSubmissions, COALESCE(c.total, 0) AS countComments, COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore, DATEDIFF(NOW(), l.created) + COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore2 FROM login l LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM submission GROUP BY loginid ) s ON l.loginid = s.loginid LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM comment GROUP BY loginid ) c ON l.loginid = c.loginid GROUP BY l.loginid ORDER BY totalScore2 DESC LIMIT 10"; $result = mysql_query($sqlStr); $arr = array(); echo "<table class=\"samplesrec1edit\">"; while ($row = mysql_fetch_array($result)) { echo '<tr>'; echo '<td class="sitename1edit1"><a href="http://www...com/.../members/index.php?profile='.$row["username"].'">'.stripslashes($row["username"]).'</a></td>'; echo '<td class="sitename1edit2">'.($row["countSubmissions"]).'</td>'; echo '<td class="sitename1edit2">'.($row["countComments"]).'</td>'; echo '<td class="sitename1edit2">'.($row["days"]).'</td>'; echo '<td class="sitename1edit2">'.($row["totalScore2"]).'</td>'; echo '</tr>'; } echo "</table>";

    Read the article

  • OpenGL, how to set a monocrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :) Thank's

    Read the article

  • Using $this when not in object context

    - by Ken
    I'm creating a function to show blog's. So I made a show blog function but it keeps giving "Using $this when not in object context" error Class Blog{ public function getLatestBlogsBig($cat = null){ $sqlString = "SELECT blog_id FROM jab_blog"; if($cat != null) $sqlString .= " WHERE blog_cat = " . $cat; $sqlString .= " ORDER BY blog_id DESC LIMIT 5"; $blog = mysql_query($sqlString); while($id = mysql_result($blog,"blog_id")){ $this->showBlog($id); //Error is on this line } } function showBlog($id,$small = false){ $sqlString = "SELECT blog_id FROM jab_blog WHERE blog_id=" . $id . ";"; $blog = mysql_query($sqlString); if($small = true){ echo "<ul>"; while($blogItem = mysql_fetch_array($blog)){ echo '<a href="' . $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']) .'">' . $blogItem['blog_title'] . '</a></li>'; } echo "</ul>"; }else{ while($blogItem = mysql_fetch_array($blog)){ ?> <div class="post"> <h2 class="title"><a href="<?php echo $_SESSION['JAB_LINK'] . "blog/" . $blogItem['blog_id'] . "/" . SimpleUrl::toAscii($blogItem['blog_title']);?>"><?php echo $blogItem['blog_title'];?></a></h2> <p class="meta"><span class="date">The date implement</span><span class="posted">Posted by <a href="#">Someone</a></span></p> <div style="clear: both;">&nbsp;</div> <div class="entry"> <?php echo $blogItem['blog_content'];?> </div> </div> <?php } } } }

    Read the article

  • 2nd Year College - Learning - Microsoft Server Products

    - by Ryan
    As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

    Read the article

  • Intent filter for browsing XML (specifically rss) in android

    - by Leif Andersen
    I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

    Read the article

  • Blit Queue Optimization Algorithm

    - by martona
    I'm looking to implement a module that manages a blit queue. There's a single surface, and portions of this surface (bounded by rectangles) are copied to elsewhere within the surface: add_blt(rect src, point dst); There can be any number of operations posted, in order, to the queue. Eventually the user of the queue will stop posting blits, and ask for an optimal set of operations to actually perform on the surface. The task of the module is to ensure that no pixel is copied unnecessarily. This gets tricky because of overlaps of course. A blit could re-blit a previously copied pixel. Ideally blit operations would be subdivided in the optimization phase in such a way that every block goes to its final place with a single operation. It's tricky but not impossible to put this together. I'm just trying to not reinvent the wheel. I looked around on the 'net, and the only thing I found was the SDL_BlitPool Library which assumes that the source surface differs from the destination. It also does a lot of grunt work, seemingly unnecessarily: regions and similar building blocks are a given. I'm looking for something higher-level. Of course, I'm not going to look a gift horse in the mouth, and I also don't mind doing actual work... If someone can come forward with a basic idea that makes this problem seem less complex than it does right now, that'd be awesome too. EDIT: Thinking about aaronasterling's answer... could this work? Implement customized region handler code that can maintain metadata for every rectangle it contains. When the region handler splits up a rectangle, it will automatically associate the metadata of this rectangle with the resulting sub-rectangles. When the optimization run starts, create an empty region handled by the above customized code, call this the master region Iterate through the blt queue, and for every entry: Let srcrect be the source rectangle for the blt beng examined Get the intersection of srcrect and master region into temp region Remove temp region from master region, so master region no longer covers temp region Promote srcrect to a region (srcrgn) and subtract temp region from it Offset temp region and srcrgn with the vector of the current blt: their union will cover the destination area of the current blt Add to master region all rects in temp region, retaining the original source metadata (step one of adding the current blt to the master region) Add to master region all rects in srcrgn, adding the source information for the current blt (step two of adding the current blt to the master region) Optimize master region by checking if adjacent sub-rectangles that are merge candidates have the same metadata. Two sub-rectangles are merge candidates if (r1.x1 == r2.x1 && r1.x2 == r2.x2) | (r1.y1 == r2.y1 && r1.y2 == r2.y2). If yes, combine them. Enumerate master region's sub-rectangles. Every rectangle returned is an optimized blt operation destination. The associated metadata is the blt operation`s source.

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

< Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >