Search Results

Search found 18329 results on 734 pages for 'interpret order'.

Page 681/734 | < Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Cannot work for 2nd iteration because of writing delay.

    - by karikari
    My code's IF-THEN does not work for 2nd iteration. This is due to, the jar processing take some time to write it result inside the output.txt. Since the writing is a bit late, my code's 2nd iteration will always read the previous written value inside the output.txt in order to pass it to the IF-THEN. For example, in 1st iteration: output.txt -- 0.9888 twrite.txt -- msg: ok 2nd iteration: output.txt -- 0.5555 twrite.txt -- msg: ok //the IF-THEN still gives this result which is based on previous iteration. it should be msg: not ok . since it is < 0.7 I need help, how to solve this 'delay' problem? HRESULT CButtonDemoBHO::onDocumentComplete(IDispatch *pDisp, VARIANT *vUrl){ ATLTRACE("CButtonDemoBHO::onDocumentComplete %S\n", vUrl->bstrVal); WinHttpClient client(vUrl->bstrVal); client.SendHttpRequest(); wstring httpResponseHeader = client.GetHttpResponseHeader(); wstring httpResponse = client.GetHttpResponse(); writeToLog(httpResponse.c_str()); if (isMainFrame(pDisp)){ m_normalPageLoad=false; FILE *child = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt > c:\\output.txt", "r"); fclose(child); char readnumber[10]; float f = 0; FILE *file11 = fopen("c:\\output.txt","r"); char* p = fgets(readnumber,10,file11); std::istringstream iss(p); iss >> f; if (f > 0.7) { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: ok"; file12.close(); } else { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: not ok"; file12.close(); } iss.clear(); fclose(file11); return S_OK; } return S_OK; }

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

  • .NET threading: how can I capture an abort on an unstarted thread?

    - by Groxx
    I have a chunk of threads I wish to run in order, on an ASP site running .NET 2.0 with Visual Studio 2008 (no idea how much all that matters, but there it is), and they may have aborted-clean-up code which should be run regardless of how far through their task they are. So I make a thread like this: Thread t = new Thread(delegate() { try { /* do things */ System.Diagnostics.Debug.WriteLine("try"); } catch (ThreadAbortException) { /* cleanup */ System.Diagnostics.Debug.WriteLine("catch"); } }); Now, if I wish to abort the set of threads part way through, the cleanup may still be desirable later on down the line. Looking through MSDN implies you can .Abort() a thread that has not started, and then .Start() it, at which point it will receive the exception and perform normally. Or you can .Join() the aborted thread to wait for it to finish aborting. Presumably you can combine them. http://msdn.microsoft.com/en-us/library/ty8d3wta(v=VS.80).aspx To wait until a thread has aborted, you can call the Join method on the thread after calling the Abort method, but there is no guarantee the wait will end. If Abort is called on a thread that has not been started, the thread will abort when Start is called. If Abort is called on a thread that is blocked or is sleeping, the thread is interrupted and then aborted. Now, when I debug and step through this code: t.Abort(); // ThreadState == Unstarted | AbortRequested t.Start(); // throws ThreadStartException: "Thread failed to start." // so I comment it out, and t.Join(); // throws ThreadStateException: "Thread has not been started." At no point do I see any output, nor do any breakpoints on either the try or catch block get reached. Oddly, ThreadStartException is not listed as a possible throw of .Start(), from here: http://msdn.microsoft.com/en-us/library/a9fyxz7d(v=VS.80).aspx (or any other version) I understand this could be avoided by having a start parameter, which states if the thread should jump to cleanup code, and foregoing the Abort call (which is probably what I'll do). And I could .Start() the thread, and then .Abort() it. But as an indeterminate amount of time may pass between .Start and .Abort, I'm considering it unreliable, and the documentation seems to say my original method should work. Am I missing something? Is the documentation wrong? edit: ow. And you can't call .Start(param) on a non-parameterized Thread(Start). Is there a way to find out if a thread is parameterized or not, aside from trial and error? I see a private m_Delegate, but nothing public...

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

  • Is there limit of "join" or the "where" or length of SQL query ?

    - by Chetan sharma
    Actually i was trying to get data from elgg database based on multiple joins. It generated very big query with lots of JOIN statements and query never respond back. SELECT distinct e.* from test_entities e JOIN test_metadata m1 on e.guid = m1.entity_guid JOIN test_metastrings ms1 on ms1.id = m1.name_id JOIN test_metastrings mv1 on mv1.id = m1.value_id JOIN test_objects_entity obj on e.guid = obj.guid JOIN test_metadata m2 on e.guid = m2.entity_guid JOIN test_metastrings ms2 on ms2.id = m2.name_id JOIN test_metastrings mv2 on mv2.id = m2.value_id JOIN test_metadata m3 on e.guid = m3.entity_guid JOIN test_metastrings ms3 on ms3.id = m3.name_id JOIN test_metastrings mv3 on mv3.id = m3.value_id JOIN test_metadata m4 on e.guid = m4.entity_guid JOIN test_metastrings ms4 on ms4.id = m4.name_id JOIN test_metastrings mv4 on mv4.id = m4.value_id JOIN test_metadata m5 on e.guid = m5.entity_guid JOIN test_metastrings ms5 on ms5.id = m5.name_id JOIN test_metastrings mv5 on mv5.id = m5.value_id JOIN test_metadata m6 on e.guid = m6.entity_guid JOIN test_metastrings ms6 on ms6.id = m6.name_id JOIN test_metastrings mv6 on mv6.id = m6.value_id where ms1.string='expire_date' and mv1.string <= 1272565800 and ms2.string='homecity' and mv2.string LIKE "%dasf%" and ms3.string='schoolname' and mv3.string LIKE "%asdf%" and ms4.string='award_amount' and mv4.string <= 123 and ms5.string='no_of_awards' and mv5.string <= 7 and ms6.string='avg_rating' and mv6.string <= 2 and e.type = 'object' and e.subtype = 5 and e.site_guid = 1 and (obj.title like '%asdf%') OR (obj.description like '%asdf%') and ( (e.access_id = -2 AND e.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (e.access_id IN (2,1) OR (e.owner_guid = 5) OR ( e.access_id = 0 AND e.owner_guid = 5 ) ) and e.enabled='yes') and ( (m1.access_id = -2 AND m1.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m1.access_id IN (2,1) OR (m1.owner_guid = 5) OR ( m1.access_id = 0 AND m1.owner_guid = 5 ) ) and m1.enabled='yes') and ( (m2.access_id = -2 AND m2.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m2.access_id IN (2,1) OR (m2.owner_guid = 5) OR ( m2.access_id = 0 AND m2.owner_guid = 5 ) ) and m2.enabled='yes') and ( (m3.access_id = -2 AND m3.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m3.access_id IN (2,1) OR (m3.owner_guid = 5) OR ( m3.access_id = 0 AND m3.owner_guid = 5 ) ) and m3.enabled='yes') and ( (m4.access_id = -2 AND m4.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m4.access_id IN (2,1) OR (m4.owner_guid = 5) OR ( m4.access_id = 0 AND m4.owner_guid = 5 ) ) and m4.enabled='yes') and ( (m5.access_id = -2 AND m5.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m5.access_id IN (2,1) OR (m5.owner_guid = 5) OR ( m5.access_id = 0 AND m5.owner_guid = 5 ) ) and m5.enabled='yes') and ( (m6.access_id = -2 AND m6.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m6.access_id IN (2,1) OR (m6.owner_guid = 5) OR ( m6.access_id = 0 AND m6.owner_guid = 5 ) ) and m6.enabled='yes') order by obj.title limit 0, 10 this is the query that i am running.

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • Supersized image captions - render outside of JavaScript

    - by Sol
    I am using the jQuery supersized script for a full screen slideshow (not the WordPress plugin as this didn't give me enough control). However, one issue that I am trying to tackle is how to render the image caption text outside of the javascript slides[ ] call - and instead, render them within the page div - to improve SEO on the page. My code works fine right now, images and the caption text are correctly displaying, but looking at the source code, there is very little text outside of the javascript (which is bad for SEO), so I would just like to improve it, if possible. I haven't been able to find any other topic on this subject and so far, I've been unsuccessful at improving on the current code, which is as follows; <!-- Supersized 3.2.7 - By Sam Dunn / One Mighty Roar (www.onemightyroar.com) Released under MIT License / GPL License --> <script type="text/javascript"> var slides=[]; <?php $my_query = new WP_Query ( array( 'post_status' => 'publish', 'post_type' => 'featured', //'numberposts' => 5, 'orderby' => 'menu_order', 'order' => 'ASC', 'showposts' => 50 )); while( $my_query->have_posts() ) : $my_query->the_post(); $slink = get_post_meta($post->ID,'FS_link',true); ?> slides.push({image : '<?php echo get_image_path(get_post_meta($post->ID, 'FS_slideimage_src', true)); ?>', title : '<div class="slidecaptioninside"><h1><?php echo the_title(); ?></h1><p><?php echo strip_tags(get_post_meta($post->ID, 'FS_fitemcaption', true)); ?>...<a href="<?php echo $slink;?>">find out more</a></p></div>', url : '<?php echo $slink;?>'}); <?php endwhile; ?> // start supersized JS $j = jQuery.noConflict(); $j(window).load(function() { $j.supersized({ //Functionality slideshow: 1, // ..... additional functions go here... slide_captions : 1, //Slide caption (Pull from "title" in slides array) slides : slides, slide_links : 'blank', progress_bar : 1, mouse_scrub: 1 }); }); </script> <div id="slidecontainer"> <div id="slidecaption"></div> <!--Thumbnail Navigation--> <div id="prevthumb"></div> <div id="nextthumb"></div> <!--additional tray divs here--> </div><!--slidecontainer--> I have tried to get Supersized to output the content into a parent div [div id="supersized"] using $j('#supersized').supersized({ but this doesn't appear to work. Has anyone managed to do this differently to improve page SEO?

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

  • Sandbox "Sorry — your last action could not be completed"

    - by aron
    My site was working fine with PayPal's sandbox, and then all of a sudden it stopped. Now I get the wonderful error Sandbox "Sorry — your last action could not be completed" This is my HTML: <body onload="document.Paypal.submit();"> <!-- item_number should get passed back --> <form name="Paypal" method="post" action="https://www.sandbox.paypal.com cgi-bin/webscr" id="Paypal"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKLTkyNTEyNzc0NGRk0LKGvSMTla6LgHpbOsdk7iC0iXE=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWCALKhatPArLPtrsEAreImG4CweeH+AkCgMPhowcC+NaM4gQC+Y2VqwoCouzSnwEVXI9UvQxqI2UcdQ4SmcSWqfEZNw==" /> </div> <input type="hidden" name="cmd" value="_cart" /> <input type="hidden" name="upload" value="1" /> <!-- The following is for itemized PayPal data instead of the aggregated version --> <input type="hidden" name="item_name_1" value="LEADING SKILLS 4/10/2012 6:00 PM Section: Members " /> <input type="hidden" name="amount_1" value="250.00" /> <input type="hidden" name="quantity_1" value="2" /> <input type="hidden" name="handling_cart" value="7.00" /> <input type="hidden" name="tax_cart" value="35.00" /> <!-- STANDARD DATA --> <input name="business" type="hidden" id="business" value="[email protected]" /> <input name="invoice" type="hidden" id="invoice" value="TS-1E8B59A0-B" /> <input type="hidden" name="no_note" value="0" /> <input name="currency_code" type="hidden" id="currency_code" value="USD" /> <input name="shipCountry" type="hidden" id="shipCountry" /> <input type="hidden" name="return" value="http://rockclimbing.venueblue.com/Gateway/paypal/Complete.aspx?id=db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="cancel_returnUrl" type="hidden" id="cancel_returnUrl" value="http://rockclimbing.venueblue.com/ShoppingCart.aspx" /> <input type="hidden" name="cn" value="How did you hear about us?" /> <input name="custom" type="hidden" id="custom" value="db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="notify_url" type="hidden" id="notify_url" value="http://rockclimbing.venueblue.com/Gateway/Paypal/IPN.aspx" /> <input type="submit" value="Submit Payment Info" style="display:none;" /> Processing Order.... </form> </body> Anyone have a clue what happened?

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • IPhone Development Profile Expired

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • highlighting search results in php error

    - by fusion
    i'm trying to figure out what is wrong in this code. it either doesn't highlight the search result OR it outputs html tags surrounding the highlighted text. . $search_result = ""; $search_result = trim($search_result); $special_cases = array( '%', '_', '+' ); $search_result = str_replace( $special_cases, '', $_GET["q"] ); //Check if the string is empty if ($search_result == "") { echo "<p>Search Error</p><p>Please enter a search...</p>" ; exit(); } $result = mysql_query('SELECT cQuotes, vAuthor, cArabic, vReference FROM thquotes WHERE cQuotes LIKE "%' . mysql_real_escape_string($search_result) .'%" ORDER BY idQuotes DESC', $conn) or die ('Error: '.mysql_error()); //eliminating special characters function h($s) { echo htmlspecialchars($s, ENT_QUOTES); } function highlightWords($string, $word) { $string = str_replace($word, "<span style='background-color: #FFE066;font-weight:bold;'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } ?> <div class="caption">Search Results</div> <div class="center_div"> <table> <?php while ($row= mysql_fetch_array($result, MYSQL_ASSOC)) { $cQuote = highlightWords($row['cQuotes'], $search_result); ?> <tr> <td style="text-align:right; font-size:15px;"><?php h($row['cArabic']); ?></td> <td style="font-size:16px;"><?php h($cQuote); ?></td> <td style="font-size:12px;"><?php h($row['vAuthor']); ?></td> <td style="font-size:12px; font-style:italic; text-align:right;"><?php h($row['vReference']); ?></td> </tr> <?php } ?> </table> </div> on the browser, it is outputted as: A good <span style='background-color: #FFE066;font-weight:bold;'>action</span> is an ever-remaining store and a pure yield or if a div is used with class: A good <div class='highlight'>action</div> is an ever-remaining store and a pure yield

    Read the article

  • Is a Multi-DAL Approach the way to go here?

    - by Krisc
    Working on the data access / model layer in this little MVC2 project and trying to think things out to future projects. I have a database with some basic tables and I have classes in the model layer that represent them. I obviously need something to connect the two. The easiest is to provide some sort of 'provider' that can run operations on the database and return objects. But this is for a website that would potentially be used "a lot" (I know, very general) so I want to cache results from the data layer and keep the cache updated as new data is generated. This question deals with how best to approach this problem of dual DALS. One that returns cached data when possible and goes to the data layer when there is a cache miss. But more importantly, how to integrate the core provider (thing that goes into database) with the caching layer so that it too can rely on cached objects rather than creating new ones. Right now I have the following interfaces: IDataProvider is used to reach the database. It doesn't concern itself with the meaning of the objects it produces, but simply the way to produce them. interface IDataProvider{ // Select, Update, Create, et cetera access IEnumerable<Entry> GetEntries(); Entry GetEntryById(int id); } IDataManager is a layer that sits on top of the IDataProvider layer and manages the cache interface IDataManager : IDataProvider{ void ClearCache(); } Note that in practice the IDataManager implementation will have useful helper functions to add objects to their related cache stores. (In the future I may define other functions on the interface) I guess what I am looking for is the best way to approach a loop back from the IDataProvider implementations so that they can access the cache. Or a different approach entirely may be in order? I am not very interested in 3rd party products at the moment as I am interested in the design of these things much more than this specific implementation. Edit: I realize the title may be a bit misleading. I apologize for that... not sure what to call this question.

    Read the article

  • building list of child objects inside main object

    - by Asdfg
    I have two tables like this: Category: Id Name ------------------ 1 Cat1 2 Cat2 Feature: Id Name CategoryId -------------------------------- 1 F1 1 2 F2 1 3 F3 2 4 F4 2 5 F5 2 In my .Net classes, i have two POCO classes like this: public class Category { public int Id {get;set;} public int Name {get;set;} public IList<Feature> Features {get;set;} } public class Feature { public int Id {get;set;} public int CategoryId {get;set;} public int Name {get;set;} } I am using a stored proc that returns me a result set by joining these 2 tables. This is how my Stored Proc returns the result set. SELECT c.CategoryId, c.Name Category, f.FeatureId, f.Name Feature FROM Category c INNER JOIN Feature f ON c.CategoryId = f.CategoryId ORDER BY c.Name --Resultset produced by the above query CategoryId CategoryName FeatureId FeatureName --------------------------------------------------- 1 Cat1 1 F1 1 Cat1 2 F2 2 Cat2 3 F3 2 Cat2 4 F4 2 Cat2 5 F5 Now if i want to build the list of categories in my .Net code, i have to loop thru the result set and add features unless the category changes. This is how my .Net code looks like that builds Categories and Features. List<Category> categories = new List<Category>(); Int32 lastCategoryId = 0; Category c = new Category(); using (SqlDataReader reader = cmd.ExecuteReader()) { while (reader.Read()) { //Check if the categoryid is same as previous one. //If Not, add new category. //If Yes, dont add the category. if (lastCategoryId != Convert.ToInt32(reader["CategoryId"])) { c = new Category { Id = Convert.ToInt32(reader["CategoryId"]), Name = reader["CategoryName"].ToString() }; c.Features = new List<Feature>(); categories.Add(c); } lastCategoryId = Convert.ToInt32(reader["CategoryId"]); //Add Feature c.Features.Add(new Feature { Name = reader["FeatureName"].ToString(), Id = Convert.ToInt32(reader["FeatureId"]) }); } return categories; } I was wondering if there is a better way to do build the list of Categories?

    Read the article

  • Displaying an Image in an activity using URI

    - by evkwan
    Hi, I'm writing an application that uses Intent(MediaStore.ACTION_IMAGE_CAPTURE) to capture and image. On the process of capturing the image, I noted the output of the image's URI. Right after finishing the camera activity, I wish to display the image using this specific URI. The method I used to capture images is: private void saveFullImage() { Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); File file = new File(Environment.getExternalStorageDirectory(), "test.jpg"); outputFileUri = Uri.fromFile(file); intent.putExtra(MediaStore.EXTRA_OUTPUT, outputFileUri); startActivityForResult(intent, TAKE_PICTURE); } Which is a method taken from Reto Meier's book Professional Android 2 Application Development. The method works fine, and I assume that the URI of the picture I just took is stored in the outputFileUri variable. Then at this point of the code is where I want to display the picture: @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { if (requestCode == TAKE_PICTURE) { //I want to display the picture I just took here //using the URI } } I'm not sure how to do it. I tried creating a new layout object and a new ImageView object using the method setImageURI(outputFileUri). My main layout (xml) did not have a ImageView object. But even when I set the contentView to the new layout with the ImageView attached to it, it doesn't display anything. I tried creating a Bitmap object from the URI and set it to the ImageView, but I get an unexpected error and forced exit. I have seen examples from here here which creates a Bitmap from URI, but it's not displaying it? My question is just how to display an image in the middle of a running activity? Do I need to get the File Path (like this) in order to display it? If I make a Bitmap out of the URI, how do I display the Bitmap? I'm just probably missing something simple...so any help would be a greatly appreciated! Also additional question for thought: If I were to take multiple pictures, would you recommend me to use the SimpleCursorAdapter instead? Thanks!

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • C++ string sort like a human being?

    - by Walter Nissen
    I would like to sort alphanumeric strings the way a human being would sort them. I.e., "A2" comes before "A10", and "a" certainly comes before "Z"! Is there any way to do with without writing a mini-parser? Ideally it would also put "A1B1" before "A1B10". I see the question "Natural (human alpha-numeric) sort in Microsoft SQL 2005" with a possible answer, but it uses various library functions, as does "Sorting Strings for Humans with IComparer". Below is a test case that currently fails: #include <set> #include <iterator> #include <iostream> #include <vector> #include <cassert> template <typename T> struct LexicographicSort { inline bool operator() (const T& lhs, const T& rhs) const{ std::ostringstream s1,s2; s1 << toLower(lhs); s2 << toLower(rhs); bool less = s1.str() < s2.str(); std::cout<<s1.str()<<" "<<s2.str()<<" "<<less<<"\n"; return less; } inline std::string toLower(const std::string& str) const { std::string newString(""); for (std::string::const_iterator charIt = str.begin(); charIt!=str.end();++charIt) { newString.push_back(std::tolower(*charIt)); } return newString; } }; int main(void) { const std::string reference[5] = {"ab","B","c1","c2","c10"}; std::vector<std::string> referenceStrings(&(reference[0]), &(reference[5])); //Insert in reverse order so we know they get sorted std::set<std::string,LexicographicSort<std::string> > strings(referenceStrings.rbegin(), referenceStrings.rend()); std::cout<<"Items:\n"; std::copy(strings.begin(), strings.end(), std::ostream_iterator<std::string>(std::cout, "\n")); std::vector<std::string> sortedStrings(strings.begin(), strings.end()); assert(sortedStrings == referenceStrings); }

    Read the article

  • Blit Queue Optimization Algorithm

    - by martona
    I'm looking to implement a module that manages a blit queue. There's a single surface, and portions of this surface (bounded by rectangles) are copied to elsewhere within the surface: add_blt(rect src, point dst); There can be any number of operations posted, in order, to the queue. Eventually the user of the queue will stop posting blits, and ask for an optimal set of operations to actually perform on the surface. The task of the module is to ensure that no pixel is copied unnecessarily. This gets tricky because of overlaps of course. A blit could re-blit a previously copied pixel. Ideally blit operations would be subdivided in the optimization phase in such a way that every block goes to its final place with a single operation. It's tricky but not impossible to put this together. I'm just trying to not reinvent the wheel. I looked around on the 'net, and the only thing I found was the SDL_BlitPool Library which assumes that the source surface differs from the destination. It also does a lot of grunt work, seemingly unnecessarily: regions and similar building blocks are a given. I'm looking for something higher-level. Of course, I'm not going to look a gift horse in the mouth, and I also don't mind doing actual work... If someone can come forward with a basic idea that makes this problem seem less complex than it does right now, that'd be awesome too. EDIT: Thinking about aaronasterling's answer... could this work? Implement customized region handler code that can maintain metadata for every rectangle it contains. When the region handler splits up a rectangle, it will automatically associate the metadata of this rectangle with the resulting sub-rectangles. When the optimization run starts, create an empty region handled by the above customized code, call this the master region Iterate through the blt queue, and for every entry: Let srcrect be the source rectangle for the blt beng examined Get the intersection of srcrect and master region into temp region Remove temp region from master region, so master region no longer covers temp region Promote srcrect to a region (srcrgn) and subtract temp region from it Offset temp region and srcrgn with the vector of the current blt: their union will cover the destination area of the current blt Add to master region all rects in temp region, retaining the original source metadata (step one of adding the current blt to the master region) Add to master region all rects in srcrgn, adding the source information for the current blt (step two of adding the current blt to the master region) Optimize master region by checking if adjacent sub-rectangles that are merge candidates have the same metadata. Two sub-rectangles are merge candidates if (r1.x1 == r2.x1 && r1.x2 == r2.x2) | (r1.y1 == r2.y1 && r1.y2 == r2.y2). If yes, combine them. Enumerate master region's sub-rectangles. Every rectangle returned is an optimized blt operation destination. The associated metadata is the blt operation`s source.

    Read the article

  • OpenGL, how to set a monocrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :) Thank's

    Read the article

  • Get data from aspx.cs page to aspx page.

    - by Brad8118
    So I am using a jquery plug in that allows me to change the order of things in a list by dragging and dropping them. So my goal is to be able to grab a list of my objects (AlertInfo) and using it in a javascript function. I was able to use a json webservice call in a test project to pass the data to the page. But we don't have a webservice page now so I tried to grab it from a aspx.cs page and it hasn't worked. ///Aspx page: $.ajax({ type: "POST", url: "~/Alerts/GetAlerts", data: "{}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (msg) { var data = eval("(" + msg.d + ")"); jQuery.each(data, function (rec) { AlertList[AlertList.length] = new objAlert(this.id, this.title, this.details, JSONDateSerializationFix(this.startdate), JSONDateSerializationFix(this.enddate)); UpdateDisplayList(); }) }, error: function (msg) { alert("BRAD" + msg); } The issue is that the Alerts page in "URL /Alerts/GetAlerts" is Alerts.aspx.cs. I can't figure out if I can use this ajax command to call a method in a aspx.cs page. //Code behind page aspx.cs [WebMethod] //[ScriptMethod(ResponseFormat = ResponseFormat.Json)] public string GetAlerts() { List list = AlertInfo.GetTestAlerts(); return new JavaScriptSerializer().Serialize(list); } public List GetAlertsList() { List list = AlertInfo.GetTestAlerts(); return list; ; } So I was hoping that I could load data into an asp control (dataList) and then grab the data //code behind page protected void Page_Load(object sender, EventArgs e) { dataListAlertList.DataSource = GetAlertsList(); dataListAlertList.DataBind(); } public static List<AlertInfo> GetTestAlerts() { List<AlertInfo> list = new List<AlertInfo>(); list.Add(new AlertInfo("0", "Alert 1 Title", "Alert 1 Detail", "10/10/2010", "10/10/2011")); list.Add(new AlertInfo("1", "Alert 2 Title", "Alert 2 Detail", "10/10/2010", "10/10/2011")); return list; } //.aspx page $(document).ready(function () { var a1 = $("#dataListAlertList").val(); // do fun stuff now. } But I keep getting undefined....

    Read the article

< Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >