Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 698/965 | < Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >

  • Calling inheriting class methods via interface.

    - by Stacey
    Given the scenario... interface IBase{ void Process(int value); } abstract class Base : IBase { public virtual void Process(int value){ throw new NotImplementedException(); } } class Implemented: Base, IBase { public void Process(int value) { // .. some code here.. } } I'm trying to write a loop similar to the following. foreach( Base b in CollectionOfImplemented ) { b.Process( // something will go here // ); } Trying this, it keeps calling Base.Process, instead of Implemented.Process; but the type in the collection is Implemented, not Base. Boxing it seems to work, but I was hoping to see if I could find a more intelligent approach to it, since the Collection will contain other types of objects that also inherit from Base.

    Read the article

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • "IOError [Errno 13] Permisson denied" when copy a file on Windows

    - by wong2
    Hi, I wrote a program that will copy a file called a.exe to C:/Windows/, then I pack it to exe with PyInstaller, and rename the exe file to a.exe. When I run the exe file, it output IOError [Errno 13] Permisson denied: 'C:/Windows/a.exe', but the file a.exe was copied to the directory C:/Windows. Then I ran it as the Administrator, it happened again... At first, I copy the file with shututil.copy, then I wrote a function myself(open a.exe, create a.exe under C:/Windows, read a.exe 's content and write to C:/Windows/a.exe, close all), but it doesn't help...Any ideas?

    Read the article

  • How to schedule hundreds of thousands of tasks?

    - by wehriam
    We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

    Read the article

  • what is regular expression not generated over {a,b}?

    - by Loop
    Hello all, I am really stuck with these 2 question for over 2 days now. trying to figure out what the question means.... my tutor is out of town too.... write a regular expression for the only strings that are not generated over {a,b} by the expression: (a+b)*a(a+b)*. explain your reasoning. and i tried the second question, do you think is there any better answer than this one? what is regular expression of set of string that contain an odd number of a's or exactly two b's................(a((a|b)(a|b))*|bb).... coz i know to represent any odd length of a's, the RE is a((a|b)(a|b))*

    Read the article

  • (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

    - by Pyronaut
    I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

    Read the article

  • Java exception translations

    - by user3079275
    Apologies if this has been discussed on other threads but I find it helps clarify my thinking when I am forced to write down my questions. I am trying to properly understand the concept of checked vs unchecked exceptions and exception translation in Java but I am getting confused. So far I understood that checked exceptions are exceptions that need to be always caught in a try/catch block otherwise I get a compile time error. This is to force programmers to think about abnormal situations that might happen at run time (like disk full etc). Is this right? What I did not get was why we have unchecked exceptions, when are they useful? Is it only during development time to debug code that might access an illegal array index etc? This confusion is because I see that Error exceptions are also unchecked as is RunTimeException but its not clear to me why they are both lumped together into an unchecked category?

    Read the article

  • How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

    - by EugeneP
    How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

    Read the article

  • A simple log file format

    - by hgulyan
    Hi, I'm not sure if it was asked, but I couldn't find anything like this. My program uses a simple .txt file for log purposes, It just creates/opens a file and appends lines. After some time, I started to log quite a lot of activities, so the file became too large and hardly readable. I know, that it's not write way to do this, but I simply need to have a readable file. So I thought maybe there's a simple file format for log files and a soft to view it or if you'd have any other suggestions on this question? Thanks for help in advance.

    Read the article

  • In Django, using __init__() method of non-abstract parent model to record class name of child model

    - by k-g-f
    In my Django project, I have a non-abstract parent model defined as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) and, say, two children models defined as follows: class ChildA(Parent): parent = models.OneToOneField(Parent,parent_link=True) class ChildB(Parent): parent = models.OneToOneField(Parent,parent_link=True) Each time I create an instance of ChildA or of ChildB, I'd like the classType attribute to be set to the strings "ChildA" or "ChildB" respectively. What I have done is added an _ _ init_ _() method to Parent as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) def __init__(self,*args,**kwargs): super(Parent,self).__init__(*args,**kwargs) self.classType = self.__class__.__name__ Is there a better way to implement and achieve my desired result? One downside of this implementation is that when I have an instance of the Parent, say "parent", and I want to get the type of the child object linked with "parent", calling "parent.classType" gives me "Parent". In order to get the appropriate "ChildA" or "ChildB" value, I need to write a "_getClassType()" method to wrap a custom sql query.

    Read the article

  • between syntax, are there any equal function

    - by gcc
    /* char **mainp=malloc(sizeof(char *)*2); mainp[0]=malloc(sizeof(char)*300); mainp[1]=malloc(sizeof(char )*300); */ *I have some input about propositional calculus *After calculating some math funtion-removing paranthesis-changing"&" with ","-replacing "|" with"," I have >> (1) P,-Q,Q,-R is stored in mainp[0] R,A,P,B,F is stored in mainp[1] *My question is: Between comma , I have want to compare two pointer array. If there is any equal two or more functions(Q,-R is function representation) ,function which you will show me how to write must return int. According to example (1),function will return 1 (I expect like that) /*I have som thought://which function should I have use:*/ in for loop if( strspn(mainp[0][i])==1 ) increment d; continue; or in for loop srtcmp(mainp[0][i],mainp[1]);

    Read the article

  • How to scramble string C#?

    - by a_Elnajjar
    I write the code to scramble word I am create simple game jumble string jumble = theWord; int length = jumble.Count(); for (int i = 0; i < length; ++i) { int index1 = (rand.Next() % length); int index2 = (rand.Next() % length); char temp =jumble[index1]; jumble = jumble.Replace(jumble[index1], jumble[index2]); jumble = jumble.Replace(jumble[index1], temp); }

    Read the article

  • ByteArrayOutputStream to PrintWriter (Java Servlet)

    - by Thomas
    Writing generated PDF (ByteArrayOutputStream) in a Servlet to PrintWriter. I am desperately looking for a way to write a generated PDF file to the response PrintWriter. Since a Filter up the hierarchy chain has already called response.getWriter() I can't get response.getOutputStream(). I do have a ByteArrayOutputStream where I generated the PDF into. Now all I need is a way to output the content of this ByteArrayOutputStream to the PrintWriter. If anyone could give me a helping hand would be very much appreciated!

    Read the article

  • INSERT INTO othertbl SELECT * tbl

    - by Harry
    Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

    Read the article

  • Constructor initialising an array of subobjects?

    - by ojw
    Say I have several objects within a class, each of which needs constructing with a different value. I can write something like this: class b { public: b(int num) { // 1 for a.b1, and 2 for a.b2 } }; class a { public: b b1; b b2; a() : b1(1), b2(2) { } }; However, is it possible to do the same thing if those multiple objects are stored in an array? My first attempt at it doesn't compile: class a { public: b bb[2]; a() : bb[0](1), bb[1](2) { } };

    Read the article

  • What is this C function supposed to do based on description?

    - by user1261445
    unsigned int hex_c0c0c0c0(): Allowed operators: + - = & | ~ << ! >> Allowed constants: 1 2 4 8 16 Return 0xc0c0c0c0 The above is the description I have been given and I have to write the code for it. Can someone tell me what exactly the function is supposed to do? All the description says is what I have pasted above, so I'm not sure what my goal is. I'm sure it is an easy enough function to program on my own, but it would help if someone could tell me what the function is supposed to do, and maybe provide sample input/output so that I know my code is working correctly once I program this. Thanks.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Finding employees specific to department in SQL SERVER 2000(SET BASED)

    - by xyz
    Suppose I have a table (tblEmp) whose structure is like as under Dept Emp d1 e1 d1 e2 d1 e3 d2 e4 d2 e5 d3 e6 If I need to bring the output as Dept DepartmentSpecificEmployees d1 e1,e2,e3 d2 e4,e5 d3 e6 I will write the query as select Dept, stuff((select Emp + ',' from tblEmp t2 where t1.Dept = t2.Dept for xml path(''),1,1,'')DepartmentSpecificEmployees from tblEmp t1 group by Dept But this will work in Sql Server 2005+. How can I achieve the same in Sql Server 2000 without any variable declaration or loop or cursor? If I use COALESCE as an alternative, then I need to use a variable which will defeat the purpose Please help

    Read the article

  • How do you pass objects between View Controllers in Objective-C?

    - by editor
    I've been trudging through some code for two days trying to figure out why I couldn't fetch a global NSMutableArray variable I declared in the .h and implemented in .m and set in a the viewDidLoad function. It finally dawned on me: there's no such thing as a global variable in Objective-C, at least not in the PHP sense I've come to know. I didn't ever really read the XCode error warnings, but there it was, even if not quite plain English: "Instance variable 'blah' accessed in class method." My question: What am I supposed to do now? I've got two View Controllers that need to access a central NSMutableDictionary I generate from a JSON file via URL. It's basically an extended menu for all my Table View drill downs, and I'd like to have couple other "global" (non-static) variables. Do I have to grab the JSON each time I want to generate this NSMutableDictionary or is there some way to set it once and access it from various classes via #import? Do I have to write data to a file, or is there another way people usually do this?

    Read the article

  • Running Test framework as part of application

    - by VP
    Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

    Read the article

  • list within a list

    - by atm atm
    I'm working on this problem, but I cannot figure out the second part. I tried using reverse list but it did not work out how I planned it. Given a list L (e.g. [1,2,3,4]), write a program that generates the following nested lists: L1 = [[1],[1,2],[1,2,3],[1,2,3,4]], L2 = [[4],[3,4],[2,3,4],[1,2,3,4]]. My code that I have so far: mylist=[,1,2,3,4] print("Orginal list L=",mylist) n=len(mylist) l1=[] l2=[] for x in range(1,n+1,1): l1.append(mylist[0:x]) print("L1=",l1) #prints final product of l1 mylist.reverse() #this is where i get messed up for x in range(1,n+1,1): l2.append(mylist[0:x]) print("L2=",l2)

    Read the article

  • How to check an exectuable's path is correct in PHP?

    - by nickf
    I'm writing a setup/installer script for my application, basically just a nice front end to the configuration file. One of the configuration variables is the executable path for mysql. After the user has typed it in (for example: /path/to/mysql-5.0/bin/mysql or just mysql if it is in their system PATH), I want to verify that it is correct. My initial reaction would be to try running it with "--version" to see what comes back. However, I quickly realised this would lead to me writing this line of code: shell_exec($somethingAUserHasEntered . " --version"); ...which is obviously a Very Bad Thing. Now, this is a setup script which is designed for trusted users only, and ones which probably already have relatively high level access to the system, but still I don't think the above solution is something I want to write. Is there a better way to verify the executable path? Perhaps one which doesn't expose a massive security hole?

    Read the article

  • how to compress a PNG image using Java

    - by 116213060698242344024
    Hi I would like to know if there is any way in Java to reduce the size of an image (use any kind of compression) that was loaded as a BufferedImage and is going to be saved as an PNG. Maybe some sort of png imagewriteparam? I didnt find anything helpful so im stuck. heres a sample how the image is loaded and saved public static BufferedImage load(String imageUrl) { Image image = new ImageIcon(imageUrl).getImage(); bufferedImage = new BufferedImage(image.getWidth(null), image.getHeight(null), BufferedImage.TYPE_INT_ARGB); Graphics2D g2D = bufferedImage.createGraphics(); g2D.drawImage(image, 0, 0, null); return bufferedImage; } public static void storeImageAsPng(BufferedImage image, String imageUrl) throws IOException { ImageIO.write(image, "png", new File(imageUrl)); }

    Read the article

  • How come the [L] flag isn't working in my .htaccess file?

    - by George Edison
    Here are the rules: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^$ index.php?action=home [L] RewriteRule ^[\w\W]*$ error.php [L] When a page matches the first one, it is supposed to ignore any other further rules. Yet accessing / results in error.php being invoked. Commenting out the second rule works as intended - the page redirects to index.php. What am I doing wrong? Also: is there a better way to write the last line? It's basically a catch-all.

    Read the article

  • Help with implementing a function to change size of dynamic array

    - by iRobot
    I'm trying to write a function that will change the size of a dynamic array to a new size. In my header file, I have: Image **images; //pointer to a dynamic array of image pointers int maximum; //size I want to do this by allocating a new array and copying the values over without changing their indices. If there are non-null pointers outside the range newmax, then we cant do this. So heres what I have: There are no compilation or runtime errors. However, I find that the new array isnt getting sized right. When I run the following test case: I should get an index out of bounds error, but instead the system lets it slide. Can anyone see the mistake? I've looked for hours but cant find anything.

    Read the article

< Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >