Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 698/965 | < Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >

  • Executing a file not a project

    - by RPK
    I use Aptana Studio for my PHP projects. I have not learned it but just used with what I was able to do in it. Many features I still don't know how to use in it. At present, I have a HTML form and I want to write a .php script for the SEND button that it has. It is a submission script for the contact form. I want a simple PHP IDE with which I can execute a single PHP file or work with at least two or three files easily, without much mess. Please suggest a simple alternative to Aptana.

    Read the article

  • Access DB with SQL Server Front End

    - by uyuni99
    I have an old Access application that has a lot of code in forms and reports. The database is getting too large and I am thinking of moving the back end to SQL Server. My requirements are as follows: The DB needs to be multiuser and the users (3-5) will need to log in over the web I would prefer not to re-write the forms and reports in ASP or some other web front end. When I think about my choices, I see them as: Have an Access ADP front end and allows remote log-in to the server where it is stored. Not sure if it is possible for 2 users to simultaneously log in Distribute an ADP front end to the users, but I am not sure if it is possible to connect to a SQL Server back end over the internet, and the network traffic may be an issue. Any other solution? I appreciate all help. u

    Read the article

  • Help with implementing a function to change size of dynamic array

    - by iRobot
    I'm trying to write a function that will change the size of a dynamic array to a new size. In my header file, I have: Image **images; //pointer to a dynamic array of image pointers int maximum; //size I want to do this by allocating a new array and copying the values over without changing their indices. If there are non-null pointers outside the range newmax, then we cant do this. So heres what I have: There are no compilation or runtime errors. However, I find that the new array isnt getting sized right. When I run the following test case: I should get an index out of bounds error, but instead the system lets it slide. Can anyone see the mistake? I've looked for hours but cant find anything.

    Read the article

  • Reference to fnc.

    - by atch
    Hi guys, Is there a way in java to do something like this: void fnc(void Reference_to_other_func()); What I'm trying is basically I have number of places where I need to display this same text to the user and the only difference is which method is invoked after this text. So for example instead of writing: System.out.println("Hello"); f1(); //in some other place System.out.println("Hello"); f2(); //etc I would like to define one function: public void f(void Reference_to_other_func()) { System.out.println("Hello"); Reference_to_other_func();//HERE I'M INVOKING } and then instead of repeating this whole code I could write something like this: f(f1); //in some other place f(f2) //etc. Thanks for answers

    Read the article

  • how to generate uncorrelated random numbers in repeated calls in parallel?

    - by user1446948
    I want to write a function which will be repeatedly called by other functions many times. Inside this function it is supposed to generate a lot of random numbers and this part will be treated in parallel. If only for one run, the seed can be chosen differently for each thread, so that the random numbers will be uncorrelated. However, if this function will be called the 2nd time, it seems that the random numbers will repeat unless the seed will be again changed during the later calls. So my question is, is there a good way to generate the random numbers or reset the seed so that the random numbers generated by repeated calls to this function and also by different threads are really random? Thank you.

    Read the article

  • AS3 Random repeat x seconds function

    - by Lilk
    Hi, I have the following function: function update(e:Event):void { var val:Number = Math.random() * 120; rgb.r.x = rgb.r.y = val; rgb.b.x = rgb.b.y = -val; } And im looping it with: stage.addEventListener(Event.ENTER_FRAME, update); But what I need to do would be something like: Random number between 1 and 20 If the number is > 10 Call function Update and keep caling it for 20 seconds else do nothing for 10 seconds Repeat this block of code forever Can someone help me write this please?

    Read the article

  • In Ruby, how do I make a hash from an array?

    - by Wizzlewott
    I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

    Read the article

  • Running Test framework as part of application

    - by VP
    Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

    Read the article

  • PotgreSQL 2D array to rows

    - by PostGreSQL newbie
    Hello, I am new to PostgreSQL array's. I am trying to a write a procedure to convert array-into-rows, and wanted following output: alphabet | number ---------+---------- A | 10 B | 10 C | 6 D | 9 E | 3 from following: id | alphabet_series -------+-------------------------------------------------------------------------------------------------- 1 | {{A,10},{B,10},{C,6},{D,9},{E,3},{F,9},{I,10},{J,17},{K,16},{L,17},{M,20},{N,13},{O,19}} I have searched for array-to-rows functions, but they all seems to accept 1-d array. but in this case, it is 2-d array. Any pointers will be appreciated. Many thanks.

    Read the article

  • Problem with an application in USB

    - by rajivpradeep
    I have an application on a pen drive, which executes some flash files on the same USB flash drive. when i run the application with in the drive, the application just keeps running in the back ground without running the flash files. When i copy the application on desktop, it runs the flash files in the USB. Also i programmed the app to write log file, when i run the application with in USB, the app is running but the log file is not getting written, when i remove the pen drive, the file gets written. What might be the problem, I am using VC++ , VS 2008 to build the application.

    Read the article

  • Windows 8 Set User Account Image

    - by Nexion
    I'm trying to write a small CONSOLE (not metro style) app to quickly change the user account image of the current user to a select image for a setup scrip that I'm running on a bunch of laptops. They're all Windows 8 and (since it hasn't been out terribly long) I can't find a ton of info on it. I did manage to figure out that you need to use the Windows.System.UserProfile object to do so, but I can't find any documentation on how to do so in a console app. Thoughts? Suggestions?

    Read the article

  • Writing at the end of file

    - by user342534
    Hi, I'm working on a system that requires high file I/O performance (with C#). Basically, I'm filling up large files (~100MB) from the start of the file until the end of the file. Every ~5 seconds I'm adding ~5MB to the file (sequentially from the start of the file), on every bulk I'm flushing the stream. Every few minutes I need to update a structure which I write at the end of the file (some kind of metadata). When flushing each one of the bulks I have no performance issue. However, when updating the metadata at the end of the file I get really low performance. My guess is that when creating the file (which also should be done extra fast), the file doesn't really allocates the entire 100MB on the disk and when I flush the metadata it must allocates all space until the end of file. Guys/Girls, any Idea how I can overcome this problem? Thanks a lot!

    Read the article

  • c# getting value from other form

    - by djuzla123
    Situation i have: textbox(to input your name) on form1. From that form1 on button click i go to form2. From form2 button click to form3. On form3 on button click i need to writte me in empty textbox value from textbox on form1 that user wrote down. example: on form1 in textbox1 i write my name "Djuzla". When i go to form3 and click button to see what name i wrote in form1 it should show in empty textbox3 form3 "Djuzla". I'm stuck with this few hours now, and it stupid problem but i have no idea what to do next.. tried all from zillion theards on net :p

    Read the article

  • In Django, using __init__() method of non-abstract parent model to record class name of child model

    - by k-g-f
    In my Django project, I have a non-abstract parent model defined as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) and, say, two children models defined as follows: class ChildA(Parent): parent = models.OneToOneField(Parent,parent_link=True) class ChildB(Parent): parent = models.OneToOneField(Parent,parent_link=True) Each time I create an instance of ChildA or of ChildB, I'd like the classType attribute to be set to the strings "ChildA" or "ChildB" respectively. What I have done is added an _ _ init_ _() method to Parent as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) def __init__(self,*args,**kwargs): super(Parent,self).__init__(*args,**kwargs) self.classType = self.__class__.__name__ Is there a better way to implement and achieve my desired result? One downside of this implementation is that when I have an instance of the Parent, say "parent", and I want to get the type of the child object linked with "parent", calling "parent.classType" gives me "Parent". In order to get the appropriate "ChildA" or "ChildB" value, I need to write a "_getClassType()" method to wrap a custom sql query.

    Read the article

  • How to schedule hundreds of thousands of tasks?

    - by wehriam
    We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

    Read the article

  • INSERT INTO othertbl SELECT * tbl

    - by Harry
    Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

    Read the article

  • between syntax, are there any equal function

    - by gcc
    /* char **mainp=malloc(sizeof(char *)*2); mainp[0]=malloc(sizeof(char)*300); mainp[1]=malloc(sizeof(char )*300); */ *I have some input about propositional calculus *After calculating some math funtion-removing paranthesis-changing"&" with ","-replacing "|" with"," I have >> (1) P,-Q,Q,-R is stored in mainp[0] R,A,P,B,F is stored in mainp[1] *My question is: Between comma , I have want to compare two pointer array. If there is any equal two or more functions(Q,-R is function representation) ,function which you will show me how to write must return int. According to example (1),function will return 1 (I expect like that) /*I have som thought://which function should I have use:*/ in for loop if( strspn(mainp[0][i])==1 ) increment d; continue; or in for loop srtcmp(mainp[0][i],mainp[1]);

    Read the article

  • ByteArrayOutputStream to PrintWriter (Java Servlet)

    - by Thomas
    Writing generated PDF (ByteArrayOutputStream) in a Servlet to PrintWriter. I am desperately looking for a way to write a generated PDF file to the response PrintWriter. Since a Filter up the hierarchy chain has already called response.getWriter() I can't get response.getOutputStream(). I do have a ByteArrayOutputStream where I generated the PDF into. Now all I need is a way to output the content of this ByteArrayOutputStream to the PrintWriter. If anyone could give me a helping hand would be very much appreciated!

    Read the article

  • Why does the compiler complain "while expected" when I try to add more code?

    - by user1893578
    Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

    Read the article

  • Calling inheriting class methods via interface.

    - by Stacey
    Given the scenario... interface IBase{ void Process(int value); } abstract class Base : IBase { public virtual void Process(int value){ throw new NotImplementedException(); } } class Implemented: Base, IBase { public void Process(int value) { // .. some code here.. } } I'm trying to write a loop similar to the following. foreach( Base b in CollectionOfImplemented ) { b.Process( // something will go here // ); } Trying this, it keeps calling Base.Process, instead of Implemented.Process; but the type in the collection is Implemented, not Base. Boxing it seems to work, but I was hoping to see if I could find a more intelligent approach to it, since the Collection will contain other types of objects that also inherit from Base.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • how to compress a PNG image using Java

    - by 116213060698242344024
    Hi I would like to know if there is any way in Java to reduce the size of an image (use any kind of compression) that was loaded as a BufferedImage and is going to be saved as an PNG. Maybe some sort of png imagewriteparam? I didnt find anything helpful so im stuck. heres a sample how the image is loaded and saved public static BufferedImage load(String imageUrl) { Image image = new ImageIcon(imageUrl).getImage(); bufferedImage = new BufferedImage(image.getWidth(null), image.getHeight(null), BufferedImage.TYPE_INT_ARGB); Graphics2D g2D = bufferedImage.createGraphics(); g2D.drawImage(image, 0, 0, null); return bufferedImage; } public static void storeImageAsPng(BufferedImage image, String imageUrl) throws IOException { ImageIO.write(image, "png", new File(imageUrl)); }

    Read the article

  • How do you pass objects between View Controllers in Objective-C?

    - by editor
    I've been trudging through some code for two days trying to figure out why I couldn't fetch a global NSMutableArray variable I declared in the .h and implemented in .m and set in a the viewDidLoad function. It finally dawned on me: there's no such thing as a global variable in Objective-C, at least not in the PHP sense I've come to know. I didn't ever really read the XCode error warnings, but there it was, even if not quite plain English: "Instance variable 'blah' accessed in class method." My question: What am I supposed to do now? I've got two View Controllers that need to access a central NSMutableDictionary I generate from a JSON file via URL. It's basically an extended menu for all my Table View drill downs, and I'd like to have couple other "global" (non-static) variables. Do I have to grab the JSON each time I want to generate this NSMutableDictionary or is there some way to set it once and access it from various classes via #import? Do I have to write data to a file, or is there another way people usually do this?

    Read the article

  • How can I get my app ready for the iPhone 5

    - by RazorSharp
    Apple just announced the iPhone 5 with a 4 inch screen and a 16:9 aspect ratio. Of course, they only give developers two weeks to scramble to update their apps without being able to test. I'd like to update my app for the iPhone 5's new big screen, but there's nothing on Apple's developer site about the iPhone 5 or making your apps ready for a larger screen. It would be a pain to have to write my own logic for testing whether the device is an iPhone 5 and then displaying a custom storyboard file for it. Does anyone know how the new sizing works or if there are any hidden Xcode for this?

    Read the article

  • "IOError [Errno 13] Permisson denied" when copy a file on Windows

    - by wong2
    Hi, I wrote a program that will copy a file called a.exe to C:/Windows/, then I pack it to exe with PyInstaller, and rename the exe file to a.exe. When I run the exe file, it output IOError [Errno 13] Permisson denied: 'C:/Windows/a.exe', but the file a.exe was copied to the directory C:/Windows. Then I ran it as the Administrator, it happened again... At first, I copy the file with shututil.copy, then I wrote a function myself(open a.exe, create a.exe under C:/Windows, read a.exe 's content and write to C:/Windows/a.exe, close all), but it doesn't help...Any ideas?

    Read the article

< Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >