Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 698/965 | < Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • "IOError [Errno 13] Permisson denied" when copy a file on Windows

    - by wong2
    Hi, I wrote a program that will copy a file called a.exe to C:/Windows/, then I pack it to exe with PyInstaller, and rename the exe file to a.exe. When I run the exe file, it output IOError [Errno 13] Permisson denied: 'C:/Windows/a.exe', but the file a.exe was copied to the directory C:/Windows. Then I ran it as the Administrator, it happened again... At first, I copy the file with shututil.copy, then I wrote a function myself(open a.exe, create a.exe under C:/Windows, read a.exe 's content and write to C:/Windows/a.exe, close all), but it doesn't help...Any ideas?

    Read the article

  • INSERT INTO othertbl SELECT * tbl

    - by Harry
    Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

    Read the article

  • How to schedule hundreds of thousands of tasks?

    - by wehriam
    We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

    Read the article

  • Reference to fnc.

    - by atch
    Hi guys, Is there a way in java to do something like this: void fnc(void Reference_to_other_func()); What I'm trying is basically I have number of places where I need to display this same text to the user and the only difference is which method is invoked after this text. So for example instead of writing: System.out.println("Hello"); f1(); //in some other place System.out.println("Hello"); f2(); //etc I would like to define one function: public void f(void Reference_to_other_func()) { System.out.println("Hello"); Reference_to_other_func();//HERE I'M INVOKING } and then instead of repeating this whole code I could write something like this: f(f1); //in some other place f(f2) //etc. Thanks for answers

    Read the article

  • SQL grouping query question; evaluating a group of rows based on the value of one field.

    - by user324575
    I've got table vendorparts that lists all my parts and their vendor(s). Parts with multiple vendors have multiple records in this table. I'm trying to write a query that only returns the partid, and vendor of parts that do not have a default vendor assigned. Partid Vendor Defaultflag 1 A 1 2 B 0 2 C 0 3 D 0 3 E 0 3 F 1 4 G 0 I would like to return the following: Partid Vendor 2 A 2 B 4 G I'm obviously having issues with partid 3 and getting the query to see it as having a default vendor assigned.

    Read the article

  • Java - Count words in two documents

    - by user552961
    Good Morning - it is school assignment, I am not asking for any source code (if you can provide any pesudo code it would be awesome). Here is the problem :( I have to create a term frequency table. It is not pure TF, I just need to count the words and write down. I know basic steps to do it 1 - extract all terms (I can do it with file reader) 2 - remove repeating terms (I can do it with TreeMap) The output of 2nd step would be Niga, ponga, dinga, bitlo, etc. 3 - Now I have to see if there is any word in current file from above terms or not, if yes then I will count. Now this is my problem, I stucked on step 3 :( I have some idea how to count words with TreeMap (treemap.containskey etc.) but it would be global count not local count for each file :( Any pseudo code?

    Read the article

  • what is regular expression not generated over {a,b}?

    - by Loop
    Hello all, I am really stuck with these 2 question for over 2 days now. trying to figure out what the question means.... my tutor is out of town too.... write a regular expression for the only strings that are not generated over {a,b} by the expression: (a+b)*a(a+b)*. explain your reasoning. and i tried the second question, do you think is there any better answer than this one? what is regular expression of set of string that contain an odd number of a's or exactly two b's................(a((a|b)(a|b))*|bb).... coz i know to represent any odd length of a's, the RE is a((a|b)(a|b))*

    Read the article

  • between syntax, are there any equal function

    - by gcc
    /* char **mainp=malloc(sizeof(char *)*2); mainp[0]=malloc(sizeof(char)*300); mainp[1]=malloc(sizeof(char )*300); */ *I have some input about propositional calculus *After calculating some math funtion-removing paranthesis-changing"&" with ","-replacing "|" with"," I have >> (1) P,-Q,Q,-R is stored in mainp[0] R,A,P,B,F is stored in mainp[1] *My question is: Between comma , I have want to compare two pointer array. If there is any equal two or more functions(Q,-R is function representation) ,function which you will show me how to write must return int. According to example (1),function will return 1 (I expect like that) /*I have som thought://which function should I have use:*/ in for loop if( strspn(mainp[0][i])==1 ) increment d; continue; or in for loop srtcmp(mainp[0][i],mainp[1]);

    Read the article

  • (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

    - by Pyronaut
    I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

    Read the article

  • How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

    - by EugeneP
    How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

    Read the article

  • list within a list

    - by atm atm
    I'm working on this problem, but I cannot figure out the second part. I tried using reverse list but it did not work out how I planned it. Given a list L (e.g. [1,2,3,4]), write a program that generates the following nested lists: L1 = [[1],[1,2],[1,2,3],[1,2,3,4]], L2 = [[4],[3,4],[2,3,4],[1,2,3,4]]. My code that I have so far: mylist=[,1,2,3,4] print("Orginal list L=",mylist) n=len(mylist) l1=[] l2=[] for x in range(1,n+1,1): l1.append(mylist[0:x]) print("L1=",l1) #prints final product of l1 mylist.reverse() #this is where i get messed up for x in range(1,n+1,1): l2.append(mylist[0:x]) print("L2=",l2)

    Read the article

  • ByteArrayOutputStream to PrintWriter (Java Servlet)

    - by Thomas
    Writing generated PDF (ByteArrayOutputStream) in a Servlet to PrintWriter. I am desperately looking for a way to write a generated PDF file to the response PrintWriter. Since a Filter up the hierarchy chain has already called response.getWriter() I can't get response.getOutputStream(). I do have a ByteArrayOutputStream where I generated the PDF into. Now all I need is a way to output the content of this ByteArrayOutputStream to the PrintWriter. If anyone could give me a helping hand would be very much appreciated!

    Read the article

  • A simple log file format

    - by hgulyan
    Hi, I'm not sure if it was asked, but I couldn't find anything like this. My program uses a simple .txt file for log purposes, It just creates/opens a file and appends lines. After some time, I started to log quite a lot of activities, so the file became too large and hardly readable. I know, that it's not write way to do this, but I simply need to have a readable file. So I thought maybe there's a simple file format for log files and a soft to view it or if you'd have any other suggestions on this question? Thanks for help in advance.

    Read the article

  • Why does the compiler complain "while expected" when I try to add more code?

    - by user1893578
    Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

    Read the article

  • How to give friend access to git repository without giving command line access?

    - by Jack Humphries
    I have some git repositories running on my server and I would like to give a friend read/write access to one. That's simple: I add him as a user, give him SSH access, and change the permissions to the repository folder. Everything works fine; I'm able to clone the git repository using Xcode and change things (ssh://www.example.com/repo.git). However, I do not want him to have command line access. If I recall correctly, Github does not give command line access to those who SSH in. I'm using Snow Leopard Server. Is this more of a server issue or a git issue? Do you have any idea where to begin? Setting the user's Login Shell to none (as opposed to /bin/bash) cuts off access to everything.

    Read the article

  • Constructor initialising an array of subobjects?

    - by ojw
    Say I have several objects within a class, each of which needs constructing with a different value. I can write something like this: class b { public: b(int num) { // 1 for a.b1, and 2 for a.b2 } }; class a { public: b b1; b b2; a() : b1(1), b2(2) { } }; However, is it possible to do the same thing if those multiple objects are stored in an array? My first attempt at it doesn't compile: class a { public: b bb[2]; a() : bb[0](1), bb[1](2) { } };

    Read the article

  • What is this C function supposed to do based on description?

    - by user1261445
    unsigned int hex_c0c0c0c0(): Allowed operators: + - = & | ~ << ! >> Allowed constants: 1 2 4 8 16 Return 0xc0c0c0c0 The above is the description I have been given and I have to write the code for it. Can someone tell me what exactly the function is supposed to do? All the description says is what I have pasted above, so I'm not sure what my goal is. I'm sure it is an easy enough function to program on my own, but it would help if someone could tell me what the function is supposed to do, and maybe provide sample input/output so that I know my code is working correctly once I program this. Thanks.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • how to compress a PNG image using Java

    - by 116213060698242344024
    Hi I would like to know if there is any way in Java to reduce the size of an image (use any kind of compression) that was loaded as a BufferedImage and is going to be saved as an PNG. Maybe some sort of png imagewriteparam? I didnt find anything helpful so im stuck. heres a sample how the image is loaded and saved public static BufferedImage load(String imageUrl) { Image image = new ImageIcon(imageUrl).getImage(); bufferedImage = new BufferedImage(image.getWidth(null), image.getHeight(null), BufferedImage.TYPE_INT_ARGB); Graphics2D g2D = bufferedImage.createGraphics(); g2D.drawImage(image, 0, 0, null); return bufferedImage; } public static void storeImageAsPng(BufferedImage image, String imageUrl) throws IOException { ImageIO.write(image, "png", new File(imageUrl)); }

    Read the article

  • In Django, using __init__() method of non-abstract parent model to record class name of child model

    - by k-g-f
    In my Django project, I have a non-abstract parent model defined as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) and, say, two children models defined as follows: class ChildA(Parent): parent = models.OneToOneField(Parent,parent_link=True) class ChildB(Parent): parent = models.OneToOneField(Parent,parent_link=True) Each time I create an instance of ChildA or of ChildB, I'd like the classType attribute to be set to the strings "ChildA" or "ChildB" respectively. What I have done is added an _ _ init_ _() method to Parent as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) def __init__(self,*args,**kwargs): super(Parent,self).__init__(*args,**kwargs) self.classType = self.__class__.__name__ Is there a better way to implement and achieve my desired result? One downside of this implementation is that when I have an instance of the Parent, say "parent", and I want to get the type of the child object linked with "parent", calling "parent.classType" gives me "Parent". In order to get the appropriate "ChildA" or "ChildB" value, I need to write a "_getClassType()" method to wrap a custom sql query.

    Read the article

  • How to scramble string C#?

    - by a_Elnajjar
    I write the code to scramble word I am create simple game jumble string jumble = theWord; int length = jumble.Count(); for (int i = 0; i < length; ++i) { int index1 = (rand.Next() % length); int index2 = (rand.Next() % length); char temp =jumble[index1]; jumble = jumble.Replace(jumble[index1], jumble[index2]); jumble = jumble.Replace(jumble[index1], temp); }

    Read the article

  • How do you pass objects between View Controllers in Objective-C?

    - by editor
    I've been trudging through some code for two days trying to figure out why I couldn't fetch a global NSMutableArray variable I declared in the .h and implemented in .m and set in a the viewDidLoad function. It finally dawned on me: there's no such thing as a global variable in Objective-C, at least not in the PHP sense I've come to know. I didn't ever really read the XCode error warnings, but there it was, even if not quite plain English: "Instance variable 'blah' accessed in class method." My question: What am I supposed to do now? I've got two View Controllers that need to access a central NSMutableDictionary I generate from a JSON file via URL. It's basically an extended menu for all my Table View drill downs, and I'd like to have couple other "global" (non-static) variables. Do I have to grab the JSON each time I want to generate this NSMutableDictionary or is there some way to set it once and access it from various classes via #import? Do I have to write data to a file, or is there another way people usually do this?

    Read the article

  • Advanced Registry Monitoring

    - by RyanTimmons91
    I'm attempting to create a small utility to watch for the creation (or modification) of a specific registry key, and to kill the process responsible for causing that registry modification. I have had success in watching the changes to the registry via a class called 'RegistryMonitor', however it does not give you any information on what process initiated the registry call, through some googling I found that a library called 'EasyHook' should be able to do what I want, but all the documentation states that its designed for a per-application hook. The program itself is a temporary security patch, until our vendors come out with an official security update. As best I can tell there isn't a way to do exactly what I want to accomplish from C#, which is the only language I can comfortable write, test and execute software in. Any help on this would be appreciated I'm considering watching the registry changes via the program I already have, then if the change is discovered (the pc is already infected) running RKill and locking down the PC to prevent the issue from getting any worse

    Read the article

  • cvRetrieveFrame crahses

    - by pooh_bear
    I'm trying to write a simple openCV code that create a capture and retrieves the first frame from it. **CvCapture *m_pCapfile = cvCreateFileCapture(m_aviFileName.c_str()); if (m_pCapfile) m_frames = cvRound(cvGetCaptureProperty(m_pCapfile, CV_CAP_PROP_FRAME_COUNT)); cvSetCaptureProperty(m_pCapfile, CV_CAP_PROP_POS_FRAMES, 0); int ret = cvGrabFrame( m_pCapfile); IplImage *cap = cvRetrieveFrame( m_pCapfile);** In m_frames is have 153, which is the correct number of frames as far as I know. cvGrabFrame returns 1 to ret however cvRetrieveFrame crashes. I tries using cvCaptureFromFile and cvCaptureFromAVI instead of cvCreateFileCapture In both cases cvRetrieveFrame method crashes. Any ideas? Thanks

    Read the article

< Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >