Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 699/965 | < Previous Page | 695 696 697 698 699 700 701 702 703 704 705 706  | Next Page >

  • why are javascript functions like this

    - by Kajal
    I am a starter to javascript. I know to write JS userdefined functions. But recently I came across some thing that I can’t recognize. Can anyone explain to me what this is? (function( window, undefined ) { var jQuery = (function() { }); window.jQuery = window.$ = jQuery; })(window); What is the meaning of this? When I Google javascript functions I am getting only function foo(){ alert("This is an alert"); } I know to use these type of functions

    Read the article

  • ByteArrayOutputStream to PrintWriter (Java Servlet)

    - by Thomas
    Writing generated PDF (ByteArrayOutputStream) in a Servlet to PrintWriter. I am desperately looking for a way to write a generated PDF file to the response PrintWriter. Since a Filter up the hierarchy chain has already called response.getWriter() I can't get response.getOutputStream(). I do have a ByteArrayOutputStream where I generated the PDF into. Now all I need is a way to output the content of this ByteArrayOutputStream to the PrintWriter. If anyone could give me a helping hand would be very much appreciated!

    Read the article

  • How to schedule hundreds of thousands of tasks?

    - by wehriam
    We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

    Read the article

  • Windows 8 Set User Account Image

    - by Nexion
    I'm trying to write a small CONSOLE (not metro style) app to quickly change the user account image of the current user to a select image for a setup scrip that I'm running on a bunch of laptops. They're all Windows 8 and (since it hasn't been out terribly long) I can't find a ton of info on it. I did manage to figure out that you need to use the Windows.System.UserProfile object to do so, but I can't find any documentation on how to do so in a console app. Thoughts? Suggestions?

    Read the article

  • Access DB with SQL Server Front End

    - by uyuni99
    I have an old Access application that has a lot of code in forms and reports. The database is getting too large and I am thinking of moving the back end to SQL Server. My requirements are as follows: The DB needs to be multiuser and the users (3-5) will need to log in over the web I would prefer not to re-write the forms and reports in ASP or some other web front end. When I think about my choices, I see them as: Have an Access ADP front end and allows remote log-in to the server where it is stored. Not sure if it is possible for 2 users to simultaneously log in Distribute an ADP front end to the users, but I am not sure if it is possible to connect to a SQL Server back end over the internet, and the network traffic may be an issue. Any other solution? I appreciate all help. u

    Read the article

  • Algorithm of JavaScript "sort()" Function

    - by Knowledge Craving
    Recently when I was working with JavaScript "sort()" function, I found in one of the tutorials that this function does not sort the numbers properly. Instead to sort numbers, a function must be added that compares numbers, like the following code:- <script type="text/javascript"> function sortNumber(a,b) { return a - b; } var n = ["10", "5", "40", "25", "100", "1"]; document.write(n.sort(sortNumber)); </script> The output then comes as:- 1,5,10,25,40,100 Now what I didn't understand is that why is this occurring & can anybody please tell in details as to what type of algorithm is being used in this "sort()" function? This is because for any other language, I didn't find this problem where the function didn't sort the numbers correctly. Any help is greatly appreciated.

    Read the article

  • how to compress a PNG image using Java

    - by 116213060698242344024
    Hi I would like to know if there is any way in Java to reduce the size of an image (use any kind of compression) that was loaded as a BufferedImage and is going to be saved as an PNG. Maybe some sort of png imagewriteparam? I didnt find anything helpful so im stuck. heres a sample how the image is loaded and saved public static BufferedImage load(String imageUrl) { Image image = new ImageIcon(imageUrl).getImage(); bufferedImage = new BufferedImage(image.getWidth(null), image.getHeight(null), BufferedImage.TYPE_INT_ARGB); Graphics2D g2D = bufferedImage.createGraphics(); g2D.drawImage(image, 0, 0, null); return bufferedImage; } public static void storeImageAsPng(BufferedImage image, String imageUrl) throws IOException { ImageIO.write(image, "png", new File(imageUrl)); }

    Read the article

  • INSERT INTO othertbl SELECT * tbl

    - by Harry
    Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

    Read the article

  • gtk-sharp-2.0 hide/show external applications(processes)

    - by ziuciek
    Hi, maybe the topic isn't quite precise.. i want to write in c# (gtk#-2.0) an app which opens another app hidden and later shows that app. For now i know only how to open hidden app... in windows...: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Diagnostics; namespace do_kasacji { class Program { static void Main(string[] args) { ProcessStartInfo info = new ProcessStartInfo(); info.WindowStyle = ProcessWindowStyle.Minimized; info.FileName = "notepad"; using (Process pr = Process.Start(info)) { pr.WaitForExit(); } } } } Anyone knows how to change it so hat it would run in linux?

    Read the article

  • SQL query to select a range

    - by hansika attanayake
    I need to write an sql query (in c#) to select excel sheet data in "C" column starting from C19. But i cant specify the ending cell number because more data are getting added to the column. Hence i need to know how to specify the end of the column. Please help. I have mentioned the query that im using. I need to know what should be entered at the position of "C73"? OleDbCommand ccmd = new OleDbCommand(@"Select * From [SPAT$C19:C73]", conn);

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How come the [L] flag isn't working in my .htaccess file?

    - by George Edison
    Here are the rules: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^$ index.php?action=home [L] RewriteRule ^[\w\W]*$ error.php [L] When a page matches the first one, it is supposed to ignore any other further rules. Yet accessing / results in error.php being invoked. Commenting out the second rule works as intended - the page redirects to index.php. What am I doing wrong? Also: is there a better way to write the last line? It's basically a catch-all.

    Read the article

  • Rails: saving a string on an object -- syntax problem?

    - by Veep
    Hey there, I am trying to write a simple function to clean a filename string and update the object. When I save a test string it works, but when I try to save the string variable I've created, nothing happens. But when I return the string, the output seems to be correct! What am I missing? def clean_filename clean_name = filename clean_name.gsub! /^.*(\\|\/)/, '' clean_name.gsub! /[^A-Za-z0-9\.\-]/, '_' clean_name.gsub!(/\_+/, ' ') #update_attribute(:filename, "test") #<-- correctly sets filename to test #update_attribute(:filename, clean_name) #<-- no effect????? WTF #return clean_name <-- seems to returns the correct string end Thank you very much.

    Read the article

  • AS3 Random repeat x seconds function

    - by Lilk
    Hi, I have the following function: function update(e:Event):void { var val:Number = Math.random() * 120; rgb.r.x = rgb.r.y = val; rgb.b.x = rgb.b.y = -val; } And im looping it with: stage.addEventListener(Event.ENTER_FRAME, update); But what I need to do would be something like: Random number between 1 and 20 If the number is > 10 Call function Update and keep caling it for 20 seconds else do nothing for 10 seconds Repeat this block of code forever Can someone help me write this please?

    Read the article

  • How to create arrayType for WSDL in Python (using suds)?

    - by Uri
    Environment: Python v2.6.2 suds v0.3.7 The WSDL (server) I work with, have the following schema sub-sections (I tried to write it clearly using plain text) - [ sub-section #1 ] searchRequest: (searchRequest){ userIdentification = (userIdentification){ username = "" password = "" } itineraryArr = (itineraryArray){ _arrayType = "" _offset = "" _id = "" _href = "" _arrayType = "" } ... ... [ sub-section #2 ] itinerary: (itinerary){ departurePoint = (locationPoint){ locationId = None radius = None } arrivalPoint = (locationPoint){ locationId = None radius = None } ... ... There is no problem with 'userIdentification' (which is a "simple" type) But, 'itineraryArr' is an array of 'itinerary', and I don't know how to use python to create XML array. I tried few combinations, for example itinerary0 = self.client.factory.create('itinerary') itineraryArray = self.client.factory.create('itineraryArray') itineraryArray = [itinerary0] searchRequest.itineraryArr = itineraryArray But all my trials resulted with the same server error - Server raised fault: 'Cannot use object of type itinerary as array' (Fault){ faultcode = "SOAP-ENV:Server" faultstring = "Cannot use object of type itinerary as array" } Appreciate you help..... Thanks, Uri

    Read the article

  • Javascript: Retrieve Object Property Names

    - by Jason
    I'm trying to write a function that needs to know the property names of an object being passed in, like so: var data = { "key1":"value1", "key2":"value2", etc} ^ i want the string value "key1" How do I retrieve the string "key1" from data? I know I can set a property dynamically like data[prop]=value but i want to know what prop is from an object passed in. If that doesn't make sense I suppose I could try to explain more. Thanks! I eventually want to do something like: for (var i = 0; i<data.length; i++) { var name = data[i].getPropertyName() <--- not a real function // do stuff }

    Read the article

  • How do I make dynamic windows in Swing?

    - by Roman
    I have a general question. I would like to have a window containing some buttons, radio buttons, text fields and so on. So, user can do something (write text, select options and press buttons). As the result of the user activity window should change it structure/appearance some element should disappear and some appear. How do I program such "updates"? Should I close an old window and open a new one or I can modify content of window without closing it?

    Read the article

  • (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

    - by Pyronaut
    I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

    Read the article

  • How do I inherit abstract unit tests in Ruby?

    - by Graeme Moss
    I have two unit tests that should share a lot of common tests with slightly different setup methods. If I write something like class Abstract < Test::Unit::TestCase def setup @field = create end def test_1 ... end end class Concrete1 < Abstract def create SomeClass1.new end end class Concrete2 < Abstract def create SomeClass2.new end end then Concrete1 does not seem to inherit the tests from Abstract. Or at least I cannot get them to run in eclipse. If I choose "Run all TestCases" for the file that contains Concrete1 then Abstract is run even though I do not want it to be. If I specify Concrete1 then it does not run any tests at all! If I specify test_1 in Concrete1 then it complains it cannot find it ("uncaught throw :invalid_test (ArgumentError)"). I'm new to Ruby. What am I missing here?

    Read the article

  • 2 table SQL Query weird results

    - by javArc
    Ok this is driving me nuts, I need to write an SQL query that will grab product information from 2 tables. The first table 'products' contains the productId, productname, quantityperunit and unitprice. Now I can search by productname and categoryname individually, but when I try to combine the 2 I get crazy results, Here's the query: "SELECT DISTINCT productId, productname, quantityperunit, unitprice FROM products pr, categories ca WHERE pr.categoryID = ca.categoryID AND ProductName LIKE '%" + searchTerm + "%' OR CategoryName LIKE '%" + searchTerm + "%' excuse the java style in there, here it is formatted better: SELECT DISTINCT productId, productname, quantityperunit, unitprice FROM products pr, categories ca WHERE pr.categoryID = ca.categoryID AND ProductName LIKE 'Tofu' OR CategoryName LIKE 'Tofu' any help would be appreciated.

    Read the article

  • Query MS Access database in VB 2008

    - by Logan
    Hi, I added an Access database as a Data Source in VB 2008. I want to query this database and use the information in various ways throughout the program. For example, there is an Employee table with first/last names of employees. I have a combobox on my form that I want to display all of the employees. So I want to query the database for all the rows in the Employee table, and add them to the combobox as I go. I am familiar with SQL Syntax, so I am not asking how to write the query itself, but rather how to fetch rows in VB code (mimicking php's mysql_fetch_assoc and mysql_connect essentially) Thanks! Edit: Also, I want to know if I can query a DB if I don't add it as a data source (if I know the path name of the database)

    Read the article

  • Finding employees specific to department in SQL SERVER 2000(SET BASED)

    - by xyz
    Suppose I have a table (tblEmp) whose structure is like as under Dept Emp d1 e1 d1 e2 d1 e3 d2 e4 d2 e5 d3 e6 If I need to bring the output as Dept DepartmentSpecificEmployees d1 e1,e2,e3 d2 e4,e5 d3 e6 I will write the query as select Dept, stuff((select Emp + ',' from tblEmp t2 where t1.Dept = t2.Dept for xml path(''),1,1,'')DepartmentSpecificEmployees from tblEmp t1 group by Dept But this will work in Sql Server 2005+. How can I achieve the same in Sql Server 2000 without any variable declaration or loop or cursor? If I use COALESCE as an alternative, then I need to use a variable which will defeat the purpose Please help

    Read the article

  • How to edit files on the users file system from my web server?

    - by Abs
    Hello all, I am really looking for implementation advice as I have entered a new realm that I am not familiar with. At the simplest level, I would like to find a way that I can read/write to a users machine from my web server. For this to work, I think I will have to install some sort of "plugin" on the users machine which can receive (or poll?) the server for instructions. The above is the line of thought that I currently have, maybe using JAVA to do this. This needs to work on Linux, Mac and Windows OS. I am really looking for advice on the above, is it a good idea? Is there a better way of doing this? Is there something out there already that I can build on top of? I really appreciate all input and advice as this is something I have not done before. Thanks all

    Read the article

  • Constructor initialising an array of subobjects?

    - by ojw
    Say I have several objects within a class, each of which needs constructing with a different value. I can write something like this: class b { public: b(int num) { // 1 for a.b1, and 2 for a.b2 } }; class a { public: b b1; b b2; a() : b1(1), b2(2) { } }; However, is it possible to do the same thing if those multiple objects are stored in an array? My first attempt at it doesn't compile: class a { public: b bb[2]; a() : bb[0](1), bb[1](2) { } };

    Read the article

  • try except block in Delphi

    - by Nik
    Do you guys know a way to trap log and re-raise exception in Delphi code. A simple example: procedure TForm3.Button1Click(Sender: TObject); begin try raise Exception.Create('Bum'); except on E: Exception do begin MyHandleException(E); end; end; end; procedure TForm3.MyHandleException(AException: Exception); begin ShowMessage(AException.Message); // raise AException; - this will access violate end; So I need to re-raise it in the except block but I was wondering is there a better way to write my own method to handle and (on specific conditions) to re-raise exceptions?

    Read the article

< Previous Page | 695 696 697 698 699 700 701 702 703 704 705 706  | Next Page >