Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 696/965 | < Previous Page | 692 693 694 695 696 697 698 699 700 701 702 703  | Next Page >

  • In Django, using __init__() method of non-abstract parent model to record class name of child model

    - by k-g-f
    In my Django project, I have a non-abstract parent model defined as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) and, say, two children models defined as follows: class ChildA(Parent): parent = models.OneToOneField(Parent,parent_link=True) class ChildB(Parent): parent = models.OneToOneField(Parent,parent_link=True) Each time I create an instance of ChildA or of ChildB, I'd like the classType attribute to be set to the strings "ChildA" or "ChildB" respectively. What I have done is added an _ _ init_ _() method to Parent as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) def __init__(self,*args,**kwargs): super(Parent,self).__init__(*args,**kwargs) self.classType = self.__class__.__name__ Is there a better way to implement and achieve my desired result? One downside of this implementation is that when I have an instance of the Parent, say "parent", and I want to get the type of the child object linked with "parent", calling "parent.classType" gives me "Parent". In order to get the appropriate "ChildA" or "ChildB" value, I need to write a "_getClassType()" method to wrap a custom sql query.

    Read the article

  • Metro style apps with Html and C#

    - by labroo
    According to this slide http://geekswithblogs.net/images/geekswithblogs_net/technetbytes/windows-8-platform-tools.jpg Does it mean I have to use XAML view with C# if I want to develop a metro styled application? Can I use a HTML/JS/CSS - C# combination with event handlers and all? Something like ASP.NET Webforms/MVC . I know it is not the same client server architecture, but since metro styled apps support HTML/JS, I was wondering. I can use Win-JS. But can I rather write C# than Javascript, and use HTML rather than XAML?(I dont know XAML and I like C#) All the C# samples I found online use XAML.

    Read the article

  • Reference to fnc.

    - by atch
    Hi guys, Is there a way in java to do something like this: void fnc(void Reference_to_other_func()); What I'm trying is basically I have number of places where I need to display this same text to the user and the only difference is which method is invoked after this text. So for example instead of writing: System.out.println("Hello"); f1(); //in some other place System.out.println("Hello"); f2(); //etc I would like to define one function: public void f(void Reference_to_other_func()) { System.out.println("Hello"); Reference_to_other_func();//HERE I'M INVOKING } and then instead of repeating this whole code I could write something like this: f(f1); //in some other place f(f2) //etc. Thanks for answers

    Read the article

  • Writing at the end of file

    - by user342534
    Hi, I'm working on a system that requires high file I/O performance (with C#). Basically, I'm filling up large files (~100MB) from the start of the file until the end of the file. Every ~5 seconds I'm adding ~5MB to the file (sequentially from the start of the file), on every bulk I'm flushing the stream. Every few minutes I need to update a structure which I write at the end of the file (some kind of metadata). When flushing each one of the bulks I have no performance issue. However, when updating the metadata at the end of the file I get really low performance. My guess is that when creating the file (which also should be done extra fast), the file doesn't really allocates the entire 100MB on the disk and when I flush the metadata it must allocates all space until the end of file. Guys/Girls, any Idea how I can overcome this problem? Thanks a lot!

    Read the article

  • Running Test framework as part of application

    - by VP
    Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

    Read the article

  • Problem with an application in USB

    - by rajivpradeep
    I have an application on a pen drive, which executes some flash files on the same USB flash drive. when i run the application with in the drive, the application just keeps running in the back ground without running the flash files. When i copy the application on desktop, it runs the flash files in the USB. Also i programmed the app to write log file, when i run the application with in USB, the app is running but the log file is not getting written, when i remove the pen drive, the file gets written. What might be the problem, I am using VC++ , VS 2008 to build the application.

    Read the article

  • INSERT INTO othertbl SELECT * tbl

    - by Harry
    Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

    Read the article

  • detect a string contained by another discontinuously

    - by SpawnCxy
    Recently I'm working on bad content(such as advertise post) filter of a BBS.And I write a function to detect a string is in another string not continuously.Code as below: $str = 'helloguys'; $substr1 = 'hlu'; $substr2 = 'elf'; function detect($a,$b) //function that detect a in b { $c = ''; for($i=0;$i<=strlen($a);$i++) { for($j=0;$j<=strlen($b);$j++) { if($a[$i] == $b[$j]) { $b=substr($b,$j+1); $c .=$a[$i]; break; } } } if($c == $a) return true; else return false; } var_dump(detect($substr1,$str)); //true var_dump(detect($substr2,$str)); //false Since the filter works before the users do their posts so I think the efficiency here is important.And I wonder if there's any better solution? Thanks!

    Read the article

  • Shall I optimize or let compiler to do that?

    - by Knowing me knowing you
    What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

    Read the article

  • Android: how to have app talk to a web page, ie send gps location

    - by Ted pottel
    I'm trying to write a app, where a webpage will have a button that when press will give the GPS location of the phone. I was going to have the android app create a thread that waits on a scket connection. The issue is that 1. Getting the ip addrs of the phone 2. I was told this would really drain the battery I was also thinking about having the phone send the gps location to a webserver like evrry 10 seconds. This sort of seams like a waste of bandwidth. Is there a good way to do this?

    Read the article

  • c++ unicode writing is not working

    - by Jugal Kishore
    I am trying to write some Russian unicode text in file by wfstream. Following piece of code has been used for it. wfstream myfile; locale AvailLocale("Russian"); myfile.imbue(AvailLocale); myfile.open(L"d:\\example.txt",ios::out); if (myfile.is_open()) { myfile << L"?????? ????" <<endl; } myfile.flush(); myfile.close(); Something unrecognizable is written to the file by executing this code, I am using VS 2008.

    Read the article

  • How to parse out html links from a huge string with html links and other text (Java).

    - by Robert
    Hello, my question is how would i be able to go through a string and take out only the links and erase all the rest? I thought about using some type of delemiter, but wouldnt know how to go about using it in java. an example of what i am trying to do: this is my String: String myString = "The file is http: // www. .com/hello.txt and the second file is " + "http: // www. .com/hello2.dat"; I would want the output to be: "http: // www. .com/hello.txt http: // www. .com/hello2.dat" or each could be added to an array, separately. I just want some ideas, id like to write the code myself but am having trouble on how to do it. Any help would be awesome.

    Read the article

  • Query MS Access database in VB 2008

    - by Logan
    Hi, I added an Access database as a Data Source in VB 2008. I want to query this database and use the information in various ways throughout the program. For example, there is an Employee table with first/last names of employees. I have a combobox on my form that I want to display all of the employees. So I want to query the database for all the rows in the Employee table, and add them to the combobox as I go. I am familiar with SQL Syntax, so I am not asking how to write the query itself, but rather how to fetch rows in VB code (mimicking php's mysql_fetch_assoc and mysql_connect essentially) Thanks! Edit: Also, I want to know if I can query a DB if I don't add it as a data source (if I know the path name of the database)

    Read the article

  • SQL Select Upcoming Birthdays

    - by Crob
    I'm trying to write a stored procedure to select employees who have birthdays that are upcoming. SELECT * FROM Employees WHERE Birthday > @Today AND Birthday < @Today + @NumDays This will not work because the birth year is part of Birthday, so if my birthday was '09-18-1983' that will not fall between '09-18-2008' and '09-25-2008'. Is there a way to ignore the year portion of date fields and just compare month/days? This will be run every monday morning to alert managers of birthdays upcoming, so it possibly will span new years. Here is the working solution that I ended up creating, thanks Kogus. SELECT * FROM Employees WHERE Cast(DATEDIFF(dd, birthdt, getDate()) / 365.25 as int) - Cast(DATEDIFF(dd, birthdt, futureDate) / 365.25 as int) <> 0

    Read the article

  • In Ruby, how do I make a hash from an array?

    - by Wizzlewott
    I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

    Read the article

  • Choosing an alternative ( visual basic) high level programming language

    - by user370244
    I used to be visual basic 6 programmer, i was pleased with visual basic : it is high level language that do stuff fast,easy to learn, easy to do stuff in,you can drag and drop stuff to the form and write your code,it is simply amazing.however microsoft buried VB6 and pointed us to VB.NET which is so different that it is not the old VB anymore.I didn't like what microsoft did and would like to look somewhere AWAY from microsoft and from any other proprietary language . I would like to look into a similar language that is easy,cross platform (windows / Linux), object oriented, visual design, non proprietary and compile (for some guarding against reverse engineering). i am freelancer so the choice is entirely mine,i don't care about performance of programs, the time taken to develop a given programs is much more important. desktop / database / GUI /networking programming is what i am looking for. so any such language offered by our open source community ? thank you so much

    Read the article

  • Combining IN and NOT IN in SQL as single result

    - by UltraVi01
    I apologize for the vague title. I am attempting to write a query that returns an alias column with matching values (resulting from an IN) as well as an alias column with values that do not match (using NOT IN). I want the result set to have: userId | matches | nonmatches. I currently have the following query which returns the matches as expected. I am having trouble getting the nonmatches in the result set -- that is, from a NOT IN statement SET @userId = 9; SELECT ug.user_id, COUNT(DISTINCT goal_id) as matches FROM user_goal ug WHERE ug.user_id!=@userId AND goal_id IN (SELECT iug.goal_id FROM user_goal iug WHERE user_id=@userId) GROUP BY user_id ORDER BY matches DESC LIMIT 4 So, the NOT IN would look something like this: goal_id NOT IN(SELECT uggg.goal_id FROM user_goal uggg WHERE user_id=@userId) AS nonmatches I am just not sure how to incorporate the NOT IN statement in my query so I get all the results

    Read the article

  • Constructor initialising an array of subobjects?

    - by ojw
    Say I have several objects within a class, each of which needs constructing with a different value. I can write something like this: class b { public: b(int num) { // 1 for a.b1, and 2 for a.b2 } }; class a { public: b b1; b b2; a() : b1(1), b2(2) { } }; However, is it possible to do the same thing if those multiple objects are stored in an array? My first attempt at it doesn't compile: class a { public: b bb[2]; a() : bb[0](1), bb[1](2) { } };

    Read the article

  • How do I unpack bits from a structure's stream_data in c code?

    - by Chelp
    Ex. typedef struct { bool streamValid; dword dateTime; dword timeStamp; stream_data[800]; } RadioDataA; Ex. Where stream_data[800] contains: **Variable** **Length (in bits)** packetID 8 packetL 8 versionMajor 4 versionMinor 4 radioID 8 etc.. I need to write: void unpackData(radioDataA *streamData, MA_DataA *maData) { //unpack streamData (from above) & put some of the data into maData //How do I read in bits of data? I know it's by groups of 8 but I don't understand how. //MAData is also a struct. }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Eclipse plugin to measure programmer performance/stats

    - by trenki
    Does anyone know of an Eclipse plugin that can give me some stats about my behavior/usage of the Eclipse IDE? There are quite a few things I would like to know: How often/when do I invoke the "Build All" command (through Ctrl+B) How often does compilation fail/succeed (+ number of errors/warnings) How often do I hit Backspace? (I do that way to often; If pressing that key would give a nasty sound I would in time learn to type correctly in the first place) How many characters/lines of code that I typed do I delete (possibly quite immediately) How (effective/efficient/...) is my Mouse/Keyboard/IDE usage? (Kinda like measuring APM in StarCraft; this could be fun) If there is no such Eclipse plugin around, how complex and time consuming would It be to write a plugin that can accomplish the above?

    Read the article

  • Strange python error

    - by Werner
    Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

    Read the article

  • Help with implementing a function to change size of dynamic array

    - by iRobot
    I'm trying to write a function that will change the size of a dynamic array to a new size. In my header file, I have: Image **images; //pointer to a dynamic array of image pointers int maximum; //size I want to do this by allocating a new array and copying the values over without changing their indices. If there are non-null pointers outside the range newmax, then we cant do this. So heres what I have: There are no compilation or runtime errors. However, I find that the new array isnt getting sized right. When I run the following test case: I should get an index out of bounds error, but instead the system lets it slide. Can anyone see the mistake? I've looked for hours but cant find anything.

    Read the article

  • Why StringWriter.ToString return `System.Byte[]` and not the data?

    - by theateist
    UnZipFile method writes the data from inputStream to outputWriter. Why sr.ToString() returns System.Byte[] and not the data? using (var sr = new StringWriter()) { UnZipFile(response.GetResponseStream(), sr); var content = sr.ToString(); } public static void UnZipFile(Stream inputStream, TextWriter outputWriter) { using (var zipStream = new ZipInputStream(inputStream)) { ZipEntry currentEntry; if ((currentEntry = zipStream.GetNextEntry()) != null) { var size = 2048; var data = new byte[size]; while (true) { size = zipStream.Read(data, 0, size); if (size > 0) { outputWriter.Write(data); } else { break; } } } } }

    Read the article

< Previous Page | 692 693 694 695 696 697 698 699 700 701 702 703  | Next Page >