Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 696/965 | < Previous Page | 692 693 694 695 696 697 698 699 700 701 702 703  | Next Page >

  • Java generics: actual class as a generic parameter.

    - by user554916
    What do I write instead of "TheClass" to make this work? Or is there an alternative way to do it (possibly without making WithName and WithAge generic)? class Item { NeigborList<TheClass> neighbors; } class WithName extends Item { // here I want neighbors to be a NeighborList<WithName> String name; void someMethod() { System.out.println(neighbors.nearestTo(this).name); } } class WithAge extends Item { // here I want neighbors to be a NeighborList<WithAge> int age; void someOtherMethod() { System.out.println(neighbors.nearestTo(this).age); } }

    Read the article

  • regular expression

    - by Altariste
    Hi, I need to find all invocations of some logging macros in the code. The macro invocation is of the form: DEBUG[1-5] ( "methodName: the logged message", arguments) But the new versions of the macros are prepending the name of the method automatically, so my task is to write a Python script that will remove the duplicate function names specified already by the programmer. I'm using the sub function from the re module. I plan to substitute the part indicated by || signs below : ||DEBUG[1-5] ("methodName: || the logged message", arguments) with simply DEBUG[1-5](" The problem is following: To find the expressions I want to substitute, I use the following regular expression: ((DEBUG | INFO | all other macros names )[1-5]*)\s*\(\"\w+: But it doesn't match the whole expression ( from DEBUG right to the colon ), but only the macro name, that is for example DEBUG5. Is my expression wrong or there is some quirk in the Python regex processing? ( maybe the fact that I use the DEBUG[1-5] as a subgroup has something to do with this? ) Help from anyone more knowledgable than me appreciated :).

    Read the article

  • Help me construct this Linq statement

    - by Geoffrey
    There should be a simple Linq query for what I'm trying to accomplish, but I'm producing some ugly code. I have two tables, one of issues and another of issue status. There is a one-to-many relationship between issue and issue status. When an issue is created an IssueStatus is also created with the status field set to "Open" when it is closed, another IssueStatus is created with the status field set to "Closed" ... but issues can be re-opened. It seems like I should be able to write something like this: public static List<Issue> FindOpenIssues(this IList<Issue> issues) { return ( from issue in issues from issueStatus in issue.issueStatus.OrderBy(x=>x.CreatedOn).Single() where issueStatus.Status == "Open" select issue ).ToList(); } This obviously fails, but there must be a clean way to do this? Thanks!

    Read the article

  • How to parse out html links from a huge string with html links and other text (Java).

    - by Robert
    Hello, my question is how would i be able to go through a string and take out only the links and erase all the rest? I thought about using some type of delemiter, but wouldnt know how to go about using it in java. an example of what i am trying to do: this is my String: String myString = "The file is http: // www. .com/hello.txt and the second file is " + "http: // www. .com/hello2.dat"; I would want the output to be: "http: // www. .com/hello.txt http: // www. .com/hello2.dat" or each could be added to an array, separately. I just want some ideas, id like to write the code myself but am having trouble on how to do it. Any help would be awesome.

    Read the article

  • Isses using function with variadic arguments

    - by Sausages
    I'm trying to write a logging function and have tried several different attempts at dealing with the variadic arguments, but am having problems with all of them. Here's the latest: - (void) log:(NSString *)format, ... { if (self.loggingEnabled) { va_list vl; va_start(vl, format); NSString* str = [[NSString alloc] initWithFormat:format arguments:vl]; va_end(vl); NSLog(format); } } If I call this like this: [self log:@"I like: %@", @"sausages"]; Then I get an EXC_BAD_ACCESS at the NSLog line (there's also a compiler warning that the format string is not a string literal). However if in XCode's console I do "po str" it displays "I like: sausages" so str seems ok.

    Read the article

  • AS3: Performance question calling an event function with null param

    - by adehaas
    Lately I needed to call a listener function without an actual listener like so: foo(null); private function foo(event:Event):void { //do something } So I was wondering if there is a significant difference regarding performance between this and using the following, in which I can prevent the null in calling the function without the listener, but am still able to call it with a listener as well: foo(); private function foo(event:Event = null):void { } I am not sure wether it is just a question of style, or actually bad practice and I should write two similar functions, one with and one without the event param (which seems cumbersome to me). Looking forward to your opinions, thx.

    Read the article

  • What is the best way for converting phone numbers into international format (E.164) using Java?

    - by Vihung
    What is the best way for converting phone numbers into international format (E.164) using Java? Given a 'phone number' and a country id (let's say an ISO country code), I would like to convert it into a standard E.164 international format phone number. I am sure I can do it by hand quite easily - but I would not be sure it would work correctly in all situations. Which Java framework/library/utility would you recommend to accomplish this? P.S. The 'phone number' could be anything identifiable by the general public - such as * (510) 786-0404 * 1-800-GOT-MILK * +44-(0)800-7310658 that last one is my favourite - it is how some people write their number in the UK and means that you should either use the +44 or you should use the 0. The E.164 format number should be all numeric, and use the full international country code (e.g.+44)

    Read the article

  • How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

    - by EugeneP
    How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

    Read the article

  • 1054 - Unknown column 'apa_calda' in 'where clause'

    - by sebastian
    Hi, I keep getting this error in mysql. Here is the query: SELECT user_id FROM detalii_contor WHERE tip_contor=apa_calda i want to use this query in a php file but it doesn't give any result. so i tried to write it in the sql command prompt. here is what i tried in the php file: $Q = "SELECT id_contor, den_contor FROM detalii_contor WHERE tip_contor='".$contor."'"; $Q = "SELECT id_contor, den_contor FROM detalii_contor WHERE tip_contor='$contor'"; even without "" or without '' i wanted to get $contor from a form, i also tried with $_POST['util'] and {$_POST['util']} i've also tried to set $contor the value i need, but no result. please help. thanks, Sebastian

    Read the article

  • need to loop through a PHP array in JavaScript

    - by user296516
    Hi guys, For example I have a PHP array, such as this one <?php $s= array('a','b','c','d','e','f') ; ?> And I need to loop through it in JavaScript, any ideas how do I do that? for ( i=0 ; i < <?php echo sizeof($s) ?> ; i++) { document.write('<?php echo $s [somehow need to get the 'i' value into here] ?>'); } Any suggestions? Thanks!

    Read the article

  • Problem with an application in USB

    - by rajivpradeep
    I have an application on a pen drive, which executes some flash files on the same USB flash drive. when i run the application with in the drive, the application just keeps running in the back ground without running the flash files. When i copy the application on desktop, it runs the flash files in the USB. Also i programmed the app to write log file, when i run the application with in USB, the app is running but the log file is not getting written, when i remove the pen drive, the file gets written. What might be the problem, I am using VC++ , VS 2008 to build the application.

    Read the article

  • Call function by pointer and set parametrs in memory block

    - by Ellesmess Glain
    Hi, I've little problem : I'm solving problem with calling function by pointer and passing to it parameters in continuous memory block. My goal is to have function named e.g CallFunc(void * func,void *params, unsigned int param_length); that I'll send function pointer, pointer to function's parameters and eventually parameters length and this calling function will call passed function with it's parameters. I will like write this in C/C++, but if somebody has idea, how this resolve in other language, that supports DLL generation and exportet functions, it will be fine too. Thanks for answers, Ellesmess P.S. I'm sorry about my English, but I'm Czech, thanks :o)

    Read the article

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • Odd toString behavior in javascript

    - by George
    I have this small function that's behaving oddly to me. Easy enough to work around, but enough to pique my curiosity. function formatNumber(number,style) { if (typeof style == 'number') { style = style.toString(); } return (number).format(style); } The return format part is based on another function that requires the style variable to be a string to work properly, so I'm just checking if style is a number and if it is to convert it to a string. When the function above is written as is, the format function format doesn't work properly. However when I write it as simply: return (number).format(style.toString()); Everything works. Is there a difference between putting the .toString function inside the format call vs performing it before hand and setting it as the variable style?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to version SQL Server schema using VS 2005?

    - by Mike
    I am new to C# programming and am coming to it most recently from working with Ruby on Rails. In RoR, I am used to being able to write schema migrations for the database. I would like to be able to do something similar for my C#/SQLServer projects. Does such a tool exist for the VS 2005 toolset? Would it be wise to use RoR migrations with SQL Server directly outside of VS 2005? In other words, I would handle all schema versioning using ActiveRecord:Migration from Rails but nothing else. If I do handle migrations outside of C# and VS 2005 with another tool, is RoR ActiveRecord:Migration the best thing to use or is there something which is a better fit?

    Read the article

  • SQL grouping query question; evaluating a group of rows based on the value of one field.

    - by user324575
    I've got table vendorparts that lists all my parts and their vendor(s). Parts with multiple vendors have multiple records in this table. I'm trying to write a query that only returns the partid, and vendor of parts that do not have a default vendor assigned. Partid Vendor Defaultflag 1 A 1 2 B 0 2 C 0 3 D 0 3 E 0 3 F 1 4 G 0 I would like to return the following: Partid Vendor 2 A 2 B 4 G I'm obviously having issues with partid 3 and getting the query to see it as having a default vendor assigned.

    Read the article

  • what is regular expression not generated over {a,b}?

    - by Loop
    Hello all, I am really stuck with these 2 question for over 2 days now. trying to figure out what the question means.... my tutor is out of town too.... write a regular expression for the only strings that are not generated over {a,b} by the expression: (a+b)*a(a+b)*. explain your reasoning. and i tried the second question, do you think is there any better answer than this one? what is regular expression of set of string that contain an odd number of a's or exactly two b's................(a((a|b)(a|b))*|bb).... coz i know to represent any odd length of a's, the RE is a((a|b)(a|b))*

    Read the article

  • In Ruby, how do I make a hash from an array?

    - by Wizzlewott
    I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

    Read the article

  • How to define a ternary operator in Scala which preserves leading tokens?

    - by Alex R
    I'm writing a code generator which produces Scala output. I need to emulate a ternary operator in such a way that the tokens leading up to '?' remain intact. e.g. convert the expression c ? p : q to c something. The simple if(c) p else q fails my criteria, as it requires putting if( before c. My first attempt (still using c/p/q as above) is c match { case(true) = p; case _ = q } another option I found was: class ternary(val g: Boolean = Any) { def |: (b:Boolean) = g(b) } implicit def autoTernary (g: Boolean = Any): ternary = new ternary(g) which allows me to write: c |: { b: Boolean = if(b) p else q } I like the overall look of the second option, but is there a way to make it less verbose? Thanks

    Read the article

  • How do I pick the most beneficial combination of items from a set of items?

    - by Chu
    I'm designing a piece of a game where the AI needs to determine which combination of armor will give the best overall stat bonus to the character. Each character will have about 10 stats, of which only 3-4 are important, and of those important ones, a few will be more important than the others. Armor will also give a boost to 1 or all stats. For example, a shirt might give +4 to the character's int and +2 stamina while at the same time, a pair of pants may have +7 strength and nothing else. So let's say that a character has a healthy choice of armor to use (5 pairs of pants, 5 pairs of gloves, etc.) We've designated that Int and Perception are the most important stats for this character. How could I write an algorithm that would determine which combination of armor and items would result in the highest of any given stat (say in this example Int and Perception)?

    Read the article

  • Writing an installer using codigniter

    - by RobertWHurst
    I'm just about finished my first release of automailer, a program I've been working on for a while now. I've just got to finish writing the installer. Its job is to rewrite the codigniter configs from templates. I've got the read/write stuff working, but I'd like to be able to test the server credentials given by the user without codingiter throwing a system error if they're wrong. Is there a function other than mysql_connect that I can use to test a connection that will return true or false and won't make codeigniter have a fit?

    Read the article

  • Low-overhead way to access the memory space of a traced process?

    - by vovick
    Hello all. I'm looking for an efficient way to access(for both read and write operations) the memory space of my ptraced child process. The size of blocks being accessed may vary from several bytes up to several megabytes in size, so using the ptrace call with PTRACE_PEEKDATA and PTRACE_POKEDATA which read only one word at a time and switch context every time they're called seems like a pointless waste of resources. The only one alternative solution I could find, though, was the /proc/<pid>/mem file, but it has long since been made read only. Is there any other (relatively simple) way to do that job? The ideal solution would be to somehow share the address space of my child process with its parent and then use the simple memcpy call to copy data I need in both directions, but I have no clues how to do it and where to begin. Any ideas?

    Read the article

  • (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

    - by Pyronaut
    I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

    Read the article

  • ByteArrayOutputStream to PrintWriter (Java Servlet)

    - by Thomas
    Writing generated PDF (ByteArrayOutputStream) in a Servlet to PrintWriter. I am desperately looking for a way to write a generated PDF file to the response PrintWriter. Since a Filter up the hierarchy chain has already called response.getWriter() I can't get response.getOutputStream(). I do have a ByteArrayOutputStream where I generated the PDF into. Now all I need is a way to output the content of this ByteArrayOutputStream to the PrintWriter. If anyone could give me a helping hand would be very much appreciated!

    Read the article

< Previous Page | 692 693 694 695 696 697 698 699 700 701 702 703  | Next Page >