Search Results

Search found 1934 results on 78 pages for 'areas'.

Page 70/78 | < Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Rails 3: How do I call a javascript function from a js.erb file

    - by user321775
    Now that I've upgraded to Rails 3, I'm trying to figure out the proper way to separate and reuse pieces of javascript. Here's the scenario I'm dealing with: I have a page with two areas: one with elements that should be draggable, the other with droppables. When the page loads I use jQuery to setup the draggables and droppables. Currently I have the script in the head portion of application.html.erb, which I'm sure is not the right solution but at least works. When I press a button on the page, an ajax call is made to my controller that replaces the draggables with a new set of elements that should also be draggable. I have a js.erb file that renders a partial in the correct location. After rendering I need to make the new elements draggable, so I'd like to reuse the code that currently lives in application.html.erb, but I haven't found the right way to do it. I can only make the new elements draggable by pasting the code directly into my js.erb file (yuck). What I'd like to have: - a javascript file that contains the functions prepdraggables() and prepdroppables() - a way to call either function from application.html.erb or from a js.erb file I've tried using :content_for to store and reuse the code, but can't seem to get it working correctly. What I currently have in the head section of application.html.erb <% content_for :drag_drop_prep do %> <script type="text/javascript" charset="utf-8"> $(document).ready(function () { // declare all DOM elements with class draggable to be draggable $( ".draggable" ).draggable( { revert : 'invalid' }); // declare all DOM elements with class legal to be droppable $(".legal").droppable({ hoverClass : 'legal_hover', drop : function(event, ui) { var c = new Object(); c['die'] = ui.draggable.attr("id"); c['cell'] = $(this).attr("id"); c['authenticity_token'] = encodeURIComponent(window._token); $.ajax({ type: "POST", url: "/placeDie", data: c, timeout: 5000 }); }}); }); </script> <% end %> undo.js.erb $("#board").html("<%= escape_javascript(render :partial => 'shared/board', :locals => { :playable => true, :restartable => !session[:challenge]}) %>") // This is where I want to prepare draggables. <%= javascript_include_tag "customdragdrop.js" %> // assuming this file had the draggables code from above in a prepdraggables() function prepdraggables();

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Coping with feelings of technical mediocrity

    - by Karim
    As I've progressed as a programmer, I noticed more nuance and areas I could study in depth. In part, I've come to think of myself from, at one point, a "guru" to now much less, even mediocre or inadequate. Is this normal, or is it a sign of a destructive excessive ambition? Background I started to program when I was still a kid, I had about 10 or 11 years. I really enjoy my work and never get bored from it. It's amazing how somebody could be paid for what he really likes to do and would be doing it anyway even for free. When I first started to program, I was feeling proud of what I was doing, each application I built was for me a success and after 2-3 year I had a feeling that I'm a coding guru. It was a nice feeling. ;-) But the more I was in the field and the more types of software I started to develop, I was starting to have a feeling that I'm completely wrong in thinking I'm a guru. I felt that I'm not even a mediocre developer. Each new field I start to work on is giving me this feeling. Like when I once developed a device driver for a client, I saw how much I need to learn about device drivers. When I developed a video filter for an application, I saw how much do I still need to learn about DirectShow, Color Spaces, and all the theory behind that. The worst thing was when I started to learn algorithms. It was several years ago. I knew then the basic structures and algorithms like the sorting, some types of trees, some hashtables, strings, etc. and when I really wanted to learn a group of structures I learned about 5-6 new types and saw that in fact even this small group has several hundred subtypes of structures. It's depressing how little time people have in their lives to learn all this stuff. I'm now a software developer with about 10 years of experience and I still feel that I'm not a proficient developer when I think about things that others do in the industry.

    Read the article

  • How do I write object classes effectively when dealing with table joins?

    - by Chris
    I should start by saying I'm not now, nor do I have any delusions I'll ever be a professional programmer so most of my skills have been learned from experience very much as a hobby. I learned PHP as it seemed a good simple introduction in certain areas and it allowed me to design simple web applications. When I learned about objects, classes etc the tutor's basic examnples covered the idea that as a rule of thumb each database table should have its own class. While that worked well for the photo gallery project we wrote, as it had very simple mysql queries, it's not working so well now my projects are getting more complex. If I require data from two separate tables which require a table join I've instead been ignoring the class altogether and handling it on a case by case basis, OR, even worse been combining some of the data into the class and the rest as a separate entity and doing two queries, which to me seems inefficient. As an example, when viewing content on a forum I wrote, if you view a thread, I retrieve data from the threads table, the posts table and the user table. The queries from the user and posts table are retrieved via a join and not instantiated as an object, whereas the thread data is called using my Threads class. So how do I get from my current state of affairs to something a little less 'stupid', for want of a better word. Right now I have a DB class that deals with connection and escaping values etc, a parent db query class that deals with the common queries and methods, and all of the other classes (Thread, Upload, Session, Photo and ones thats aren't used Post, User etc ) are children of that. Do I make a big posts class that has the relevant extra attributes that I retrieve from the users (and potentially threads) table? Do I have separate classes that populate each of their relevant attributes with a single query? If so how do I do that? Because of the way my classes are written, based on what I was taught, my db update row method, or insert method both just take the attributes as an array and update all of that, if I have extra attributes from other db tables in each class then how do I rewrite those methods as obbiously updating automatically like that would result in errors? In short I think my understanding is limited right now and I'd like some pointers when it comes to the fundamentals of how to write more complex classes.

    Read the article

  • Issue with SQL query for activity stream/feed

    - by blabus
    I'm building an application that allows users to recommend music to each other, and am having trouble building a query that would return a 'stream' of recommendations that involve both the user themselves, as well as any of the user's friends. This is my table structure: Recommendations ID Sender Recipient [other columns...] -- ------ --------- ------------------ r1 u1 u3 ... r2 u3 u2 ... r3 u4 u3 ... Users ID Email First Name Last Name [other columns...] --- ----- ---------- --------- ------------------ u1 ... ... ... ... u2 ... ... ... ... u3 ... ... ... ... u4 ... ... ... ... Relationships ID Sender Recipient Status [other columns...] --- ------ --------- -------- ------------------ rl1 u1 u2 accepted ... rl2 u3 u1 accepted ... rl3 u1 u4 accepted ... rl4 u3 u2 accepted ... So for user 'u4' (who is friends with 'u1'), I want to query for a 'stream' of recommendations relevant to u4. This stream would include all recommendations in which either the sender or recipient is u4, as well as all recommendations in which the sender or recipient is u1 (the friend). This is what I have for the query so far: SELECT * FROM recommendations WHERE recommendations.sender IN ( SELECT sender FROM relationships WHERE recipient='u4' AND status='accepted' UNION SELECT recipient FROM relationships WHERE sender='u4' AND status='accepted') OR recommendations.recipient IN ( SELECT sender FROM relationships WHERE recipient='u4' AND status='accepted' UNION SELECT recipient FROM relationships WHERE sender='u4' AND status='accepted') UNION SELECT * FROM recommendations WHERE recommendations.sender='u4' OR recommendations.recipient='u4' GROUP BY recommendations.id ORDER BY datecreated DESC Which seems to work, as far as I can see (I'm no SQL expert). It returns all of the records from the Recommendations table that would be 'relevant' to a given user. However, I'm now having trouble also getting data from the Users table as well. The Recommendations table has the sender's and recipient's ID (foreign keys), but I'd also like to get the first and last name of each as well. I think I require some sort of JOIN, but I'm lost on how to proceed, and was looking for help on that. (And also, if anyone sees any areas for improvement in my current query, I'm all ears.) Thanks!

    Read the article

  • CSS / HTML - Image will not show up

    - by weka
    Ugh, ok. I've been up all night working this thing and now an image won't show. It's so darn annoying. Trying to get this .png image to show up on a simple PHP webpage. I just wanna go to sleep X_X CSS: <style> .achievement { position:relative; width:500px; background:#B5B5B5; float:left; padding:10px; margin-bottom:10px; } .icon { float:left; width:32px; height:32px; background: url("images/trophy.php") no-repeat center; padding:05px; border:4px solid #4D4D4D; } .ptsgained { position:absolute; top:0; right:0; background:#79E310; color:#fff; font-family:Tahoma; font-weight:bold; font-size:12px; padding:5px; } .achievement h1 { color:#454545; font-size:12pt; font-family:Georgia; font-weight:none; margin:0;padding:0; } .achievement p { margin:0;padding:0; font-size:12px; font-family:Tahoma; color:#1C1C1C; } .text { margin-left:10px; float:left; } </style> HTML: <div class="achievement"> <span class="ptsgained">+10</span> <div class="icon"></div> <div class="text"><h1>All Around Submitter</h1> <p>Submit and have approved content in all 6 areas.</p> </div> </div> What am I doing wrong, guys? :\

    Read the article

  • Optimizing GDI+ drawing?

    - by user146780
    I'm using C++ and GDI+ I'm going to be making a vector drawing application and want to use GDI+ for the drawing. I'v created a simple test to get familiar with it: case WM_PAINT: GetCursorPos(&mouse); GetClientRect(hWnd,&rct); hdc = BeginPaint(hWnd, &ps); MemDC = CreateCompatibleDC(hdc); bmp = CreateCompatibleBitmap(hdc, 600, 600); SelectObject(MemDC,bmp); g = new Graphics(MemDC); for(int i = 0; i < 1; ++i) { SolidBrush sb(Color(255,255,255)); g->FillRectangle(&sb,rct.top,rct.left,rct.right,rct.bottom); } for(int i = 0; i < 250; ++i) { pts[0].X = 0; pts[0].Y = 0; pts[1].X = 10 + mouse.x * i; pts[1].Y = 0 + mouse.y * i; pts[2].X = 10 * i + mouse.x; pts[2].Y = 10 + mouse.y * i; pts[3].X = 0 + mouse.x; pts[3].Y = (rand() % 600) + mouse.y; Point p1, p2; p1.X = 0; p1.Y = 0; p2.X = 300; p2.Y = 300; g->FillPolygon(&b,pts,4); } BitBlt(hdc,0,0,900,900,MemDC,0,0,SRCCOPY); EndPaint(hWnd, &ps); DeleteObject(bmp); g->ReleaseHDC(MemDC); DeleteDC(MemDC); delete g; break; I'm wondering if I'm doing it right, or if I have areas killing the cpu. Because right now it takes ~ 1sec to render this and I want to be able to have it redraw itself very quickly. Thanks In a real situation would it be better just to figure out the portion of the screen to redraw and only redraw the elements withing bounds of this?

    Read the article

  • Are there any CMS editors out there which users can populate locked down HTML templates with content

    - by Deep
    Hi there, We work in email marketing, creating HTML/TEXT emails for clients. In essence we design HTML email templates for our clients. Clients then post us content (via a form) to populate these templates before we send them out. Right now we do this manually, basically cutting and pasting the content from their submitted form into the relevant parts of the template, which is time consuming and particularly mind-numbing. What we're looking for (and have so far been unable to find) is a simple system which will allow us to capture this client content in a sort of WYSIWYG HTML format. Basically they populate a locked down version of the template, entering text where necessary, before submitting to us. This is our most basic requirement, and a friend of mine kindly demo'd a proof of concept here: http://advantageone.co.uk/mbe/ Note: If you click on a text area in the body of the template, an editor pop ups. Now what we are looking for a CMS editor out there which can be easily adapted to do the above and the following for our end clients? User login View previously submitted campaigns that they have created and edit these Create new - selecting from template (assigned to their user/client id), perhaps being able to add new rows to the template. And have these HTML templates locked down so they can only edit what they're allowed too (like in the demo above), and perhaps make some areas required. Perhaps have a simple workflow or approval built in Allow us to lock submitted campaigns after a point so they can't be further edited, and as administrators view all campaigns from all users Be so incredibly simple, with any extraneous functionality switched off Essentially an extremley simple stripped down CMS, but we use the outputted HTML for sending out as an email, rather than publishing onto the web. Now to the actual dilemma: we're looking for something really simple, and the above sounds like a CMS. But we haven't been able to find anything that already does, or can be easily adapted to do this. Everything is either too complex, or simple and inflexible. We're sure there must be something off the shelf available, rather than us coding something ourselves. But we've kind of got stuck. Does anyone know of a system, or could recommend a system that can do the above out of the box, or with a few days tweaking? Forgive me if this is a little disjointed, if I'm being incredibly dopey and there is something out there please let me know! Kind regards, Dp.

    Read the article

  • What would make a noise in a PC on graphics operations on a passively-cooled system?

    - by T.J. Crowder
    I have this system based on the Intel D510MO motherboard, which is basically an Atom D510 (dual-core HT Atom w/built-in GPU), an Intel NM10 chipset, and a Realtek Gigabit LAN controller. It's entirely passively cooled. I noticed almost immediately that there was a kind of very, very soft noise that corresponded with graphics operations, sort of the noise you'd get if you had a sheet of flat paper and slid something really light across it — but more electronic than that. I wrote it off as observation error and/or disk activity triggered by the graphics operation (although the latter seemed like a lot of unnecessary disk activity). It isn't. I got curious enough that I finally did a few controlled experiments, and here's what I've determined: It isn't the HDD. For one thing, the sounds the HDD makes (when seeking, when reading or writing, when just sitting there spinning) is different. For another, I used sudo hdparm -y /dev/sda (I'm using Ubuntu 10.04 LTS) to temporarily put the disk on standby while making sure that non-disk graphics op was happening in a loop. The disk spun down, but the other sound continued, corresponding perfectly with the timing of the graphics op. (Then the disk spun up again, but it takes long enough that I could rule out the HDD.) It isn't the monitor; I ensured the two were well physically-separated and the sound was definitely coming from the main box. It isn't something else in the room; the sound is coming from the box. It isn't cross-talk to an audio circuit coming out the speakers. (It doesn't have any speakers.) It isn't my mouse (e.g., when I'm trying to make graphics ops happen); the sound happens if I set up a recurring operation and don't use the mouse at all, or if I lift the mouse off the table slightly (but enough that the laser still registers movement). It isn't the voices in my head; they never whisper like that. Other observations: It doesn't seem to matter what the graphics operation is; anything that changes what's on the screen seems to do it. I get the sound when moving the mouse over the Chromium tab bar (which makes the tab backgrounds change); I get it when a web page has a counter on it that changes the text on the page: I get it when dragging window contents around. The sound is very, very slightly louder if the graphics op is larger, like scrolling a text area when writing a question on superuser.com, than for smaller operations like the tick counter on the web page. But it's very slight. It's fairly loud (and of good duration) when the op involves color changes to substantial surface areas. For instance, when asking a question here on superuser and you move the cursor between the question box and the tag box, and the help to the right fades out, changes, and fades back in. (Yet another example related to the web browser, so let me say: I hear it when operations completely unrelated to the web browser as well.) It doesn't sound like arcing or anything like that (I'd've shut off the machine Right Quick Like if it did). Moving windows does it. Scrolling windows (by and large) doesn't. I have the feeling I've heard this sort of thing before, when all system fans were on low and such, with other systems — but (again) written it off as observational error. For all the world it's like I'm hearing the CPU working (as opposed to the GPU; note the window scroll thing above) or data being transferred somewhere, but that just seems...unlikely. So what am I hearing? This may seem like a very localized question, but perhaps other silent PC enthusiasts may be interested as well...

    Read the article

  • Determining the required depth and specifications for a server cabinet

    - by Bingu Bingme
    I'm trying to understand the considerations ("why") that go into determining the specifications ("what") for a rackmount server cabinet, in order to determine what sort of rack I should purchase for my home use. Since this is for home use, I won't be following certain best practices (eg. hot/cold aisle, not even air conditioning) and may be willing to sacrifice in various areas in order to reduce cost and footprint - but please advise if there are safety concerns or other considerations to note. The most basic specs for a server cabinet are the dimensions (external width x external depth x usable height). Width: commonly 600mm or 800mm (if the use case requires extra clearance around the sides, such as if there is lots of cabling). In my case and most common cases, I'm going to stick with 600mm. Height: Select a sufficiently tall rack to fit my equipment. But how much may I stuff into it? Eg, if there is a 15U rack, can I really populate it with 15U of servers, or should I leave 1U at top and bottom for air circulation? Depth: Racks commonly have external depth of 600mm (network equipment), 800mm, 1000mm, or even longer. I'm trying to see how to fit into the 800mm depth. With reference to http://www.server-racks.com/rack-mount-depth.html, I'm hoping to have the front and rear posts mounted ~ 28.5" (72cm) apart, which would leave only 8cm for front space and rear space. How much rear space (from rear posts to back of rack) do I really need? I won't use cable management arms, so can I mount a 72cm depth server since the power, KVM, network cables won't take up much depth? My most important equipment are all < 60cm depth (4U chassis) and should comfortably fit within the 800mm cabinet. The rest of the equipment are very old 1U servers that range from 65-72cm depth. I might still want to make further use of them, or I might discard them since they are so old. Even if the 72cm servers cannot be powered on in an 800mm rack, I should be able to use them as 1U shelves. But, what server depth can I expect to be able to operate? Or am I forced to upgrade to 1000mm depth racks in order to use any servers deeper than 60cm? With reference to best practices for HP racks, some other specs and installation considerations: There aren't any minimum recommendations for clearance on the sides of the rack. It is recommended to leave 48" front clearance. The 48" front clearance is based on 32" chassis depth, 13" to extend the rack rails and mate the inner/outer rails, and 3" for movement. If I don't use such rails (eg, use shelves instead), it should be sufficient to leave front clearance of chassis depth + 3". It is recommended to leave 30" rear clearance "to provide space for servicing the rack". I'm planning to back the rack into a corner of the room, and wheel it slightly out when I need to access the rear. If the wheeling plan is ok, I still need to know how much rear clearance is required for air circulation and ventilation purposes. Castor wheels and stabilising feet. Since I'm backing the rack into a corner of the room, I'll only be able to set the stabilising feet on the front corners. Thoughts on safety? The rack that I'm considering has front glass doors with side ventilation slits and fully perforated rear doors. I'm hoping this will be a good balance between temperature and noise (only ventilation slits facing out the front, while the rear is facing the walls). Or is the sound of high-rpm fans going to escape through the front slits anyway and destroy my sanity?

    Read the article

  • How to stop windows resizing when the monitor display channel is turned off / switched to different source

    - by Heartspeace
    Have a new 6870 ati radeon adapter with its drivers set to 1080p 60hz resolution hooked up to a 2008 47" high end Samsung HDMI based TV. However, when the tv is turned to a different hdmi input -(when I come back into windows) somehow Windows decides to resize all the open apps to a lower resolution - including some of the side docked hidden pop-outs. When it resizes those though - it just sticked the pop-outs in the middle of the screen and all the resized windows from the open applications in the top left corner - all of them stacked on top of each other and resized to the smaller resolution. The things that seem to be ok after returning are the icons on the desktop, the taskbar, and the sidebar. Anyone have any knowledge of 1) how this happens 2) why it happens 3) how to stop it from resizing the applications and some of the docked pop-outs (they are not really resized after returning - they are just stuck in the middle of the screen approximately where they would be if the right or bottom sidebar should be if the screen was resized to that lower resolution). My hypothesis is that upon losing HDMI signal - that Windows is told by something (driver, or windows itself) that the resolution to be without a signal being present (noting that HDMI signals and handshakes are two way on HDMI devices. If it loses the signal or the tv is switched to another device - then the display adapter must figure that out and tell Windows or figures it out and designs randomly to change the display size). Any and all help is most appreciated. I asked AMD/ATI - but they said they don't know why or how this is happening. I was hoping that maybe this is THE place that the super users truly go to - those that develop display adapter drivers, or that dive deeply into these areas of windows. If there is better sites or just competing sites - please advise - noting I have already written AMD/ATI. HP Response / Additions 4/7/2011 It is really nice to get your reply Shinrai. (BTW is it proper etiquette on these forums to have a discussion?) Yet 'only one issue' - I am using a single display in this case - so Windows doesn't move application windows to another desktop. Windows (or something) decides to shrink the desktop it currently has and resize all windows to the maximum size of the desktop. As such I would be glad if Windows would just keep the current size of the one desktop that is in operation. I also know that this does NOT happen on monitors connected with DVI. There I have had one and two monitors setup and it doesn't resize those screens at all when disconnecting monitors, turning them off, whatever... they stay solid - everything in place - to such an extent that if you forgot the other monitor is off - you will have troubles finding some windows without using one of the control app utilities. So if I could even get the HDMI handling by Windows (or the display driver) ( 1] which is doing this anyway the display driver or Windows - and 2] where is that other resolution size (1024x768) coming from - its not the smallest and its not the largest?) to be having like DVI - Life would be golden (for this aspect anyway). ** found others with same problem in this thread: http://hardforum.com/showthread.php?t=1507324 Thanks, HP

    Read the article

  • volume group disappeared after xfs_check run

    - by John P
    EDIT** I have a volume group consisting of 5 RAID1 devices grouped together into a lvm and formatted with xfs. The 5th RAID device lost its RAID config (cat /proc/mdstat does not show anything). The two drives are still present (sdj and sdk), but they have no partitions. The LVM appeared to be happily using sdj up until recently. (doing a pvscan showed the first 4 RAID1 devices + /dev/sdj) I removed the LVM from the fstab, rebooted, then ran xfs_check on the LV. It ran for about half an hour, then stopped with an error. I tried rebooting again, and this time when it came up, the logical volume was no longer there. It is now looking for /dev/md5, which is gone (though it had been using /dev/sdj earlier). /dev/sdj was having read errors, but after replacing the SATA cable, those went away, so the drive appears to be fine for now. Can I modify the /etc/lvm/backup/dedvol, change the device to /dev/sdj and do a vgcfgrestore? I could try doing a pvcreate --uuid KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ /dev/sdj to make it recognize it, but I'm afraid that would erase the data on the drive UPDATE: just changing the pv to point to /dev/sdj did not work vgcfgrestore --file /etc/lvm/backup/dedvol dedvol Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Cannot restore Volume Group dedvol with 1 PVs marked as missing. Restore failed. pvscan /dev/sdj: read failed after 0 of 4096 at 0: Input/output error Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. PV /dev/sdd2 VG VolGroup00 lvm2 [74.41 GB / 0 free] PV /dev/md2 VG dedvol lvm2 [931.51 GB / 0 free] PV /dev/md3 VG dedvol lvm2 [931.51 GB / 0 free] PV /dev/md0 VG dedvol lvm2 [931.51 GB / 0 free] PV /dev/md4 VG dedvol lvm2 [931.51 GB / 0 free] PV unknown device VG dedvol lvm2 [1.82 TB / 63.05 GB free] Total: 6 [5.53 TB] / in use: 6 [5.53 TB] / in no VG: 0 [0 ] vgscan Reading all physical volumes. This may take a while... /dev/sdj: read failed after 0 of 4096 at 0: Input/output error /dev/sdj: read failed after 0 of 4096 at 2000398843904: Input/output error Found volume group "VolGroup00" using metadata type lvm2 Found volume group "dedvol" using metadata type lvm2 vgdisplay dedvol --- Volume group --- VG Name dedvol System ID Format lvm2 Metadata Areas 5 Metadata Sequence No 10 VG Access read/write VG Status resizable MAX LV 0 Cur LV 1 Open LV 0 Max PV 0 Cur PV 5 Act PV 5 VG Size 5.46 TB PE Size 4.00 MB Total PE 1430796 Alloc PE / Size 1414656 / 5.40 TB Free PE / Size 16140 / 63.05 GB VG UUID o1U6Ll-5WH8-Pv7Z-Rtc4-1qYp-oiWA-cPD246 dedvol { id = "o1U6Ll-5WH8-Pv7Z-Rtc4-1qYp-oiWA-cPD246" seqno = 10 status = ["RESIZEABLE", "READ", "WRITE"] flags = [] extent_size = 8192 # 4 Megabytes max_lv = 0 max_pv = 0 physical_volumes { pv0 { id = "Msiee7-Zovu-VSJ3-Y2hR-uBVd-6PaT-Ho9v95" device = "/dev/md2" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv1 { id = "ZittCN-0x6L-cOsW-v1v4-atVN-fEWF-e3lqUe" device = "/dev/md3" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv2 { id = "NRNo0w-kgGr-dUxA-mWnl-bU5v-Wld0-XeKVLD" device = "/dev/md0" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv3 { id = "2EfLFr-JcRe-MusW-mfAs-WCct-u4iV-W0pmG3" device = "/dev/md4" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv4 { id = "KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ" device = "/dev/md5" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 3907028992 # 1.81935 Terabytes pe_start = 384 pe_count = 476932 # 1.81935 Terabytes } }

    Read the article

  • Installing EclipseFP on Mac OS X

    - by Dom Kennedy
    I am trying to install EclipseFP. I'm running OS X Mavericks. I've tried following both the official installation instructions and the advice in this answer on SU, but I'm still having the same problem. I can get the plugin itself installed painlessly using Help -> Install New Software..., Bbut when I restart and switch to the Haskell perspective, things start to go wrong. The installation instructions tells me that I should receive a prompt to install BuildWrapper and Scion Browser. I do not receive this prompt. Furthermore, if I create a new Haskell project, my code has no syntax highlighting, and the Hoogle search feature does not appear to do anything. It's clear that the plugin is not set up correctly yet. I've tried running cabal update in Terminal, but this does not change anything. After several attempts going round in circles with this on Eclipse Juno, I uninstalled Eclispe and the Haskell Platform and performed a clean install of Eclipse Luna and the latest Haskell Platform. However, the problems are persisting. I've tried going into Preferences to see if I could sort any of this out manually. I should initially point out that my GHC installation seems to be correctly references under Preferences -> Haskell Implementations Under Haskell -> Helper executables, there are areas for configuring the options of both BuildWrapper and Scion Browser. At present, both are blank. I tried clicking the Install from Hackage... button beside each of them with no success; I receive an error message saying Expected executable <workspace>/.metadata/.plugins/net.sf.eclipsefp.haskell.ui/sandbox/.cabal-sandbox/bin/buildwrapper not found!` (replace buildwrapper for scion-browser and the message is the same) The Eclipse console displays the following exception after doing the above with BuildWrapper: src/Language/Haskell/BuildWrapper/GHCStorage.hs:313:32: Not in scope: data constructor ‘MatchGroup’ cabal.real: Error: some packages failed to install: buildwrapper-0.7.4 failed during the building phase. The exception was: ExitFailure 1 and after doing it for Scion-Browser: zip-archive-0.2.3.4 (reinstall) changes: text-1.1.0.0 -> 0.11.3.1 pandoc-1.12.3.3 (latest: 1.13) -http-conduit (new version) Graphalyze-0.14.1.0 (reinstall) changes: pandoc-1.12.4.2 -> 1.12.3.3, text-1.1.0.0 -> 0.11.3.1 cabal.real: The following packages are likely to be broken by the reinstalls: pandoc-1.12.4.2 unordered-containers-0.2.4.0 aeson-0.7.0.4 scientific-0.2.0.2 case-insensitive-1.1.0.3 HTTP-4000.2.10 Use --force-reinstalls if you want to install anyway. After receiving similar results as the above on previous attempts, I've tried using force-reinstalls and ended up at more dead ends. I am at a loss as to what is wrong and how to solve this. I should point out that my GHC installation appears to be correctly configured under Preferences -> Haskell -> Haskell Implementations. Apologies if any of this information is irrelevant, I'm just not really sure what is important and what isn't at this point. Any help anyone could provide me with would be greatly appreciated.

    Read the article

  • C#: System.Collections.Concurrent.ConcurrentQueue vs. Queue

    - by James Michael Hare
    I love new toys, so of course when .NET 4.0 came out I felt like the proverbial kid in the candy store!  Now, some people get all excited about the IDE and it’s new features or about changes to WPF and Silver Light and yes, those are all very fine and grand.  But me, I get all excited about things that tend to affect my life on the backside of development.  That’s why when I heard there were going to be concurrent container implementations in the latest version of .NET I was salivating like Pavlov’s dog at the dinner bell. They seem so simple, really, that one could easily overlook them.  Essentially they are implementations of containers (many that mirror the generic collections, others are new) that have either been optimized with very efficient, limited, or no locking but are still completely thread safe -- and I just had to see what kind of an improvement that would translate into. Since part of my job as a solutions architect here where I work is to help design, develop, and maintain the systems that process tons of requests each second, the thought of extremely efficient thread-safe containers was extremely appealing.  Of course, they also rolled out a whole parallel development framework which I won’t get into in this post but will cover bits and pieces of as time goes by. This time, I was mainly curious as to how well these new concurrent containers would perform compared to areas in our code where we manually synchronize them using lock or some other mechanism.  So I set about to run a processing test with a series of producers and consumers that would be either processing a traditional System.Collections.Generic.Queue or a System.Collection.Concurrent.ConcurrentQueue. Now, I wanted to keep the code as common as possible to make sure that the only variance was the container, so I created a test Producer and a test Consumer.  The test Producer takes an Action<string> delegate which is responsible for taking a string and placing it on whichever queue we’re testing in a thread-safe manner: 1: internal class Producer 2: { 3: public int Iterations { get; set; } 4: public Action<string> ProduceDelegate { get; set; } 5: 6: public void Produce() 7: { 8: for (int i = 0; i < Iterations; i++) 9: { 10: ProduceDelegate(“Hello”); 11: } 12: } 13: } Then likewise, I created a consumer that took a Func<string> that would read from whichever queue we’re testing and return either the string if data exists or null if not.  Then, if the item doesn’t exist, it will do a 10 ms wait before testing again.  Once all the producers are done and join the main thread, a flag will be set in each of the consumers to tell them once the queue is empty they can shut down since no other data is coming: 1: internal class Consumer 2: { 3: public Func<string> ConsumeDelegate { get; set; } 4: public bool HaltWhenEmpty { get; set; } 5: 6: public void Consume() 7: { 8: bool processing = true; 9: 10: while (processing) 11: { 12: string result = ConsumeDelegate(); 13: 14: if(result == null) 15: { 16: if (HaltWhenEmpty) 17: { 18: processing = false; 19: } 20: else 21: { 22: Thread.Sleep(TimeSpan.FromMilliseconds(10)); 23: } 24: } 25: else 26: { 27: DoWork(); // do something non-trivial so consumers lag behind a bit 28: } 29: } 30: } 31: } Okay, now that we’ve done that, we can launch threads of varying numbers using lambdas for each different method of production/consumption.  First let's look at the lambdas for a typical System.Collections.Generics.Queue with locking: 1: // lambda for putting to typical Queue with locking... 2: var productionDelegate = s => 3: { 4: lock (_mutex) 5: { 6: _mutexQueue.Enqueue(s); 7: } 8: }; 9:  10: // and lambda for typical getting from Queue with locking... 11: var consumptionDelegate = () => 12: { 13: lock (_mutex) 14: { 15: if (_mutexQueue.Count > 0) 16: { 17: return _mutexQueue.Dequeue(); 18: } 19: } 20: return null; 21: }; Nothing new or interesting here.  Just typical locks on an internal object instance.  Now let's look at using a ConcurrentQueue from the System.Collections.Concurrent library: 1: // lambda for putting to a ConcurrentQueue, notice it needs no locking! 2: var productionDelegate = s => 3: { 4: _concurrentQueue.Enqueue(s); 5: }; 6:  7: // lambda for getting from a ConcurrentQueue, once again, no locking required. 8: var consumptionDelegate = () => 9: { 10: string s; 11: return _concurrentQueue.TryDequeue(out s) ? s : null; 12: }; So I pass each of these lambdas and the number of producer and consumers threads to launch and take a look at the timing results.  Basically I’m timing from the time all threads start and begin producing/consuming to the time that all threads rejoin.  I won't bore you with the test code, basically it just launches code that creates the producers and consumers and launches them in their own threads, then waits for them all to rejoin.  The following are the timings from the start of all threads to the Join() on all threads completing.  The producers create 10,000,000 items evenly between themselves and then when all producers are done they trigger the consumers to stop once the queue is empty. These are the results in milliseconds from the ordinary Queue with locking: 1: Consumers Producers 1 2 3 Time (ms) 2: ---------- ---------- ------ ------ ------ --------- 3: 1 1 4284 5153 4226 4554.33 4: 10 10 4044 3831 5010 4295.00 5: 100 100 5497 5378 5612 5495.67 6: 1000 1000 24234 25409 27160 25601.00 And the following are the results in milliseconds from the ConcurrentQueue with no locking necessary: 1: Consumers Producers 1 2 3 Time (ms) 2: ---------- ---------- ------ ------ ------ --------- 3: 1 1 3647 3643 3718 3669.33 4: 10 10 2311 2136 2142 2196.33 5: 100 100 2480 2416 2190 2362.00 6: 1000 1000 7289 6897 7061 7082.33 Note that even though obviously 2000 threads is quite extreme, the concurrent queue actually scales really well, whereas the traditional queue with simple locking scales much more poorly. I love the new concurrent collections, they look so much simpler without littering your code with the locking logic, and they perform much better.  All in all, a great new toy to add to your arsenal of multi-threaded processing!

    Read the article

  • Our Look at Opera 10.50 Web Browser

    - by Asian Angel
    Everyone has been talking about the newest version of Opera recently but perhaps you have not looked at it too closely yet. Today we will take a look at 10.50 and let you see what this “new browser” is all about. The New Engines Carakan JavaScript Engine: Runs web applications up to 7 times faster than its predecessor Futhark Vega Graphics Library: Enables super fast and smooth graphics on everything from tab switching to webpage animation Presto 2.5: Provides support for HTML5, CSS2.1 and the latest CSS3 standards A Look at the Features Available If you have installed or used older versions of Opera before then the default look after a clean install will probably seem rather different. The main differences in appearance are mainly located within the “glass border” areas of the browser. The “Speed Dial” setup looks and works just as well as in previous versions. You can set a favorite wallpaper or image as your background and choose the number of “dials” using the “Configure Speed Dial Command”. One of the “standout” differences is the “O Button”. All of the menus have been condensed into this single access point but it only takes a few moments to find what you are looking for. If you have used the style before in earlier versions of Opera some of the items have been moved around. For those who prefer the “Menu Bar” that can be easily restored using the “Show Menu Bar Command”. If desired you can actually “extend” the “Tab Bar” downwards to display thumbnails of your open tabs. Just use your mouse to grab the bottom of the “Tab Bar” and adjust it to suit your personal needs. The only problem with this feature is that it will quickly use up a good sized portion of your available UI and browser window space. The “Password Manager” is ready to access when needed…the background for the button will turn a shiny metallic blue when you open a webpage that you have “Login Information” saved for. One of the new features is a small “Recycle Bin Button” in the upper right corner. Clicking on this will display a list of recently closed tabs letting you have easy access to any tabs that you may have accidentally closed. This is definitely a great feature to have as an easy access button. For those who were used to how the “Zoom Feature” looked before it has a new “look” to it. Instead of the pop-up menu-type listing of “view sizes” present before you now have a slider button that you can use to adjust the zooming level. For our default setup here the “Sidebar Panels” available were: “Bookmarks, Widgets, Unite, Notes, Downloads, History, & Panels”. Additional panels such as “Links, Windows, Search, Info, etc.” are available if you want and/or need them (accessible using the “Panels Plus Sign Button”). The “Opera Link Button” makes it easy for you to synchronize your “Speed Dial, Bookmarks, Personal Bar, Custom Searches, History & Notes”. Note: “Opera Link” requires an account and can be signed up for using the link provided below. Want to share files with your family and friends? “Unite” allows you to do that and more. With “Unite” you can: “Stream Music, Show Photo Galleries, Share Files and/or Folders, & host webpages directly from your browser”. We have a more in-depth look at “Unite” in our article here. Note: Use of “Unite” requires an Opera account. Got a slow internet connection? “Opera Turbo” can help with that by running the web traffic through their “compression servers” to speed up your web browsing. Keep in mind that “Opera Turbo” will not engage if you are accessing a secure website (i.e. your bank’s website) thus preserving your security. Note: “Opera Turbo” can be set up to automatically detect slow internet connections (i.e. crowded Wi-Fi in a cafe). Opera has a built-in “Private Browsing Mode” now for those who prefer anonymous browsing and want to keep the “history records clean” on their computer. To access it go to “Tabs and windows” and select “New private tab” or “New private window” as desired. When you open your new “Private Tab or Window” you will see the following message with details on how Opera will handle browsing information and a large “door hanger symbol”. Notice that the one tab is locked into “Private Browsing Mode” while the others are still working in “Regular Browsing Mode”. Very nice! A miniature version of the “door hanger symbol” will be present on any tab that is locked into “Private Browsing Mode”. If you are using Windows 7 then you will love how things look from your “Taskbar”. Here you can see four very nice looking thumbnails for the tabs that we had open. All that you have to do is click on the desired thumbnail… The “Context Menu” looks just as lovely as the thumbnails and definitely has some terrific functionality built into it. Add Enhanced Aero Capability If you love “Aero” and want more for your new Opera install then we have the perfect theme for you. The theme’s name is Z1-AV69 and once you have downloaded it you will need to place it in the “Skins Subfolder” in Opera’s “Program Files Folder”. Note: For our example we used version 1.10 but version 2.00 is now available (link provided below). Once you have restarted Opera, go to the “O Menu” and select “Appearance”. When the “Appearance Window” opens click on “Z1-Glass Skin” and then click “OK”. All of a sudden you will have more “Aero Goodness” to enjoy. Compare this screenshot with the one at the top of this article…the only part that is not transparent now is the browser window area itself. Want even more “Aero Goodness”? Right click on the “Tab Bar” and set “Tab Bar Placement” to “Left”. Note: You can achieve the same effect by setting the “Tab Bar Placement” to “Right”. With the “Speed Dial” visible you will be able to see your wallpaper with ease. While this is obviously not for everyone it does make for a great visual trick. Portable Versions Perhaps you need this wonderful new version of Opera to go with you wherever you do during the day. Not a problem…just visit the Opera USB website to choose a version that works best for you. You can select from “Zip or Exe” setup files and if needed update an older portable version using a “Zipped Update Files Package”. If you are updating an older version keep in mind that you will need to delete the old “OperaUSB.exe. File” due to changes with the new setup files. During our tests updating older portable versions went well for the most part but we did experience a few “odd UI quirks” here and there…so we recommend setting up a clean install if possible. Conclusion The new 10.50 release is a pleasure to use and is a recommended install for your system. Whether you are considering trying Opera for the first time or have been using it for a bit we think that you will pleased with everything that the 10.50 release has to offer. For those who would like to add User Scripts to Opera be certain to look at our how-to article here. Links Download Opera 10.50 for your location (Windows) Get the latest Snapshot versions for Linux & Mac Sign up for an Opera Link account View In-Depth detail on Opera 10.50’s features Download the Z1-AV69 Aero Theme Download Portable Opera 10.50 Similar Articles Productive Geek Tips Set the Speed Dial as the Opera Startup PageSet Up User Scripts in Opera BrowserScan Files for Viruses Before You Download With Dr.WebTurn Your Computer into a File, Music, and Web Server with Opera UniteSet the Default Browser on Ubuntu From the Command Line TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 PCmover Professional Make your Joomla & Drupal Sites Mobile with OSMOBI Integrate Twitter and Delicious and Make Life Easier Design Your Web Pages Using the Golden Ratio Worldwide Growth of the Internet How to Find Your Mac Address Use My TextTools to Edit and Organize Text

    Read the article

  • 17 new features in Visual Studio 2010

    - by vik20000in
    Visual studio 2010 has been released to RTM a few days back. This release of Visual studio 2010 comes with a big number of improvements on many fronts. In this post I will try and point out some of the major improvements in Visual Studio 2010. 1)      Visual studio IDE Improvement. Visual studio IDE has been rewritten in WPF. The look and feel of the studio has been improved for improved readability. Start page has been redesigned and template so that anyone can change the start page as they wish. 2)      Multiple Monitor - Support for Multiple Monitor was already there in Visual studio. But in this edition it has been improved as much that we can now place the document, design and code window outside the IDE in another monitor. 3)      ZOOM in Code Editor – Making the editors in WPF has made significant improvement for them. The best one that I like is the ZOOM feature. We can now zoom in the code editor with the help of the ctrl + Mouse scroll. The zoom feature does not work on the Design surface or windows with icon like solution view and toolbox. 4)      Box Selection - Another Important improvement in the Visual studio 2010 is the box selection. We can select a rectangular by holding down the Alt Key and selecting with mouse.  Now in the rectangular selection we can insert text, Paste same code in different line etc. This is helpful if you want to convert a number of variables from public to private etc… 5)      New Improved Search – One of the best productivity improvements in Visual studio 2010 is its new search as you type support. This has been done in the Navigate To window which can be brought up by pressing (Ctrl + ,). The navigate To windows also take help of the Camel casing and will be able to search with the help of camel casing when character is entered in upper case. For example we can search AOH for AddOrederHeader. 6)      Call Hierarchy – This feature is only available to the Visual C# and Visual C++ editor. The call hierarchy windows displays the calls made to and from (yes both to and from) a selected method property or a constructor. The call hierarchy also shows the implementation of interface and the overrides of virtual or abstract methods. This window is very helpful in understanding the code flow, and evaluating the effect of making changes. The best part is it is available at design time and not at runtime only like a debugger. 7)      Highlighting references – One of the very cool stuff in Visual Studio 2010 is the fact if you select a variable then all the use of that variable will be highlighted alongside. This should work for all the result of symbols returned by Find all reference. This also works for Name of class, objects variable, properties and methods. We can also use the Ctrl + Shift + Down Arrow or Up Arror to move through them. 8)      Generate from usage - The Generate from usage feature lets you use classes and members before you define them. You can generate a stub for any undefined class, constructor, method, property, field, or enum that you want to use but have not yet defined. You can generate new types and members without leaving your current location in code, This minimizes interruption to your workflow.9)      IntelliSense Suggestion Mode - IntelliSense now provides two alternatives for IntelliSense statement completion, completion mode and suggestion mode. Use suggestion mode for situations where classes and members are used before they are defined. In suggestion mode, when you type in the editor and then commit the entry, the text you typed is inserted into the code. When you commit an entry in completion mode, the editor shows the entry that is highlighted on the members list. When an IntelliSense window is open, you can press CTRL+ALT+SPACEBAR to toggle between completion mode and suggestion mode. 10)   Application Lifecycle Management – A client application for management of application lifecycle like version control, work item tracking, build automation, team portal etc is available for free (this is not available for express edition.). 11)   Start Page – The start page has been redesigned with WPF for new functionality and look. Tabbed areas are provided for content from different source including MSDN. Once you open some project the start page closes automatically. The list of recent project also lets you remove project from the list. And above all the start page is customizable enough to be changed as per individual requirement. 12)   Extension Manager – Visual Studio 2010 has provided good ways to be extended. We can also use MEF to extend most of the features of Visual Studio. The new extension manager now can go the visual studio gallery and install the extension without even opening any explorer. 13)   Code snippets – Visual studio 2010 for HTML, Jscript and Asp.net also. 14)   Improved Intelligence for JavaScript has been improved vastly (around 2-5 times). Intelligence now also shows the XML documentation comment on the go. 15)   Web Deployment – Web Deployment has been vastly improved. We can package and publish the web application in one click. Three major supported deployment scenarios are Web packages, one click deployment and Web configuration Transformation. 16)   SharePoint - Visual Studio 2010 also brings vastly improved development experience for SharePoint. We can create, edit, debug, package, deploy and activate SharePoint project from within Visual Studio. Deployment of Site is as easy as hitting F5. 17)   Azure – Visual Studio 2010 also comes with handy improvement for developing on windows Azure environment. Vikram

    Read the article

  • SQL Server 2008 R2 Reporting Services - The Word is But a Stage (T-SQL Tuesday #006)

    - by smisner
    Host Michael Coles (blog|twitter) has selected LOB data as the topic for this month's T-SQL Tuesday, so I'll take this opportunity to post an overview of reporting with spatial data types. As part of my work with SQL Server 2008 R2 Reporting Services, I've been exploring the use of spatial data types in the new map data region. You can create a map using any of the following data sources: Map Gallery - a set of Shapefiles for the United States only that ships with Reporting Services ESRI Shapefile - a .shp file conforming to the Environmental Systems Research Institute, Inc. (ESRI) shapefile spatial data format SQL Server spatial data - a query that includes SQLGeography or SQLGeometry data types Rob Farley (blog|twitter) points out today in his T-SQL Tuesday post that using the SQL geography field is a preferable alternative to ESRI shapefiles for storing spatial data in SQL Server. So how do you get spatial data? If you don't already have a GIS application in-house, you can find a variety of sources. Here are a few to get you started: US Census Bureau Website, http://www.census.gov/geo/www/tiger/ Global Administrative Areas Spatial Database, http://biogeo.berkeley.edu/gadm/ Digital Chart of the World Data Server, http://www.maproom.psu.edu/dcw/ In a recent post by Pinal Dave (blog|twitter), you can find a link to free shapefiles for download and a tutorial for using Shape2SQL, a free tool to convert shapefiles into SQL Server data. In my post today, I'll show you how to use combine spatial data that describes boundaries with spatial data in AdventureWorks2008R2 that identifies stores locations to embed a map in a report. Preparing the spatial data First, I downloaded Shapefile data for the administrative boundaries in France and unzipped the data to a local folder. Then I used Shape2SQL to upload the data into a SQL Server database called Spatial. I'm not sure of the reason why, but I had to uncheck the option to create a spatial index to upload the data. Otherwise, the upload appeared to run successfully, but no table appeared in my database. The zip file that I downloaded contained three files, but I didn't know what was in them until I used Shape2SQL to upload the data into tables. Then I found that FRA_adm0 contains spatial data for the country of France, FRA_adm1 contains spatial data for each region, and FRA_adm2 contains spatial data for each department (a subdivision of region). Next I prepared my SQL query containing sales data for fictional stores selling Adventure Works products in France. The Person.Address table in the AdventureWorks2008R2 database (which you can download from Codeplex) contains a SpatialLocation column which I joined - along with several other tables - to the Sales.Customer and Sales.Store tables. I'll be able to superimpose this data on a map to see where these stores are located. I included the SQL script for this query (as well as the spatial data for France) in the downloadable project that I created for this post. Step 1: Using the Map Wizard to Create a Map of France You can build a map without using the wizard, but I find it's rather useful in this case. Whether you use Business Intelligence Development Studio (BIDS) or Report Builder 3.0, the map wizard is the same. I used BIDS so that I could create a project that includes all the files related to this post. To get started, I added an empty report template to the project and named it France Stores. Then I opened the Toolbox window and dragged the Map item to the report body which starts the wizard. Here are the steps to perform to create a map of France: On the Choose a source of spatial data page of the wizard, select SQL Server spatial query, and click Next. On the Choose a dataset with SQL Server spatial data page, select Add a new dataset with SQL Server spatial data. On the Choose a connection to a SQL Server spatial data source page, select New. In the Data Source Properties dialog box, on the General page, add a connecton string like this (changing your server name if necessary): Data Source=(local);Initial Catalog=Spatial Click OK and then click Next. On the Design a query page, add a query for the country shape, like this: select * from fra_adm1 Click Next. The map wizard reads the spatial data and renders it for you on the Choose spatial data and map view options page, as shown below. You have the option to add a Bing Maps layer which shows surrounding countries. Depending on the type of Bing Maps layer that you choose to add (from Road, Aerial, or Hybrid) and the zoom percentage you select, you can view city names and roads and various boundaries. To keep from cluttering my map, I'm going to omit the Bing Maps layer in this example, but I do recommend that you experiment with this feature. It's a nice integration feature. Use the + or - button to rexize the map as needed. (I used the + button to increase the size of the map until its edges were just inside the boundaries of the visible map area (which is called the viewport). You can eliminate the color scale and distance scale boxes that appear in the map area later. Select the Embed map data in this report for faster rendering. The spatial data won't be changing, so there's no need to leave it in the database. However, it does increase the size of the RDL. Click Next. On the Choose map visualization page, select Basic Map. We'll add data for visualization later. For now, we have just the outline of France to serve as the foundation layer for our map. Click Next, and then click Finish. Now click the color scale box in the lower left corner of the map, and press the Delete key to remove it. Then repeat to remove the distance scale box in the lower right corner of the map. Step 2: Add a Map Layer to an Existing Map The map data region allows you to add multiple layers. Each layer is associated with a different data set. Thus far, we have the spatial data that defines the regional boundaries in the first map layer. Now I'll add in another layer for the store locations by following these steps: If the Map Layers windows is not visible, click the report body, and then click twice anywhere on the map data region to display it. Click on the New Layer Wizard button in the Map layers window. And then we start over again with the process by choosing a spatial data source. Select SQL Server spatial query, and click Next. Select Add a new dataset with SQL Server spatial data, and click Next. Click New, add a connection string to the AdventureWorks2008R2 database, and click Next. Add a query with spatial data (like the one I included in the downloadable project), and click Next. The location data now appears as another layer on top of the regional map created earlier. Use the + button to resize the map again to fill as much of the viewport as possible without cutting off edges of the map. You might need to drag the map within the viewport to center it properly. Select Embed map data in this report, and click Next. On the Choose map visualization page, select Basic Marker Map, and click Next. On the Choose color theme and data visualization page, in the Marker drop-down list, change the marker to diamond. There's no particular reason for a diamond; I think it stands out a little better than a circle on this map. Clear the Single color map checkbox as another way to distinguish the markers from the map. You can of course create an analytical map instead, which would change the size and/or color of the markers according to criteria that you specify, such as sales volume of each store, but I'll save that exploration for another post on another day. Click Finish and then click Preview to see the rendered report. Et voilà...c'est fini. Yes, it's a very simple map at this point, but there are many other things you can do to enhance the map. I'll create a series of posts to explore the possibilities. Share this post: email it! | bookmark it! | digg it! | reddit! | kick it! | live it!

    Read the article

  • ¿Es más barato desarrollar a medida que adquirir un ERP?

    - by Luis Alberto Quilez
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} La clave está en el tiempo. Cuando abordamos un desarrollo a medida, estamos pensando únicamente en las necesidades de hoy. Tenemos un proyecto concreto, un determinado alcance funcional y conocemos las herramientas que hoy tenemos disponibles. Somos los que mejor conocemos nuestra empresa de hoy, sus procesos y el desarrollo parece una buena opción, pues las licencias de las herramientas de desarrollo son económicas y el coste de la tarifa diaria de programación es asequible, y entonces, caemos en la trampa del corto plazo y vamos adelante. Es muy posible que este desarrollo salga bien, que estemos orgullosos de nuestro trabajo, e incluso que proclamemos a los 4 vientos el dinero que nos hemos ahorrado. Sin embargo el mundo no se para, el negocio no se para, la adaptación debe ser permanente, nuestros clientes, internos y externos, tendrán nuevas exigencias y nuestro desarrollo no estará terminado, tendremos que integrarlo con otras áreas, tendremos que tratar de darle mayor funcionalidad y alcance, tendremos que adaptarlo a las nuevas tecnologías, permitir que la información se analice, se comparta, se acceda desde nuevos dispositivos … y veremos en primera persona cómo la trampa del desarrollo se cierra sobre nuestras cabezas, nunca estará terminado, la tecnología que usamos un día se quedará obsoleta, el ritmo de exigencia por funcionalidad e integración será cada vez mayor y no podremos sino poner más y más recursos dedicados al mantenimiento de un desarrollo propio, que no deja de comer, que me obliga a gastar más y más cada día y del que no puedo salir. Al poco tiempo me he convertido en una empresa de desarrollo de software dentro de mi propia empresa y ni tengo los recursos económicos para hacerlo viable, ni tengo las capacidades humanas y de inversión para responder a lo que se me exige desde el negocio. Así que pensemos, desde el principio, en que nuestra empresa debe perdurar muchos años, y hagamos el análisis de costes bajo esta perspectiva a la hora de tomar la decisión y veremos entonces que la adquisición de un ERP es mucho más económica que el desarrollo a medida. Por otro lado tenemos la integración. Un sistema de producción, requiere la asignación de recursos, que a su vez requieren de un plan de desarrollo, una formación o un cálculo de su nómina; también requiere de una cuenta contable, de una gestión de compras o de una asignación de costes y claro,de todos estos puntos nos vamos dando cuenta sobre la marcha, cuando en un sistema de gestión integral (ERP) lo tenemos disponible desde el primer momento. Claro que no nos vale un ERP cerrado, poco flexible y que no me permita diferenciar a mi empresa. Tenemos que buscar un socio tecnológico que nos acompañe, que asuma la inversión en tecnología y que me vaya suministrando versiones y soluciones acordes a las exigencias de los tiempos, de hoy y de mañana, pero además que me permita adaptar los flujos e innovar en los procesos para que podamos diferenciar nuestra empresa de la competencia, hoy y mañana. Veremos cómo, con la decisión de un ERP, flexible y abierto, los números salen y en el largo plazo es mucho más económica la decisión de adquirir un ERP que de optar por el desarrollo. Luis Alberto Quilez v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • Learning AngularJS by Example – The Customer Manager Application

    - by dwahlin
    I’m always tinkering around with different ideas and toward the beginning of 2013 decided to build a sample application using AngularJS that I call Customer Manager. It’s not exactly the most creative name or concept, but I wanted to build something that highlighted a lot of the different features offered by AngularJS and how they could be used together to build a full-featured app. One of the goals of the application was to ensure that it was approachable by people new to Angular since I’ve never found overly complex applications great for learning new concepts. The application initially started out small and was used in my AngularJS in 60-ish Minutes video on YouTube but has gradually had more and more features added to it and will continue to be enhanced over time. It’ll be used in a new “end-to-end” training course my company is working on for AngularjS as well as in some video courses that will be coming out. Here’s a quick look at what the application home page looks like: In this post I’m going to provide an overview about how the application is organized, back-end options that are available, and some of the features it demonstrates. I’ve already written about some of the features so if you’re interested check out the following posts: Building an AngularJS Modal Service Building a Custom AngularJS Unique Value Directive Using an AngularJS Factory to Interact with a RESTful Service Application Structure The structure of the application is shown to the right. The  homepage is index.html and is located at the root of the application folder. It defines where application views will be loaded using the ng-view directive and includes script references to AngularJS, AngularJS routing and animation scripts, plus a few others located in the Scripts folder and to custom application scripts located in the app folder. The app folder contains all of the key scripts used in the application. There are several techniques that can be used for organizing script files but after experimenting with several of them I decided that I prefer things in folders such as controllers, views, services, etc. Doing that helps me find things a lot faster and allows me to categorize files (such as controllers) by functionality. My recommendation is to go with whatever works best for you. Anyone who says, “You’re doing it wrong!” should be ignored. Contrary to what some people think, there is no “one right way” to organize scripts and other files. As long as the scripts make it down to the client properly (you’ll likely minify and concatenate them anyway to reduce bandwidth and minimize HTTP calls), the way you organize them is completely up to you. Here’s what I ended up doing for this application: Animation code for some custom animations is located in the animations folder. In addition to AngularJS animations (which are defined using CSS in Content/animations.css), it also animates the initial customer data load using a 3rd party script called GreenSock. Controllers are located in the controllers folder. Some of the controllers are placed in subfolders based upon the their functionality while others are placed at the root of the controllers folder since they’re more generic:   The directives folder contains the custom directives created for the application. The filters folder contains the custom filters created for the application that filter city/state and product information. The partials folder contains partial views. This includes things like modal dialogs used in the application. The services folder contains AngularJS factories and services used for various purposes in the application. Most of the scripts in this folder provide data functionality. The views folder contains the different views used in the application. Like the controllers folder, the views are organized into subfolders based on their functionality:   Back-End Services The Customer Manager application (grab it from Github) provides two different options on the back-end including ASP.NET Web API and Node.js. The ASP.NET Web API back-end uses Entity Framework for data access and stores data in SQL Server (LocalDb). The other option on the back-end is Node.js, Express, and MongoDB.   Using the ASP.NET Web API Back-End To run the application using ASP.NET Web API/SQL Server back-end open the .sln file at the root of the project in Visual Studio 2012 or higher (the free Express 2013 for Web version is fine). Press F5 and a browser will automatically launch and display the application. Using the Node.js Back-End To run the application using the Node.js/MongoDB back-end follow these steps: In the CustomerManager directory execute 'npm install' to install Express, MongoDB and Mongoose (package.json). Load sample data into MongoDB by performing the following steps: Execute 'mongod' to start the MongoDB daemon Navigate to the CustomerManager directory (the one that has initMongoCustData.js in it) then execute 'mongo' to start the MongoDB shell Enter the following in the mongo shell to load the seed files that handle seeding the database with initial data: use custmgr load("initMongoCustData.js") load("initMongoSettingsData.js") load("initMongoStateData.js") Start the Node/Express server by navigating to the CustomerManager/server directory and executing 'node app.js' View the application at http://localhost:3000 in your browser. Key Features The Customer Manager application certainly doesn’t cover every feature provided by AngularJS (as mentioned the intent was to keep it as simple as possible) but does provide insight into several key areas: Using factories and services as re-useable data services (see the app/services folder) Creating custom directives (see the app/directives folder) Custom paging (see app/views/customers/customers.html and app/controllers/customers/customersController.js) Custom filters (see app/filters) Showing custom modal dialogs with a re-useable service (see app/services/modalService.js) Making Ajax calls using a factory (see app/services/customersService.js) Using Breeze to retrieve and work with data (see app/services/customersBreezeService.js). Switch the application to use the Breeze factory by opening app/services.config.js and changing the useBreeze property to true. Intercepting HTTP requests to display a custom overlay during Ajax calls (see app/directives/wcOverlay.js) Custom animations using the GreenSock library (see app/animations/listAnimations.js) Creating custom AngularJS animations using CSS (see Content/animations.css) JavaScript patterns for defining controllers, services/factories, directives, filters, and more (see any JavaScript file in the app folder) Card View and List View display of data (see app/views/customers/customers.html and app/controllers/customers/customersController.js) Using AngularJS validation functionality (see app/views/customerEdit.html, app/controllers/customerEditController.js, and app/directives/wcUnique.js) More… Conclusion I’ll be enhancing the application even more over time and welcome contributions as well. Tony Quinn contributed the initial Node.js/MongoDB code which is very cool to have as a back-end option. Access the standard application here and a version that has custom routing in it here. Additional information about the custom routing can be found in this post.

    Read the article

  • The new workflow management of Oracle´s Hyperion Planning: Define more details with Planning Unit Hierarchies and Promotional Paths

    - by Alexandra Georgescu
    After having been almost unchanged for several years, starting with the 11.1.2 release of Oracle´s Hyperion Planning the Process Management has not only got a new name: “Approvals” now is offering the possibility to further split Planning Units (comprised of a unique Scenario-Version-Entity combination) into more detailed combinations along additional secondary dimensions, a so called Planning Unit Hierarchy, and also to pre-define a path of planners, reviewers and approvers, called Promotional Path. I´d like to introduce you to changes and enhancements in this new process management and arouse your curiosity for checking out more details on it. One reason of using the former process management in Planning was to limit data entry rights to one person at a time based on the assignment of a planning unit. So the lowest level of granularity for this assignment was, for a given Scenario-Version combination, the individual entity. Even if in many cases one person wasn´t responsible for all data being entered into that entity, but for only part of it, it was not possible to split the ownership along another additional dimension, for example by assigning ownership to different accounts at the same time. By defining a so called Planning Unit Hierarchy (PUH) in Approvals this gap is now closed. Complementing new Shared Services roles for Planning have been created in order to manage set up and use of Approvals: The Approvals Administrator consisting of the following roles: Approvals Ownership Assigner, who assigns owners and reviewers to planning units for which Write access is assigned (including Planner responsibilities). Approvals Supervisor, who stops and starts planning units and takes any action on planning units for which Write access is assigned. Approvals Process Designer, who can modify planning unit hierarchy secondary dimensions and entity members for which Write access is assigned, can also modify scenarios and versions that are assigned to planning unit hierarchies and can edit validation rules on data forms for which access is assigned. (this includes as well Planner and Ownership Assigner responsibilities) Set up of a Planning Unit Hierarchy is done under the Administration menu, by selecting Approvals, then Planning Unit Hierarchy. Here you create new PUH´s or edit existing ones. The following window displays: After providing a name and an optional description, a pre-selection of entities can be made for which the PUH will be defined. Available options are: All, which pre-selects all entities to be included for the definitions on the subsequent tabs None, manual entity selections will be made subsequently Custom, which offers the selection for an ancestor and the relative generations, that should be included for further definitions. Finally a pattern needs to be selected, which will determine the general flow of ownership: Free-form, uses the flow/assignment of ownerships according to Planning releases prior to 11.1.2 In Bottom-up, data input is done at the leaf member level. Ownership follows the hierarchy of approval along the entity dimension, including refinements using a secondary dimension in the PUH, amended by defined additional reviewers in the promotional path. Distributed, uses data input at the leaf level, while ownership starts at the top level and then is distributed down the organizational hierarchy (entities). After ownership reaches the lower levels, budgets are submitted back to the top through the approval process. Proceeding to the next step, now a secondary dimension and the respective members from that dimension might be selected, in order to create more detailed combinations underneath each entity. After selecting the Dimension and a Parent Member, the definition of a Relative Generation below this member assists in populating the field for Selected Members, while the Count column shows the number of selected members. For refining this list, you might click on the icon right beside the selected member field and use the check-boxes in the appearing list for deselecting members. -------------------------------------------------------------------------------------------------------- TIP: In order to reduce maintenance of the PUH due to changes in the dimensions included (members added, moved or removed) you should consider to dynamically link those dimensions in the PUH with the dimension hierarchies in the planning application. For secondary dimensions this is done using the check-boxes in the Auto Include column. For the primary dimension, the respective selection criteria is applied by right-clicking the name of an entity activated as planning unit, then selecting an item of the shown list of include or exclude options (children, descendants, etc.). Anyway in order to apply dimension changes impacting the PUH a synchronization must be run. If this is really necessary or not is shown on the first screen after selecting from the menu Administration, then Approvals, then Planning Unit Hierarchy: under Synchronized you find the statuses Yes, No or Locked, where the last one indicates, that another user is just changing or synchronizing the PUH. Select one of the not synchronized PUH´s (status No) and click the Synchronize option in order to execute. -------------------------------------------------------------------------------------------------------- In the next step owners and reviewers are assigned to the PUH. Using the icons with the magnifying glass right besides the columns for Owner and Reviewer the respective assignments can be made in the ordermthat you want them to review the planning unit. While it is possible to assign only one owner per entity or combination of entity+ member of the secondary dimension, the selection for reviewers might consist of more than one person. The complete Promotional Path, including the defined owners and reviewers for the entity parents, can be shown by clicking the icon. In addition optional users might be defined for being notified about promotions for a planning unit. -------------------------------------------------------------------------------------------------------- TIP: Reviewers cannot change data, but can only review data according to their data access permissions and reject or promote planning units. -------------------------------------------------------------------------------------------------------- In order to complete your PUH definitions click Finish - this saves the PUH and closes the window. As a final step, before starting the approvals process, you need to assign the PUH to the Scenario-Version combination for which it should be used. From the Administration menu select Approvals, then Scenario and Version Assignment. Expand the PUH in order to see already existing assignments. Under Actions click the add icon and select scenarios and versions to be assigned. If needed, click the remove icon in order to delete entries. After these steps, set up is completed for starting the approvals process. Start, stop and control of the approvals process is now done under the Tools menu, and then Manage Approvals. The new PUH feature is complemented by various additional settings and features; some of them at least should be mentioned here: Export/Import of PUHs: Out of Office agent: Validation Rules changing promotional/approval path if violated (including the use of User-defined Attributes (UDAs)): And various new and helpful reviewer actions with corresponding approval states. About the Author: Bernhard Kinkel started working for Hyperion Solutions as a Presales Consultant and Consultant in 1998 and moved to Hyperion Education Services in 1999. He joined Oracle University in 2007 where he is a Principal Education Consultant. Based on these many years of working with Hyperion products he has detailed product knowledge across several versions. He delivers both classroom and live virtual courses. His areas of expertise are Oracle/Hyperion Essbase, Oracle Hyperion Planning and Hyperion Web Analysis.

    Read the article

  • South Florida Code Camp 2010 &ndash; VI &ndash; 2010-02-27

    - by Dave Noderer
    Catching up after our sixth code camp here in the Ft Lauderdale, FL area. Website at: http://www.fladotnet.com/codecamp. For the 5th time, DeVry University hosted the event which makes everything else really easy! Statistics from 2010 South Florida Code Camp: 848 registered (we use Microsoft Group Events) ~ 600 attended (516 took name badges) 64 speakers (including speaker idol) 72 sessions 12 parallel tracks Food 400 waters 600 sodas 900 cups of coffee (it was cold!) 200 pounds of ice 200 pizza's 10 large salad trays 900 mouse pads Photos on facebook Dave Noderer: http://www.facebook.com/home.php#!/album.php?aid=190812&id=693530361 Joe Healy: http://www.facebook.com/devfish?ref=mf#!/album.php?aid=202787&id=720054950 Will Strohl:http://www.facebook.com/home.php#!/album.php?aid=2045553&id=1046966128&ref=mf Veronica Gonzalez: http://www.facebook.com/home.php#!/album.php?aid=150954&id=672439484 Florida Speaker Idol One of the sessions at code camp was the South Florida Regional speaker idol competition. After user group level competitions there are five competitors. I acted as MC and score keeper while Ed Hill, Bob O’Connell, John Dunagan and Shervin Shakibi were judges. This statewide competition is being run by Roy Lawsen in Lakeland and the winner, Jeff Truman from Naples will move on to the state finals to be held at the Orlando Code Camp on 3/27/2010: http://www.orlandocodecamp.com/. Each speaker has 10 minutes. The participants were: Alex Koval Jeff Truman Jared Nielsen Chris Catto Venkat Narayanasamy They all did a great job and I’m working with each to make sure they don’t stop there and start speaking at meetings. Thanks to everyone involved! Volunteers As always events like this don’t happen without a lot of help! The key people were: Ed Hill, Bob O’Connell – DeVry For the months leading up to the event, Ed collects all of the swag, books, etc and stores them. He holds meeting with various DeVry departments to coordinate the day, he works with the students in the days  before code camp to stuff bags, print signs, arrange tables and visit BJ’s for our supplies (I go and pay but have a small car!). And of course the day of the event he is there at 5:30 am!! We took two SUV’s to BJ’s, i was really worried that the 36 cases of water were going to break his rear axle! He also helps with the students and works very hard before and after the event. Rainer Haberman – Speakers and Volunteer of the Year Rainer has helped over the past couple of years but this time he took full control of arranging the tracks. I did some preliminary work solicitation speakers but he took over all communications after that. We have tried various organizations around speakers, chair per track, central team but having someone paying attention to the details is definitely the way to go! This was the first year I did not have to jump in at the last minute and re-arrange everything. There were lots of kudo’s from the speakers too saying they felt it was more organized than they have experienced in the past from any code camp. Thanks Rainer! Ray Alamonte – Book Swap We saw the idea of a book swap from the Alabama Code Camp and thought we would give it a try. Ray jumped in and took control. The idea was to get people to bring their old technical books to swap or for others to buy. You got a ticket for each book you brought that you could then turn in to buy another book. If you did not have a ticket you could buy a book for $1. Net proceeds were $153 which I rounded up and donated to the Red Cross. There is plenty going on in Haiti and Chile! I don’t think we really got a count of how many books came in. I many cases the books barely hit the table before being picked up again. At the end we were left with a dozen books which we donated to the DeVry library. A great success we will definitely do again! Jace Weiss / Ratchelen Hut – Coffee and Snacks Wow, this was an eye opener. In past years a few of us would struggle to give some attention to coffee, snacks, etc. But it was always tenuous and always ended up running out of coffee. In the past we have tried buying Dunkin Donuts coffee, renting urns, borrowing urns, etc. This year I actually purchased 2 – 100 cup Westbend commercial brewers plus a couple of small urns (30 and 60 cup we used for decaf). We got them both started early (although i forgot to push the on button on one!) and primed it with 10 boxes of Joe from Dunkin. then Jace and Rachelen took over.. once a batch was brewed they would refill the boxes, keep the area clean and at one point were filling cups. We never ran out of coffee and served a few hundred more than last  year. We did look but next year I’ll get a large insulated (like gatorade) dispensing container. It all went very smoothly and having help focused on that one area was a big win. Thanks Jace and Rachelen! Ken & Shirley Golding / Roberta Barbosa – Registration Ken & Shirley showed up and took over registration. This year we printed small name tags for everyone registered which was great because it is much easier to remember someone’s name when they are labeled! In any case it went the smoothest it has ever gone. All three were actively pulling people through the registration, answering questions, directing them to bags and information very quickly. I did not see that there was too big a line at any time. Thanks!! Scott Katarincic / Vishal Shukla – Website For the 3rd?? year in a row, Scott was in charge of the website starting in August or September when I start on code camp. He handles all the requests, makes changes to the site and admin. I think two years ago he wrote all the backend administration and tunes it and the website a bit but things are pretty stable. The only thing I do is put up the sponsors. It is a big pressure off of me!! Thanks Scott! Vishal jumped into the web end this year and created a new Silverlight agenda page to replace the old ajax page. We will continue to enhance this but it is definitely a good step forward! Thanks! Alex Funkhouser – T-shirts/Mouse pads/tables/sponsors Alex helps in many areas. He helps me bring in sponsors and handles all the logistics for t-shirts, sponsor tables and this year the mouse pads. He is also a key person to help promote the event as well not to mention the after after party which I did not attend and don’t want to know much about! Students There were a number of student volunteers but don’t have all of their names. But thanks to them, they stuffed bags, patrolled pizza and helped with moving things around. Sponsors We had a bunch of great sponsors which allowed us to feed people and give a way a lot of great swag. Our major sponsors of DeVry, Microsoft (both DPE and UGSS), Infragistics, Telerik, SQL Share (End to End, SQL Saturdays), and Interclick are very much appreciated. The other sponsors Applied Innovations (also supply code camp hosting), Ultimate Software (a great local SW company), Linxter (reliable cloud messaging we are lucky to have here!), Mediascend (a media startup), SoftwareFX (another local SW company we are happy to have back participating in CC), CozyRoc (if you do SSIS, check them out), Arrow Design (local DNN and Silverlight experts),Boxes and Arrows (a local SW consulting company) and Robert Half. One thing we did this year besides a t-shirt was a mouse pad. I like it because it will be around for a long time on many desks. After much investigation and years of using mouse pad’s I’ve determined that the 1/8” fabric top is the best and that is what we got!   So now I get a break for a few months before starting again!

    Read the article

  • B2B and B2C Commerce are alike… but a little different – Oracle Commerce named Leader in Forrester B2B Commerce Wave

    - by Katrina Gosek
    We weren’t surprised to see Oracle Commerce positioned as a Leader in Forrester’s first Commerce Wave focused on B2B, released earlier this month. The reports validates much of what we’ve heard from our largest customers – the world’s largest distribution, manufacturing and high-tech customers who sell billions of dollars of goods and services to other businesses through their Web channels. More importantly, the report confirms something very important: B2B and B2C Commerce are alike… but a little different. B2B and B2C Commerce are alike… Clearly, B2C experiences have set expectations for B2B. Every B2B buyer is a consumer at home and brings the same expectations to a website selling electronic components, aftermarket parts, or MRO products. Forrester calls these rich consumer-based capabilities that help B2B customers do their jobs “table stakes”: search & navigation, promotions, cross-channel commerce and mobile: “Whether they are just beginning to sell online or are in the late stages of launching a next-generation site, B2B eCommerce operations today must: offer a customer experience standard comparable to what leading b2c sites now offer; address the growing influence that mobile devices are having in the workplace; make a qualitative and quantitative business case that drives sustained investment.” Just five years ago, many of our B2B customers’ online business comprised only 5-10% of their total revenue. Today, when we speak to those same brands, we hear about double and triple digit growth in their online channels. Many have seen the percentage of the business they perform in their web channels cross the 30-50% threshold. You can hear first-hand from several Oracle Commerce B2B customers about the success they are seeing, and what they’re trying to accomplish (Carolina Biological, Premier Farnell, DeliXL, Elsevier). This momentum is likely the reason Forrester broke out the separate B2B Commerce Wave from the B2C Wave. In fact, B2B is becoming the larger force in commerce, expected to collect twice the online dollars of B2C this year ($559 billion). But a little different… Despite the similarities, there is a key and very important difference between B2C and B2B. Unlike a consumer shopping for shoes, a business shopper buying from a distributor or manufacturer is coming to the Web channel as a part of their job. So in addition to a rich, consumer-like experience this shopper expects, these B2B buyers need quoting tools and complex pricing capabilities, like eProcurement, bulk order entry, and other self-service tools such as account, contract and organization management.  Forrester also is emphasizing three additional “back-end” tools and capabilities their clients say they need to drive growth in their B2B online channels: i) product information management (PIM), which provides a single system of record for large part lists and product catalogs; ii) web content management (WCM), needed to manage large volumes of unstructured marketing information, and iii) order management systems (OMS), which manage and orchestrate the complex B2B order life cycle from quote through approval, submission to manufacturing, distribution and delivery.  We would like to expand on each of these 3 areas: As Forrester highlights, back-end PIM is definitely needed by B2B Commerce providers. Most B2B companies have made significant investments in enterprise-grade PIMs, given the importance of product data management for aggregation and syndication of content, product attribution, analytics, and handling of complex workflows. While in principle it may sound appealing to have a PIM as part of a commerce offering (especially for SMBs who have to do more with less), our customers have typically found that PIM in a commerce platform is largely redundant with what they already have in-place, and is not fully-featured or robust enough to handle the complexity of the product data sets that B2B distributors and manufacturers usually handle. To meet the PIM needs for commerce, Oracle offers enterprise PIM (Product Hub/Fusion PIM) and a robust enterprise data quality product (EDQP) integrated with the Oracle Commerce solution. These are key differentiators of our offering and these capabilities are becoming even more tightly integrated with Oracle Commerce over time. For Commerce, what customers really need is a robust product catalog and content management system for enabling business users to further enrich and ready catalog and content data to be presented and sold online.  This has been a significant area of investment in the Oracle Commerce platform , which continue to get stronger. We see this combination of capabilities as best meeting the needs of our customers for a commerce platform without adding a largely redundant, less functional PIM in the commerce front-end.   On the topic of web content management, we were pleased to see Forrester recognize Oracle’s unique functional capabilities in this area and the “unique opportunity in the market to lead the convergence of commerce and content management with the amalgamation of Oracle Commerce with WebCenter Sites (formally FatWire).” Strong content management capabilities are critical for distributors and manufacturers who are frequently serving an engineering audience coming to their websites to conduct product research in search of technical data sheets, drawings, videos and more. The convergence of content, commerce, and experience is critical for B2B brands selling online. Regarding order management, Forrester notes that many businesses use their existing back-end enterprise resource planning (ERP) systems to manage order life cycles.  We hear the same from most of our B2B customers, as they already have an ERP system—if not several of them—and are not interested in yet another one.  So what do we take away from the Wave results? Forrester notes that the Oracle Commerce Platform “has always had strong B2B commerce capabilities and Oracle has an exhaustive list of B2B customers using the solution.”  What makes us excited about developing leading B2B solutions are the close relationships with our customers and the clear opportunity in the market – which we’ll address in an exciting new release in the coming months. Oracle has one of the world’s largest B2B customer bases, providing leading solutions across key business-to-business functions – from marketing, sales automation, and service to master data management, and ERP.  To learn more about Oracle’s Commerce product vision and strategy, visit our website and check out these other B2B Commerce Resources: - 2013 B2B Commerce Trends Report - B2B Commerce Whitepaper: Consumerization, Complexity, Change - B2B Commerce Webcast: What Industry Trend Setters Do Right - Internet Retailer, Web Drives Sales for B2B Companies - Internet Retailer, The Web Means Business: B2B Companies Beef Up Their Websites, borrowing from b2c retailers and breaking new ground - Internet Retailer, B2B e-Commerce is poised for growth ----------THIS DOCUMENT IS FOR INFORMATIONAL PURPOSES ONLY AND MAY NOT BE INCORPORATED INTO A CONTRACT OR AGREEMENT 

    Read the article

  • So, how is the Oracle HCM Cloud User Experience? In a word, smokin’!

    - by Edith Mireles-Oracle
    By Misha Vaughan, Oracle Applications User Experience Oracle unveiled its game-changing cloud user experience strategy at Oracle OpenWorld 2013 (remember that?) with a new simplified user interface (UI) paradigm.  The Oracle HCM cloud user experience is about light-weight interaction, tailored to the task you are trying to accomplish, on the device you are comfortable working with. A key theme for the Oracle user experience is being able to move from smartphone to tablet to desktop, with all of your data in the cloud. The Oracle HCM Cloud user experience provides designs for better productivity, no matter when and how your employees need to work. Release 8  Oracle recently demonstrated how fast it is moving development forward for our cloud applications, with the availability of release 8.  In release 8, users will see expanded simplicity in the HCM cloud user experience, such as filling out a time card and succession planning. Oracle has also expanded its mobile capabilities with task flows for payslips, managing absences, and advanced analytics. In addition, users will see expanded extensibility with the new structures editor for simplified pages, and the with the user interface text editor, which allows you to update language throughout the UI from one place. If you don’t like calling people who work for you “employees,” you can use this tool to create a term that is suited to your business.  Take a look yourself at what’s available now. What are people saying?Debra Lilley (@debralilley), an Oracle ACE Director who has a long history with Oracle Applications, recently gave her perspective on release 8: “Having had the privilege of seeing a preview of release 8, I am again impressed with the enhancements around simplified UI. Even more so, at a user group event in London this week, an existing Cloud HCM customer speaking publically about his implementation said he was very excited about release 8 as the absence functionality was so superior and simple to use.”  In an interview with Lilley for a blog post by Dennis Howlett  (@dahowlett), we probably couldn’t have asked for a more even-handed look at the Oracle Applications Cloud and the impact of user experience. Take the time to watch all three videos and get the full picture.  In closing, Howlett’s said: “There is always the caveat that getting from the past to Fusion [from the editor: Fusion is now called the Oracle Applications Cloud] is not quite as simple as may be painted, but the outcomes are much better than anticipated in large measure because the user experience is so much better than what went before.” Herman Slange, Technical Manager with Oracle Applications partner Profource, agrees with that comment. “We use on-premise Financials & HCM for internal use. Having a simple user interface that works on a desktop as well as a tablet for (very) non-technical users is a big relief. Coming from E-Business Suite, there is less training (none) required to access HCM content.  From a technical point of view, having the abilities to tailor the simplified UI very easy makes it very efficient for us to adjust to specific customer needs.  When we have a conversation about simplified UI, we just hand over a tablet and ask the customer to just use it. No training and no explanation required.” Finally, in a story by Computer Weekly  about Oracle customer BG Group, a natural gas exploration and production company based in the UK and with a presence in 20 countries, the author states: “The new HR platform has proved to be easier and more intuitive for HR staff to use than the previous SAP-based technology.” What’s Next for Oracle’s Applications Cloud User Experiences? This is the question that Steve Miranda, Oracle Executive Vice President, Applications Development, asks the Applications User Experience team, and we’ve been hard at work for some time now on “what’s next.”  I can’t say too much about it, but I can tell you that we’ve started talking to customers and partners, under non-disclosure agreements, about user experience concepts that we are working on in order to get their feedback. We recently had a chance to talk about possibilities for the Oracle HCM Cloud user experience at an Oracle HCM Southern California Customer Success Summit. This was a fantastic event, hosted by Shane Bliss and Vance Morossi of the Oracle Client Success Team. We got to use the uber-slick facilities of Allergan, our hosts (of Botox fame), headquartered in Irvine, Calif., with a presence in more than 100 countries. Photo by Misha Vaughan, Oracle Applications User Experience Vance Morossi, left, and Shane Bliss, of the Oracle Client Success Team, at an Oracle HCM Southern California Customer Success Summit.  We were treated to a few really excellent talks around human resources (HR). Alice White, VP Human Resources, discussed Allergan's process for global talent acquisition -- how Allergan has designed and deployed a global process, and global tools, along with Oracle and Cognizant, and are now at the end of a global implementation. She shared a couple of insights about the journey for Allergan: “One of the major areas for improvement was on role clarification within the company.” She said the company is “empowering managers and deputizing them as recruiters. Now it is a global process that is nimble and efficient."  Deepak Rammohan, VP Product Management, HCM Cloud, Oracle, also took the stage to talk about pioneering modern HR. He reflected modern HR problems of getting the right data about the workforce, the importance of getting the right talent as a key strategic initiative, and other workforce insights. "How do we design systems to deal with all of this?” he asked. “Make sure the systems are talent-centric. The next piece is collaborative, engaging, and mobile. A lot of this is influenced by what users see today. The last thing is around insight; insight at the point of decision-making." Rammohan showed off some killer HCM Cloud talent demos focused on simplicity and mobility that his team has been cooking up, and closed with a great line about the nature of modern recruiting: "Recruiting is a team sport." Deepak Rammohan, left, and Jake Kuramoto, both of Oracle, debate the merits of a Google Glass concept demo for recruiters on-the-go. Later, in an expo-style format, the Apps UX team showed several concepts for next-generation HCM Cloud user experiences, including demos shown by Jake Kuramoto (@jkuramoto) of The AppsLab, and Aylin Uysal (@aylinuysal), Director, HCM Cloud user experience. We even hauled out our eye-tracker, a research tool used to show where the eye is looking at a particular screen, thanks to teammate Michael LaDuke. Dionne Healy, HCM Client Executive, and Aylin Uysal, Director, HCM Cloud user experiences, Oracle, take a look at new HCM Cloud UX concepts. We closed the day with Jeremy Ashley (@jrwashley), VP, Applications User Experience, who brought it all back together by talking about the big picture for applications cloud user experiences. He covered the trends we are paying attention to now, what users will be expecting of their modern enterprise apps, and what Oracle’s design strategy is around these ideas.   We closed with an excellent reception hosted by ADP Payroll services at Bistango. Want to read more?Want to see where our cloud user experience is going next? Read more on the UsableApps web site about our latest design initiative: “Glance, Scan, Commit.” Or catch up on the back story by looking over our Applications Cloud user experience content on the UsableApps web site.  You can also find out where we’ll be next at the Events page on UsableApps.

    Read the article

  • Interview with Lenz Grimmer about MySQL Connect

    - by Keith Larson
    Keith Larson: Thank you for allowing me to do this interview with you.  I have been talking with a few different Oracle ACEs   about the MySQL Connect Conference. I figured the MySQL community might be missing you as well. You have been very busy with Oracle Linux but I know you still have an eye on the MySQL Community. How have things been?Lenz Grimmer: Thanks for including me in this series of interviews, I feel honored! I've read the other interviews, and really liked them. I still try to follow what's going on over in the MySQL community and it's good to see that many of the familiar faces are still around. Over the course of the 9 years that I was involved with MySQL, many colleagues and contacts turned into good friends and we still maintain close relationships.It's been almost 1.5 years ago that I moved into my new role here in the Linux team at Oracle, and I really enjoy working on a Linux distribution again (I worked for SUSE before I joined MySQL AB in 2002). I'm still learning a lot - Linux in the data center has greatly evolved in so many ways and there are a lot of new and exciting technologies to explore. Keith Larson: What were your thoughts when you heard that Oracle was going to deliver the MySQL Connect conference to the MySQL Community?Lenz Grimmer: I think it's testament to the fact that Oracle deeply cares about MySQL, despite what many skeptics may say. What started as "MySQL Sunday" two years ago has now evolved into a full-blown sub-conference, with 80 sessions at one of the largest corporate IT events in the world. I find this quite telling, not many products at Oracle enjoy this level of exposure! So it certainly makes me feel proud to see how far MySQL has come. Keith Larson: Have you had a chance to look over the sessions? What are your thoughts on them?Lenz Grimmer: I did indeed look at the final schedule.The content committee did a great job with selecting these sessions. I'm glad to see that the content selection was influenced by involving well-known and respected members of the MySQL community. The sessions cover a broad range of topics and technologies, both covering established topics as well as recent developments. Keith Larson: When you get a chance, what sessions do you plan on attending?Lenz Grimmer: I will actually be manning the Oracle booth in the exhibition area on one of these days, so I'm not sure if I'll have a lot of time attending sessions. But if I do, I'd love to see the keynotes and catch some of the sessions that talk about recent developments and new features in MySQL, High Availability and Clustering . Quite a lot has happened and it's hard to keep up with this constant flow of new MySQL releases.In particular, the following sessions caught my attention: MySQL Connect Keynote: The State of the Dolphin Evaluating MySQL High-Availability Alternatives CERN’s MySQL “as a Service” Deployment with Oracle VM: Empowering Users MySQL 5.6 Replication: Taking Scalability and High Availability to the Next Level What’s New in MySQL Server 5.6? MySQL Security: Past and Present MySQL at Twitter: Development and Deployment MySQL Community BOF MySQL Connect Keynote: MySQL Perspectives Keith Larson: So I will ask you just like I have asked the others I have interviewed, any tips that you would give to people for handling the long hours at conferences?Lenz Grimmer: Wear comfortable shoes and make sure to drink a lot! Also prepare a plan of the sessions you would like to attend beforehand and familiarize yourself with the venue, so you can get to the next talk in time without scrambling to find the location. The good thing about piggybacking on such a large conference like Oracle OpenWorld is that you benefit from the whole infrastructure. For example, there is a nice schedule builder that helps you to keep track of your sessions of interest. Other than that, bring enough business cards and talk to people, build up your network among your peers and other MySQL professionals! Keith Larson: What features of the MySQL 5.6 release do you look forward to the most ?Lenz Grimmer: There has been solid progress in so many areas like the InnoDB Storage Engine, the Optimizer, Replication or Performance Schema, it's hard for me to really highlight anything in particular. All in all, MySQL 5.6 sounds like a very promising release. I'm confident it will follow the tradition that Oracle already established with MySQL 5.5, which received a lot of praise even from very critical members of the MySQL community. If I had to name a single feature, I'm particularly and personally happy that the precise GIS functions have finally made it into a GA release - that was long overdue. Keith Larson:  In your opinion what is the best reason for someone to attend this event?Lenz Grimmer: This conference is an excellent opportunity to get in touch with the key people in the MySQL community and ecosystem and to get facts and information from the domain experts and developers that work on MySQL. The broad range of topics should attract people from a variety of roles and relations to MySQL, beginning with Developers and DBAs, to CIOs considering MySQL as a viable solution for their requirements. Keith Larson: You will be attending MySQL Connect and have some Oracle Linux Demos, do you see a growing demand for MySQL on Oracle Linux ?Lenz Grimmer: Yes! Oracle Linux is our recommended Linux distribution and we have a good relationship to the MySQL engineering group. They use Oracle Linux as a base Linux platform for development and QA, so we make sure that MySQL and Oracle Linux are well tested together. Setting up a MySQL server on Oracle Linux can be done very quickly, and many customers recognize the benefits of using them both in combination.Because Oracle Linux is available for free (including free bug fixes and errata), it's an ideal choice for running MySQL in your data center. You can run the same Linux distribution on both your development/staging systems as well as on the production machines, you decide which of these should be covered by a support subscription and at which level of support. This gives you flexibility and provides some really attractive cost-saving opportunities. Keith Larson: Since I am a Linux user and fan, what is on the horizon for  Oracle Linux?Lenz Grimmer: We're working hard on broadening the ecosystem around Oracle Linux, building up partnerships with ISVs and IHVs to certify Oracle Linux as a fully supported platform for their products. We also continue to collaborate closely with the Linux kernel community on various projects, to make sure that Linux scales and performs well on large systems and meets the demands of today's data centers. These improvements and enhancements will then rolled into the Unbreakable Enterprise Kernel, which is the key ingredient that sets Oracle Linux apart from other distributions. We also have a number of ongoing projects which are making good progress, and I'm sure you'll hear more about this at the upcoming OpenWorld conference :) Keith Larson: What is something that more people should be aware of when it comes to Oracle Linux and MySQL ?Lenz Grimmer: Many people assume that Oracle Linux is just tuned for Oracle products, such as the Oracle Database or our Engineered Systems. While it's of course true that we do a lot of testing and optimization for these workloads, Oracle Linux is and will remain a general-purpose Linux distribution that is a very good foundation for setting up a LAMP-Stack, for example. We also provide MySQL RPM packages for Oracle Linux, so you can easily stay up to date if you need something newer than what's included in the stock distribution.One more thing that is really unique to Oracle Linux is Ksplice, which allows you to apply security patches to the running Linux kernel, without having to reboot. This ensures that your MySQL database server keeps up and running and is not affected by any downtime. Keith Larson: What else would you like to add ?Lenz Grimmer: Thanks again for getting in touch with me, I appreciated the opportunity. I'm looking forward to MySQL Connect and Oracle OpenWorld and to meet you and many other people from the MySQL community that I haven't seen for quite some time! Keith Larson:  Thank you Lenz!

    Read the article

< Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >