Search Results

Search found 18361 results on 735 pages for 'hibernate search'.

Page 708/735 | < Previous Page | 704 705 706 707 708 709 710 711 712 713 714 715  | Next Page >

  • Objective-C++ Memory Problem

    - by Stephen Furlani
    Hello, I'm having memory woes. I've got a C++ Library (Equalizer from Eyescale) and they use the Traversal Visitor Pattern to allow you to add new functionality to their classes. I've finally figured out how it works, and I've got a Visitor that just returns the properties from one of the objects. (since I don't know how they're allocated). so. My little code does this: VisitorResult AGLContextVisitor::visit( Channel* channel ) { // Search through Nodes, Pipes until we get to the right window. // Add some code to make sure we find the right one? // Not executing the following code as C++ in gdb? eq::Window* w = channel->getWindow(); OSWindow* osw = w->getOSWindow(); AGLWindow* aw = (AGLWindow *)osw; AGLContext agl_ctx = aw->getAGLContext(); this->setContext(agl_ctx); return TRAVERSE_PRUNE; } So here's the problem. eq::Window* w = channel->getWindow(); (gdb) print w 0x0 BUT If I do this: (gdb) set objc-non-blocking-mode off (gdb) print w=channel->getWindow() 0x300effb9 // an honest memory location, and sets w as verified in the Debugger window of XCode. It does the same thing for osw. I don't get it. Why would something work in (gdb) but not in the code? The file is completely a cpp file, but it seems to be running in objc++, since I need to turn blocking off. Help!? I feel like I'm missing some memory-management basic thing here, either with C++ or Obj-C. [edit] channel-getWindow() is supposed to do this: /** @return the parent window. @version 1.0 */ Window* getWindow() { return _window; } The code also executes fine if I run it from a C++-only application. [edit] No... I tried creating a simple stand-alone program since I was tired of running it as a plugin. Messy to debug. And no, it doesn't run in the C++ program either. So I'm really at a loss as to what I'm doing wrong. Thanks, -- Stephen Furlani

    Read the article

  • Selenium: How to use stored value in a javascript comparison

    - by dstrube
    I've searched around for the answer to this and found lots of much more complicated questions, but none that gave me insight enough to figure this one out. What I'm doing: 1- open a page with a number that will probably be large 2- get the X Path to where that number is and store it to a variable 3- do a javascript to compare the above stored variable to see if it is bigger than 10, if so, set a new varaible to true; else false (because that is the default value) 4- verify the variable in #3 is true Sounds simple enough, no? Where it goes wrong: At step 3, comparing the variable from step #2 to 10 isn't allowed, at least not the way I'm writing it. Why? Details: <tr> <td>open</td> <td>http://www.google.com/search?hl=en&q=selenium+verifyEval</td> <td></td> </tr> <tr> <td>store</td> <td>/html/body/div[5]/div/p/b[3]</td> <td>resultCount</td> </tr> <tr> <td>storeEval</td> <td>var isMoreThan10 = new Boolean(); isMoreThan10 = (resultCount &gt; 10);</td> <td>isMoreThan10</td> </tr> <tr> <td>verifyExpression</td> <td>${isMoreThan10}</td> <td>true</td> </tr> I just thought of one possible workaround: Exapnd the javascript code to get the value there & assign it to a variable there so I'll be more likely to be able to use that variable in the javascript. Not sure exactly how that would be done- anyone wanna help with that? But surely there is be a better way, isn't there? I must be able to assign a value to a variable in Selenium, then in the next line use that variable in a javascript, right?

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

    - by Ted
    There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

    Read the article

  • whats wrong with this php mysql_real_escape_string

    - by skyhigh
    Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • Scalable Database Tagging Schema

    - by Longpoke
    EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

    Read the article

  • php imap save massage to sent folder after sending

    - by user1108279
    I am stucked with this for two days. I am trying to use imap_append from PHP but no luck so far. I was able to to implement this code for single attachment but multiple attachments not working. <?php $authhost="{000.000.000.000:993/validate-cert/ssl}Sent"; $user="sadasd"; $pass="sadasd"; if ($mbox=imap_open( $authhost, $user, $pass)) { $dmy=date("d-M-Y H:i:s"); $filename="filename.pdf"; $attachment = chunk_split(base64_encode($filestring)); $boundary = "------=".md5(uniqid(rand())); $msg = ("From: Somebody\r\n" . "To: [email protected]\r\n" . "Date: $dmy\r\n" . "Subject: This is the subject\r\n" . "MIME-Version: 1.0\r\n" . "Content-Type: multipart/mixed; boundary=\"$boundary\"\r\n" . "\r\n\r\n" . "--$boundary\r\n" . "Content-Type: text/html;\r\n\tcharset=\"ISO-8859-1\"\r\n" . "Content-Transfer-Encoding: 8bit \r\n" . "\r\n\r\n" . "Hello this is a test\r\n" . "\r\n\r\n" . "--$boundary\r\n" . "Content-Transfer-Encoding: base64\r\n" . "Content-Disposition: attachment; filename=\"$filename\"\r\n" . "\r\n" . $attachment . "\r\n" . "\r\n\r\n\r\n" . "--$boundary--\r\n\r\n"); imap_append($mbox,$authhost,$msg); imap_close($mbox); } else { echo "<h1>FAIL!</h1>\n"; } ?> Now that raw code above is working but I am unable to add multiple attachments. In some cases I got message body base64 decoded and in message body lot of strange letters. Something like R0lGODlhkAEfAOYAAPSeZPONtdSIu+u2vv/La+5Rj8AhYPvWhOjtkfvi7MRImcjYse5DM6O+dOnl ..... I search all the web i still got no luck. Since I have dedicated server I also tried to implement some procmail+ postfix examples but also no luck. Can someone help?

    Read the article

  • Use of text() function when using xPath in dom4j

    - by jlawless
    I have inherited an application that parses xml using dom4j and xPath: The xml being parsed is similar to the following: <cache> <content> <transaction> <page> <widget name="PAGE_ID">WRK_REGISTRATION</widget> <widget name="TRANS_DETAIL_ID">77145</widget> <widget name="GRD_ERRORS" /> </page> <page> <widget name="PAGE_ID">WRK_REGISTRATION</widget> <widget name="TRANS_DETAIL_ID">77147</widget> <widget name="GRD_ERRORS" /> </page> <page> <widget name="PAGE_ID">WRK_PROCESSING</widget> <widget name="TRANS_DETAIL_ID">77152</widget> <widget name="GRD_ERRORS" /> </page> </transaction> </content> </cache> Individual Nodes are being searched using the following: String xPathToGridErrorNode = "//cache/content/transaction/page/widget[@name='PAGE_ID'][text()='WRK_DNA_REGISTRATION']/../widget[@name='TRANS_DETAIL_ID'][text()='77147']/../widget[@name='GRD_ERRORS_TEMP']"; org.dom4j.Element root = null; SAXReader reader = new SAXReader(); Document document = reader.read(new BufferedInputStream(new ByteArrayInputStream(xmlToParse.getBytes()))); root = document.getRootElement(); Node gridNode = root.selectSingleNode(xPathToGridErrorNode); where xmlToParse is a String of xml similar to the excerpt provided above. The code is trying to obtain the GRD_ERROR node for the page with the PAGE_ID and TRANS_DETAIL_ID provided in the xPath. I am seeing an intermittent (~1-2%) failure (returned node is null) of this selectSingleNode request even though the requested node is in the xml being searched. I know there are some gotchas associated with using text()= in xPath and was wondering if there was a better way to format the xPath string for this type of search.

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • VB.NET looping through XML to store in singleton

    - by rockinthesixstring
    I'm having a problem with looping through an XML file and storing the value in a singleton My XML looks like this <values> <value></value> <value>$1</value> <value>$5,000</value> <value>$10,000</value> <value>$15,000</value> <value>$25,000</value> <value>$50,000</value> <value>$75,000</value> <value>$100,000</value> <value>$250,000</value> <value>$500,000</value> <value>$750,000</value> <value>$1,000,000</value> <value>$1,250,000</value> <value>$1,500,000</value> <value>$1,750,000</value> <value>$2,000,000</value> <value>$2,500,000</value> <value>$3,000,000</value> <value>$4,000,000</value> <value>$5,000,000</value> <value>$7,500,000</value> <value>$10,000,000</value> <value>$15,000,000</value> <value>$25,000,000</value> <value>$50,000,000</value> <value>$100,000,000</value> <value>$100,000,000+</value> </values> And my function looks like this Public Class LoadValues Private Shared SearchValuesInstance As List(Of SearchValues) = Nothing Public Shared ReadOnly Property LoadSearchValues As List(Of SearchValues) Get Dim sv As New List(Of SearchValues) If SearchValuesInstance Is Nothing Then Dim objDoc As XmlDocument = New XmlDataDocument Dim objRdr As XmlTextReader = New XmlTextReader(HttpContext.Current.Server.MapPath("~/App_Data/Search-Values.xml")) objRdr.Read() objDoc.Load(objRdr) Dim root As XmlElement = objDoc.DocumentElement Dim itemNodes As XmlNodeList = root.SelectNodes("/values") For Each n As XmlNode In itemNodes sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) Next SearchValuesInstance = sv Else : sv = SearchValuesInstance End If Return sv End Get End Property End Class My problem is that I'm getting an object not set to an instance of an object on the sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) line.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • What variable dictates position of non-focused elements in the roundabout plugin?

    - by kristina childs
    Part of the problem here is that i'm not sure what the best language to use in order to find the solution. I search and searched so please forgive if this is already a thread somewhere. I'm using the roundabout plugin to cycle through 3 divs. Each div is 794px wide, which makes the roundabout-in-focus element 794 and the two not in focus 315.218px wide, positioned so half of each is hidden by the in-focus div. This is all well and good, however the total width of the display needs to stay within 1000px (ideally 980px, but i can fudge if need be.) Basically I want to make the non-focused divs be 3/4 hidden by the in-focus div but for the life of me can't figure out what variables i need to edit in order to do it. Unfortunately it's not one of the many easily-changed options like z-index and minScale. i tried minScale but it's clear this isn't going to work. the plugin outputs this code: <li class="roundabout-moveable-item" style="position: absolute; left: -57px; top: 205px; width: 319.982px; height: 149.513px; opacity: 0.7; z-index: 146; font-size: 5.6px;"> i need to find out what changes the left positioning so it's shifted closer to the center of the stage, like this: <li class="roundabout-moveable-item" style="position: absolute; left: 5px; top: 205px; width: 319.982px; height: 149.513px; opacity: 0.7; z-index: 146; font-size: 5.6px;"> i tried playing with the positioning functions of the plugin but all that did was shift everything in tandem left or right. any help is greatly appreciated. this site is going to be awesome once i figure out all this jquery stuff! here is a link to my .js file: http://avalon.eaw.com/scripts/jquery.roundabout2.js i've got an overflow:hidden on the to help guide the positioning of those no-focused items.

    Read the article

  • Why does std::map operator[] create an object if the key doesn't exist?

    - by n1ck
    Hi, I'm pretty sure I already saw this question somewhere (comp.lang.c++? Google doesn't seem to find it there either) but a quick search here doesn't seem to find it so here it is: Why does the std::map operator[] create an object if the key doesn't exist? I don't know but for me this seems counter-intuitive if you compare to most other operator[] (like std::vector) where if you use it you must be sure that the index exists. I'm wondering what's the rationale for implementing this behavior in std::map. Like I said wouldn't it be more intuitive to act more like an index in a vector and crash (well undefined behavior I guess) when accessed with an invalid key? Refining my question after seeing the answers: Ok so far I got a lot of answers saying basically it's cheap so why not or things similar. I totally agree with that but why not use a dedicated function for that (I think one of the comment said that in java there is no operator[] and the function is called put)? My point is why doesn't map operator[] work like a vector? If I use operator[] on an out of range index on a vector I wouldn't like it to insert an element even if it was cheap because that probably mean an error in my code. My point is why isn't it the same thing with map. I mean, for me, using operator[] on a map would mean: i know this key already exist (for whatever reason, i just inserted it, I have redundancy somewhere, whatever). I think it would be more intuitive that way. That said what are the advantage of doing the current behavior with operator[] (and only for that, I agree that a function with the current behavior should be there, just not operator[])? Maybe it give clearer code that way? I don't know. Another answer was that it already existed that way so why not keep it but then, probably when they (the ones before stl) choose to implement it that way they found it provided an advantage or something? So my question is basically: why choose to implement it that way, meaning a somewhat lack of consistency with other operator[]. What benefit do it give? Thanks

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

  • Jquery-UI tabs : Double loading of the default tab with

    - by Stephane
    I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

    Read the article

  • Multiple layouts in rails [Newbie Q]

    - by BriteLite
    Hi. As a newb, I decided to build a "home inventory" application. I am now stuck on how to programmatically select a layout based on what type of item it is when viewing it in a browser. According to my planning, so far I should have created a few models to represent types of items I can find in my home: Furniture, Electronics and Books. class Book < ActiveRecord::Base end class Furniture < ActiveRecord::Base end class Electronic < ActiveRecord::Base end Now the Books model has things like isbn, pages, address, and category. Furniture model has things like color, price, address, and category. Electronics has things like name, voltage, address, and category. Here is where I got confused. I know the property address is going to be the same for all of them. I also know that, I will need to create multiple "layouts" for 3 different types of items to show the different properties of said items with appropriate graphics and stylesheets. But how will I go about deciding which category the item is so I can determine which layout to render. According to me, this is how I will do it: class DisplayController < ApplicationController def display @item = Params[:item] if @item.category = "electronics" render :layout => 'electronics' end end In my routes.rb map.display ':item', :controller => 'display', :action => 'display' I only seem to have one concern with this, I probably will add a lot of categories later on and think there should be a more DRY-esque way of dealing, rather than hardcoding them. I understand that I need to add into my layout html tags to display relevant information for that particular category. ----Questions---- Is this the right way to approach this type of problem. Will this approach be compatible when I decide to add a gem like *thinking_sphinx* to run search. What issues do you see with my approach and how can I make it better. I was reading something about "Polymorphic Assoc", does that apply in this case, since category exist for all items? Also, I was trying to get a routes to render a URL like "http://localhost/living-room-tv"

    Read the article

  • Moving from Windows to Ubuntu.

    - by djzmo
    Hello there, I used to program in Windows with Microsoft Visual C++ and I need to make some of my portable programs (written in portable C++) to be cross-platform, or at least I can release a working version of my program for both Linux and Windows. I am total newcomer in Linux application development (and rarely use the OS itself). So, today, I installed Ubuntu 10.04 LTS (through Wubi) and equipped Code::Blocks with the g++ compiler as my main weapon. Then I compiled my very first Hello World linux program, and I confused about the output program. I can run my program through the "Build and Run" menu option in Code::Blocks, but when I tried to launch the compiled application externally through a File Browser (in /media/MyNTFSPartition/MyProject/bin/Release; yes, I saved it in my NTFS partition), the program didn't show up. Why? I ran out of idea. I need to change my Windows and Microsoft Visual Studio mindset to Linux and Code::Blocks mindset. So I came up with these questions: How can I execute my compiled linux programs externally (outside IDE)? In Windows, I simply run the generated executable (.exe) file How can I distribute my linux application? In Windows, I simply distribute the executable files with the corresponding DLL files (if any) What is the equivalent of LIBs (static library) and DLLs (dynamic library) in linux and how to use them? In Windows/Visual Studio, I simply add the required libraries to the Additional Dependencies in the Project Settings, and my program will automatically link with the required static library(-ies)/DLLs. Is it possible to use the "binary form" of a C++ library (if provided) so that I wouldn't need to recompile the entire library source code? In Windows, yes. Sometimes precompiled *.lib files are provided. If I want to create a wxWidgets application in Linux, which package should I pick for Ubuntu? wxGTK or wxX11? Can I run wxGTK program under X11? In Windows, I use wxMSW, Of course. If question no. 4 is answered possible, are precompiled wxX11/wxGTK library exists out there? Haven't tried deep google search. In Windows, there is a project called "wxPack" (http://wxpack.sourceforge.net/) that saves a lot of my time. Sorry for asking many questions, but I am really confused on these linux development fundamentals. Any kind of help would be appreciated =) Thanks.

    Read the article

< Previous Page | 704 705 706 707 708 709 710 711 712 713 714 715  | Next Page >