Search Results

Search found 19539 results on 782 pages for 'pretty print'.

Page 729/782 | < Previous Page | 725 726 727 728 729 730 731 732 733 734 735 736  | Next Page >

  • Is a many-to-many relationship with extra fields the right tool for my job?

    - by whichhand
    Previously had a go at asking a more specific version of this question, but had trouble articulating what my question was. On reflection that made me doubt if my chosen solution was correct for the problem, so this time I will explain the problem and ask if a) I am on the right track and b) if there is a way around my current brick wall. I am currently building a web interface to enable an existing database to be interrogated by (a small number of) users. Sticking with the analogy from the docs, I have models that look something like this: class Musician(models.Model): first_name = models.CharField(max_length=50) last_name = models.CharField(max_length=50) dob = models.DateField() class Album(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) class Instrument(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) Where I have one central table (Musician) and several tables of associated data that are related by either ForeignKey or OneToOneFields. Users interact with the database by creating filtering criteria to select a subset of Musicians based on data the data on the main or related tables. Likewise, the users can then select what piece of data is used to rank results that are presented to them. The results are then viewed initially as a 2 dimensional table with a single row per Musician with selected data fields (or aggregates) in each column. To give you some idea of scale, the database has ~5,000 Musicians with around 20 fields of related data. Up to here is fine and I have a working implementation. However, it is important that I have the ability for a given user to upload there own annotation data sets (more than one) and then filter and order on these in the same way they can with the existing data. The way I had tried to do this was to add the models: class UserDataSets(models.Model): user = models.ForeignKey(User) name = models.CharField(max_length=100) description = models.CharField(max_length=64) results = models.ManyToManyField(Musician, through='UserData') class UserData(models.Model): artist = models.ForeignKey(Musician) dataset = models.ForeignKey(UserDataSets) score = models.IntegerField() class Meta: unique_together = (("artist", "dataset"),) I have a simple upload mechanism enabling users to upload a data set file that consists of 1 to 1 relationship between a Musician and their "score". Within a given user dataset each artist will be unique, but different datasets are independent from each other and will often contain entries for the same musician. This worked fine for displaying the data, starting from a given artist I can do something like this: artist = Musician.objects.get(pk=1) dataset = UserDataSets.objects.get(pk=5) print artist.userdata_set.get(dataset=dataset.pk) However, this approach fell over when I came to implement the filtering and ordering of query set of musicians based on the data contained in a single user data set. For example, I could easily order the query set based on all of the data in the UserData table like this: artists = Musician.objects.all().order_by(userdata__score) But that does not help me order by the results of a given single user dataset. Likewise I need to be able to filter the query set based on the "scores" from different user data sets (eg find all musicians with a score 5 in dataset1 and < 2 in dataset2). Is there a way of doing this, or am I going about the whole thing wrong?

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • POST parameters strangely parsed inside phantomjs

    - by user61629
    I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • 2nd Year College - Learning - Microsoft Server Products

    - by Ryan
    As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

    Read the article

  • Why does std::map operator[] create an object if the key doesn't exist?

    - by n1ck
    Hi, I'm pretty sure I already saw this question somewhere (comp.lang.c++? Google doesn't seem to find it there either) but a quick search here doesn't seem to find it so here it is: Why does the std::map operator[] create an object if the key doesn't exist? I don't know but for me this seems counter-intuitive if you compare to most other operator[] (like std::vector) where if you use it you must be sure that the index exists. I'm wondering what's the rationale for implementing this behavior in std::map. Like I said wouldn't it be more intuitive to act more like an index in a vector and crash (well undefined behavior I guess) when accessed with an invalid key? Refining my question after seeing the answers: Ok so far I got a lot of answers saying basically it's cheap so why not or things similar. I totally agree with that but why not use a dedicated function for that (I think one of the comment said that in java there is no operator[] and the function is called put)? My point is why doesn't map operator[] work like a vector? If I use operator[] on an out of range index on a vector I wouldn't like it to insert an element even if it was cheap because that probably mean an error in my code. My point is why isn't it the same thing with map. I mean, for me, using operator[] on a map would mean: i know this key already exist (for whatever reason, i just inserted it, I have redundancy somewhere, whatever). I think it would be more intuitive that way. That said what are the advantage of doing the current behavior with operator[] (and only for that, I agree that a function with the current behavior should be there, just not operator[])? Maybe it give clearer code that way? I don't know. Another answer was that it already existed that way so why not keep it but then, probably when they (the ones before stl) choose to implement it that way they found it provided an advantage or something? So my question is basically: why choose to implement it that way, meaning a somewhat lack of consistency with other operator[]. What benefit do it give? Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MySQL LEFT OUTER JOIN virtual table

    - by user1707323
    I am working on a pretty complicated query let me try to explain it to you. Here is the tables that I have in my MySQL database: students Table --- `students` --- student_id first_name last_name current_status status_change_date ------------ ------------ ----------- ---------------- -------------------- 1 John Doe Active NULL 2 Jane Doe Retread 2012-02-01 students_have_courses Table --- `students_have_courses` --- students_student_id courses_course_id s_date e_date int_date --------------------- ------------------- ---------- ---------- ----------- 1 1 2012-01-01 2012-01-04 2012-01-05 1 2 2012-01-05 NULL NULL 2 1 2012-01-10 2012-01-11 NULL students_have_optional_courses Table --- `students_have_optional_courses` --- students_student_id optional_courses_opcourse_id s_date e_date --------------------- ------------------------------ ---------- ---------- 1 1 2012-01-02 2012-01-03 1 1 2012-01-06 NULL 1 5 2012-01-07 NULL Here is my query so far SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_have_optional_courses`.optional_courses_opcourse_id, `students_have_optional_courses`.s_date, `students_have_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN `students_have_optional_courses` ON ( `students_have_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_have_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_have_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id; What I want to be returned is the student_id, first_name, and last_name for all Active or Retread students and then LEFT JOIN the highest course_id, s_date, e_date, and int_date for the those students where the s_date is since the status_change_date if status is 'Retread'. Then LEFT JOIN the highest optional_courses_opcourse_id, s_date, and e_date from the students_have_optional_courses TABLE where the students_have_optional_courses.s_date is greater or equal to the students_have_courses.s_date and the students_have_optional_courses.e_date IS NULL Here is what is being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 1 2012-01-06 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Here is what I want being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 5 2012-01-07 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Everything is working except one thing, I cannot seem to get the highest students_have_optional_courses.optional_courses_opcourse_id no matter how I form the query Sorry, I just solved this myself after writing this all out I think it helped me think of the solution. Here is the solution query: SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_optional_courses`.optional_courses_opcourse_id, `students_optional_courses`.s_date, `students_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN ( SELECT * FROM `students_have_optional_courses` ORDER BY `students_have_optional_courses`.optional_courses_opcourse_id DESC ) `students_optional_courses` ON ( `students_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id;

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • How to properly preload images, js and css files?

    - by Kenny Bones
    Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • How do I call a function name that is stored in a hash in Perl?

    - by Ether
    I'm sure this is covered in the documentation somewhere but I have been unable to find it... I'm looking for the syntactic sugar that will make it possible to call a method on a class whose name is stored in a hash (as opposed to a simple scalar): use strict; use warnings; package Foo; sub foo { print "in foo()\n" } package main; my %hash = (func => 'foo'); Foo->$hash{func}; If I copy $hash{func} into a scalar variable first, then I can call Foo->$func just fine... but what is missing to enable Foo->$hash{func} to work? (EDIT: I don't mean to do anything special by calling a method on class Foo -- this could just as easily be a blessed object (and in my actual code it is); it was just easier to write up a self-contained example using a class method.) EDIT 2: Just for completeness re the comments below, this is what I'm actually doing (this is in a library of Moose attribute sugar, created with Moose::Exporter): # adds an accessor to a sibling module sub foreignTable { my ($meta, $table, %args) = @_; my $class = 'MyApp::Dir1::Dir2::' . $table; my $dbAccessor = lcfirst $table; eval "require $class" or do { die "Can't load $class: $@" }; $meta->add_attribute( $table, is => 'ro', isa => $class, init_arg => undef, # don't allow in constructor lazy => 1, predicate => 'has_' . $table, default => sub { my $this = shift; $this->debug("in builder for $class"); ### here's the line that uses a hash value as the method name my @args = ($args{primaryKey} => $this->${\$args{primaryKey}}); push @args, ( _dbObject => $this->_dbObject->$dbAccessor ) if $args{fkRelationshipExists}; $this->debug("passing these values to $class -> new: @args"); $class->new(@args); }, ); } I've replaced the marked line above with this: my $pk_accessor = $this->meta->find_attribute_by_name($args{primaryKey})->get_read_method_ref; my @args = ($args{primaryKey} => $this->$pk_accessor); PS. I've just noticed that this same technique (using the Moose meta class to look up the coderef rather than assuming its naming convention) cannot also be used for predicates, as Class::MOP::Attribute does not have a similar get_predicate_method_ref accessor. :(

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Downloading large file with php

    - by Alessandro
    Hi, I have to write a php script to download potentially large files. The file I'm reporting here works fine most of the times. However, if the client's connection is slow the request ends (with status code 200) in the middle of the downloading, but not always at the very same point, and not at the very same time. I tried to overwrite some php.ini variables (see the first statements) but the problem remains. I don't know if it's relevant but my hosting server is SiteGround, and for simple static file requests, the download works fine also with slow connections. I've found Forced downloading large file with php but I didn't understand mario's answer. I'm new to web programming. So here's my code. <?php ini_set('memory_limit','16M'); ini_set('post_max_size', '30M'); set_time_limit(0); include ('../private/database_connection.php'); $downloadFolder = '../download/'; $fileName = $_POST['file']; $filePath = $downloadFolder . $fileName; if($fileName == NULL) { exit; } ob_start(); session_start(); if(!isset($_SESSION['Username'])) { // or redirect to login (remembering this download request) $_SESSION['previousPage'] = 'download.php?file=' . $fileName; header("Location: login.php"); exit; } if (file_exists($filePath)) { header('Content-Description: File Transfer'); header('Content-Type: application/octet-stream'); //header('Content-Disposition: attachment; filename='.$fileName); header("Content-Disposition: attachment; filename=\"$fileName\""); header('Content-Transfer-Encoding: binary'); header('Expires: 0'); header('Cache-Control: must-revalidate, post-check=0, pre-check=0'); //header('Pragma: public'); header('Content-Length: ' . filesize($filePath)); ob_clean(); flush(); // download // 1 // readfile($filePath); // 2 $file = @fopen($filePath,"rb"); if ($file) { while(!feof($file)) { print(fread($file, 1024*8)); flush(); if (connection_status()!=0) { @fclose($file); die(); } } @fclose($file); } exit; } else { header('HTTP/1.1 404 File not found'); exit; } ?>

    Read the article

  • Having trouble understanding some code (Ruby on Rails)

    - by user284194
    I posted a question awhile ago asking how I could limit the rate at which a form could be submitted from a rails application. I was helped by a very patient user and their solution works great. The code was for my comments controller, and now I find myself wanting to add this functionality to another controller, my Messages controller. I immediately tried reusing the working code from the comments controller but I couldn't get it to work. Instead of asking for the working code, could someone please help me understand my working comment controller code? class CommentsController < ApplicationController #... before_filter :post_check def record_post_time cookies[:last_post_at] = Time.now.to_i end def last_post_time Time.at((cookies[:last_post_at].to_i rescue 0)) end MIN_POST_TIME = 2.minutes def post_check return true if (Time.now - last_post_time) > MIN_POST_TIME flash[:warning] = "You are trying to reply too fast." @message = Message.find(params[:message_id]) redirect_to(@message) return false end #... def create @message = Message.find(params[:message_id]) @comment = @message.comments.build(params[:comment]) if @comment.save record_post_time flash[:notice] = "Replied to \"#{@message.title}\"" redirect_to(@message) else render :action => "new" end end def update @message = Message.find(params[:message_id]) @comment = Comment.find(params[:id]) if @comment.update_attributes(params[:comment]) record_post_time redirect_to post_comment_url(@message, @comment) else render :action => "edit" end end #... end My Messages controller is pretty much a standard rails generated controller with a few before filters and associated private methods for DRYing up the code and a redirect for non existent pages. I'll explain how much of the code I understand. When a comment is created, a cookie is created with a last_post_time value. If they try to post another comment, the cookie is checked if the last one was made in the last two minutes. If it was a flash warning is displayed and no comment is recorded. What I don't really understand is how the post_check method works and how I can adapt it for my simpler posts controller. I thought I could reuse all the code in the message controller with the exception of the line: @message = Message.find(params[:message_id]) # (don't need the redirect code) in the post_check method. But it trips up on the "record_post_time" in the create action/method. I really want to understand this. Can someone explain why this doesn't work? I greatly appreciate you reading my lengthy question.

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

  • Casting objects in C# (ASP.Net MVC)

    - by Mortanis
    I'm coming from a background in ColdFusion, and finally moving onto something modern, so please bear with me. I'm running into a problem casting objects. I have two database tables that I'm using as Models - Residential and Commercial. Both of them share the majority of their fields, though each has a few unique fields. I've created another class as a container that contains the sum of all property fields. Query the Residential and Commercial, stuff it into my container, cunningly called Property. This works fine. However, I'm having problems aliasing the fields from Residential/Commercial onto Property. It's quite easy to create a method for each property: fillPropertyByResidential(Residential source) and fillPropertyByCommercial(Commercial source), and alias the variables. That also works fine, but quite obviously will copy a bunch of code - all those fields that are shared between the two main Models. So, I'd like a generic fillPropertyBySource() that takes the object, and detects if it's Residential or Commercial, fills the particular fields of each respective type, then do all the fields in common. Except, I gather in C# that variables created inside an If are only in the scope of the if, so I'm not sure how to do this. public property fillPropertyBySource(object source) { property prop = new property(); if (source is Residential) { Residential o = (Residential)source; //Fill Residential only fields } else if (source is Commercial) { Commercial o = (Commercial)source; //Fill Commercial only fields } //Fill fields shared by both prop.price = (int)o.price; prop.bathrooms = (float)o.bathrooms; return prop; } "o" being a Commercial or Residential only exists within the scope of the if. How do I detect the original type of the source object and take action? Bear with me - the shift from ColdFusion into a modern language is pretty..... difficult. More so since I'm used to procedural code and MVC is a massive paradigm shift. Edit: I should include the error: The name 'o' does not exist in the current context For the aliases of price and bathrooms in the shared area.

    Read the article

  • Little CSS problem with Auto height and nested div's

    - by GeekDrop.com
    So I'm finally learning my way around CSS more and have run into a small problem. I have a container div, with a few divs inside of it, one of them is a bit if text (which can be a random height) and an image that will have a MAX height of 200px. I am using a dotted/colored background behind them that needs to auto expand to the height of whichever is the tallest, either the text or the image. Right now when i use height:auto on the container div it works perfect for the random height text: Example Screenshot But it's only adjusting according to the text's height; if the image is taller than the text, the image overflows the bottom of the background dotted/colored box. Example Screenshot The CSS I'm using currently is this: h1 div#like_detailed { margin: 0; font-size: 1.1em; width: 700px; } #details-image img { border: none; clear: left; float: right; margin: -45px 0 0 0; max-height: 200px; padding: 0 7px 0 10px; } #deets-container { background-color: #FEF; border: #190AE7 1px dotted; height: auto; margin-top: 0; margin-bottom: 30px; padding-top: 10px; padding-right: 10px; padding-left: 10px; padding-bottom: 0; } And the HTML for it is this: <div id="deets-container" class="rounded"> <!-- Button --> <div class="likebtnframe">(some code)</div> <!-- Button --> <div class="tweetbtnframe">(some code)</div> <!-- Button --> <ul id="share"> <li><a name="share">(some code)</a></li> </ul> <!-- Submitted By --> <div class="submitter_detailed"><span class="submitter-color smalltext">(some code)</span> (some code)</div> <!-- Image --> <div id="**details-image**">(some code)</div> <!-- Like / Quote --> <h1 id="**like_detailed**">(some code)</h1> </div> I have a feeling this is pretty easy but I'm running out of time to sort it out on my own. Anyone?

    Read the article

  • Thread sleep and thread join.

    - by Dhruv Gairola
    hi guys, if i put a thread to sleep in a loop, netbeans gives me a caution saying Invoking Thread.sleep in loop can cause performance problems. However, if i were to replace the sleep with join, no such caution is given. Both versions compile and work fine tho. My code is below (check the last few lines for "Thread.sleep() vs t.join()"). public class Test{ //Display a message, preceded by the name of the current thread static void threadMessage(String message) { String threadName = Thread.currentThread().getName(); System.out.format("%s: %s%n", threadName, message); } private static class MessageLoop implements Runnable { public void run() { String importantInfo[] = { "Mares eat oats", "Does eat oats", "Little lambs eat ivy", "A kid will eat ivy too" }; try { for (int i = 0; i < importantInfo.length; i++) { //Pause for 4 seconds Thread.sleep(4000); //Print a message threadMessage(importantInfo[i]); } } catch (InterruptedException e) { threadMessage("I wasn't done!"); } } } public static void main(String args[]) throws InterruptedException { //Delay, in milliseconds before we interrupt MessageLoop //thread (default one hour). long patience = 1000 * 60 * 60; //If command line argument present, gives patience in seconds. if (args.length > 0) { try { patience = Long.parseLong(args[0]) * 1000; } catch (NumberFormatException e) { System.err.println("Argument must be an integer."); System.exit(1); } } threadMessage("Starting MessageLoop thread"); long startTime = System.currentTimeMillis(); Thread t = new Thread(new MessageLoop()); t.start(); threadMessage("Waiting for MessageLoop thread to finish"); //loop until MessageLoop thread exits while (t.isAlive()) { threadMessage("Still waiting..."); //Wait maximum of 1 second for MessageLoop thread to //finish. /*******LOOK HERE**********************/ Thread.sleep(1000);//issues caution unlike t.join(1000) /**************************************/ if (((System.currentTimeMillis() - startTime) > patience) && t.isAlive()) { threadMessage("Tired of waiting!"); t.interrupt(); //Shouldn't be long now -- wait indefinitely t.join(); } } threadMessage("Finally!"); } } As i understand it, join waits for the other thread to complete, but in this case, arent both sleep and join doing the same thing? Then why does netbeans throw the caution?

    Read the article

  • How to return the value from MySql Stored Proc ??

    - by karthik
    I am using the below storedproc to generate the Insert statements of a specified table It is build-ed without any errors. Now i want to return the result set in "V_string" as output of the SP DELIMITER $$ DROP PROCEDURE IF EXISTS `demo`.`InsertGenerator` $$ CREATE DEFINER=`root`@`localhost` PROCEDURE `InsertGenerator`() SWL_return: BEGIN -- SQLWAYS_EVAL# to retrieve column specific information -- SQLWAYS_EVAL# table DECLARE v_string NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# first half -- SQLWAYS_EVAL# tement DECLARE v_stringData NATIONAL VARCHAR(3000); -- SQLWAYS_EVAL# data -- SQLWAYS_EVAL# statement DECLARE v_dataType NATIONAL VARCHAR(1000); -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# columns DECLARE v_colName NATIONAL VARCHAR(50); DECLARE NO_DATA INT DEFAULT 0; DECLARE cursCol CURSOR FOR SELECT column_name,data_type FROM `columns` -- WHERE table_name = v_tableName; WHERE table_name = 'tbl_users'; DECLARE CONTINUE HANDLER FOR SQLEXCEPTION BEGIN SET NO_DATA = -2; END; DECLARE CONTINUE HANDLER FOR NOT FOUND SET NO_DATA = -1; OPEN cursCol; SET v_string = CONCAT('INSERT ',v_tableName,'('); SET v_stringData = ''; SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; IF NO_DATA <> 0 then -- NOT SUPPORTED print CONCAT('Table ',@tableName, ' not found, processing skipped.') close cursCol; LEAVE SWL_return; end if; WHILE NO_DATA = 0 DO IF v_dataType in('varchar','char','nchar','nvarchar') then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(',v_colName,'SQLWAYS_EVAL# ''+'); ELSE if v_dataType in('text','ntext') then -- SQLWAYS_EVAL# -- SQLWAYS_EVAL# else SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 00)),'''')+'''''',''+'); ELSE IF v_dataType = 'money' then -- SQLWAYS_EVAL# doesn't get converted -- SQLWAYS_EVAL# implicitly SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# y,''''''+ isnull(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0.0000'')+''''''),''+'); ELSE IF v_dataType = 'datetime' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# time,''''''+ isnull(cast(',v_colName, 'SQLWAYS_EVAL# 0)),''0'')+''''''),''+'); ELSE IF v_dataType = 'image' then SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(convert(varbinary,',v_colName, 'SQLWAYS_EVAL# 6)),''0'')+'''''',''+'); ELSE SET v_stringData = CONCAT(v_stringData,'SQLWAYS_EVAL# ll(cast(',v_colName,'SQLWAYS_EVAL# 0)),''0'')+'''''',''+'); end if; end if; end if; end if; end if; SET v_string = CONCAT(v_string,v_colName,','); SET NO_DATA = 0; FETCH cursCol INTO v_colName,v_dataType; END WHILE; END $$ DELIMITER ;

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

< Previous Page | 725 726 727 728 729 730 731 732 733 734 735 736  | Next Page >