Search Results

Search found 12077 results on 484 pages for 'node js'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 73/484 | < Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • How to add root node in the output method = text

    - by Akhil
    My sample input is <?xml version="1.0" encoding="UTF-8"?> <ns0:JDBC_RECEIVERDATA_MT_response xmlns:ns0="urn:parmalat.com.au:TESTSQL_REPLICATION"> <Statement_response> <response_1> <row> <XML_F52E2B61-18A1-11d1-B105-00805F49916B><![CDATA[<TransactionLog TID="1400" SeqNo="3337446" SQLTransaction="Insert into TankerLoads Values(141221,53,299,18,1,426148,6,&apos;Nov 19 2007 12:00AM&apos;,&apos;Dec 30 1899 12:59PM&apos;,3.00,20682,0,&apos;Zevo&apos;,&apos;Nov 19 2007 12:00AM&apos;,0)"/></row> <row> <XML_F52E2B61-18A1-11d1-B105-00805F49916B>um = 141221"/&gt;&lt;TransactionLog TID="1400" SeqNo="3337452" SQLTransaction="Insert into MilkPickups Values(790195,141221,0,&amp;apos;Nov 19 2007 12:00AM&amp;apos;,2433,&amp;apos;Nov 19 2007 12:00AM&amp;apos;,&amp;apos;Dec 30 1899 11:26AM&amp;apos;,3131,2.90)"/&gt; Like this I have mutiple records and my output should be like <root> <TransactionLog TID="1400" SeqNo="3337446" SQLTransaction="Insert into TankerLoads Values(141221,53,299,18,1,426148,6,'Nov 19 2007 12:00AM','Dec 30 1899 12:59PM',3.00,20682,0,'Zevo','Nov 19 2007 12:00AM',0)" /> <TransactionLog TID="1400" SeqNo="3337447" SQLTransaction="Update TankerLoads Set TankerNum = 53,DriverNum = 299,CarterNum = 18,MilkTypeNum = 1,SampleNum = 426148,ReceivalBayNum = 6,UnloadDate = 'Nov 19 2007 12:00AM',UnloadTime = 'Dec 30 1899 12:59PM',Temperature = 3.00,Volume = 20682,NetWeight = 0,WeighbridgeDocket = 'Zevo',LoadPickupDate = 'Nov 19 2007 12:00AM',IsValidated = 0 Where TankerLoadNum = 141221" /></root> AND I AM USING OUTPUT METHOD AS TEXT BECAUSE IF I USE XML THE TAG ARE REPLACED WITH &LT &GT WHICH I DONT MOREOVER IF YOU SEE THE ABOVE TWO ROWS THE LAST LINE IS HALF THE RECORD IS IN THE FIRST ROW AND CONTINUING THE OTHER HALF IN THE SECOND ROW SO i USED WHICH LEAVES SINGLE SPACE SO EVEN I DONT WANT THAT SINGLE SPACE..I HOPE I AM CLEAR IF NOT PLEASE LET ME KNOW I WILL ADD MORE COMMENTS..TPLEASE HELP ME OUT..THNKYOU

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • Return node level of hierarchical xml

    - by Ryan
    In a treeview you can retrieve the level of an item. I am trying to accomplish the same thing with the given input being an object. The XML data I will use for this example would be something like the following <?xml version="1.0" encoding="utf-8" ?> <Testing> <Numbers> <Number val="1"> <Number val="1.1"> <Number val="1.1.1"> <Number val="1.1.2" /> <Number val="1.1.3" /> <Number val="1.1.4" /> </Number> </Number> <Number val="1.2" /> <Number val="1.3" /> <Number val="1.4" /> </Number> <Number val="2" /> <Number val="3" /> <Number val="4" /> </Numbers> <Numbers> <Number val="5" /> <Number val="6" /> <Number val="7" /> <Number val="8" /> </Numbers> </Testing> This one is kicking my butt!

    Read the article

  • Issue pushing object into an array JS

    - by Javacadabra
    I'm having an issue placing an object into my array in javascript. This is the code: $('.confirmBtn').click(function(){ //Get reference to the Value in the Text area var comment = $("#comments").val(); //Create Object var orderComment = { 'comment' : comment }; //Add Object to the Array productArray.push(orderComment); //update cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); }); However when I print the array this is the output: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] => TEST TEST ) I would like it to look like this: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] Array( [comment] => TEST TEST ) I added products to the array in a similar way and it worked fine: var productArray = []; // Will hold order Items $(".orderBtn").click(function(event){ //Check to ensure quantity > 0 if(quantity == 0){ console.log("Quantity must be greater than 0") }else{//It is so continue //Show the order Box $(".order-alert").show(); event.preventDefault(); //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); //Order Item (contains stockCode and Quantity) - Can add whatever data I like here var orderItem = { 'stockCode' : stockCode, 'quantity' : quantity }; //Check if cookie exists if($.cookie('order_cookie') === undefined){ console.log("Creating new cookie"); //Add object to the Array productArray.push(orderItem);

    Read the article

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • require.js - How can I set a version on required modules as part of the URL?

    - by Ovesh
    I am using require.js to require JS modules in my application. I need a way to bust client cache on new JS modules, by way of a different requested URL. i.e., if the file hello/there.js has already been cached on the client, I can change the file name to force the browser to get the new file. In other words, for the module hello/there, I'd like require.js to request the url hello/there___v1234___.js (the file name can look different, it's just an example), according to a version string which is accessible on the client. What is the best way to achieve that?

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • JS Split ( ) to check if substring exists in Array

    - by Javacadabra
    I have an array of products that are stored as Strings in this format productname:quantity. The issue I am running into is that if a user adds one product with a quantity of x it is inserted into the array as it should. However, if they then decide to add more of a particular product a new entry is made into the array instead of checking if the product already exists and adjusting the quantity to the new value. oldQty + newQty. For example this is my array: ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1"] If I add another PALLET CARDS product it creates a new entry rather than updating the quantity of the existing item to 2. New array ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1","PALLET CARDS:1"] I would like the array to end up like this: - updating the quantity ["CBL202659/A:1","OUTER9:1","PALLET CARDS:2"] Currently this is my code: I use the split() method to seperate the String where a colon occurs and store the product name and quantity in two seperate variables. $(".orderBtn").click(function(event){ //Show the order Box $(".order-alert").show(); event.preventDefault(); //Create the Array var productArray = []; //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); var item = stockCode + ":" + quantity; var itemCheck = stockCode + ":"; if(quantity == 0){ console.log("Quantity must be greater than 0") }else{ //If no Cookie exists, create one and add the Array if ($.cookie('order_cookie') === undefined) { console.log("CREATE NEW COOKIE"); //Add items to Array productArray.push(item); //Add Array to Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); //If the Cookie already exists do this } else { productArray = JSON.parse($.cookie('order_cookie'));//get ref to array if(productArray.indexOf(itemCheck)!= -1){//It exists so update qty console.log("EXISTS... updating item: " + itemCheck); //var index = productArray.indexOf(item); //var update = productArray[index].split(":"); //var name = update[0]; //var oldQty = update[1]; //console.log(name + ":" + oldQty); //productArray[index] = item; }else{//It does not exist, so add to array console.log("Does not exist... adding new item: " + item); //Append items onto the Array productArray.push(item); } //Update the Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); console.log($.cookie('order_cookie')); } //Display the number of items in the Array in the Order Box $('#order_counter').html(productArray.length); } }); I suppose the real question I am asking here, is if it is possible to search the array for a subString - containing productname: ??

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Accessing Node of an XML object

    - by Lizard
    I am trying to access certain pieces of data from an xml file, here is the problem. ###XML FILE <products> <product> .... .... </product> <product> .... .... </product> etc... </products> I know that the piece of data I need is in ($products->product->myProdNode) I have this mapping (and many others) stored in my database as a string e.g.'product->prodCode' or 'product->dedscriptions->short_desc' How can I access this data by using the strings stored in my database. Thanks for you help in advance!

    Read the article

  • XElement return node value

    - by theDawckta
    I have an XElement that looks like this; <VideoFiles> <VideoFileInfo> <VideoType>1000</VideoType> <FormatCode>1000</FormatCode> <Url>http://www.idontwantthisvalue.com</Url> </VideoFileInfo> <VideoFileInfo> <VideoType>WMVOriginal</VideoType> <FormatCode>1004</FormatCode> <Url>http://www.iwanthitsvalue.com</Url> </VideoFile> I need to grab the value that has a sibling with a value of 1004. Can anyone help on this?

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >