Search Results

Search found 28401 results on 1137 pages for 'network location'.

Page 77/1137 | < Previous Page | 73 74 75 76 77 78 79 80 81 82 83 84  | Next Page >

  • Network not detected, but internet working

    - by Dave
    I am using a brand new HP computer with Windows 7 64 bit. When I first hooked it up it detected my network (hooked up through ethernet) easily. However, after I uninstalled Norton Internet Security, it stopped being able to detect my home network. I can still use the internet as if connected, but I can't go into the network options to communicate with other computers. I had this same problem on Windows Vista on my previous computer. Is there any way to fix this so it detects the network?

    Read the article

  • Why internet is said to be untrusted network?

    - by Ant's
    From wikipedia : 2 In computer security, a DMZ (sometimes referred to as a perimeter networking) is a physical or logical subnetwork that contains and exposes an organization's external services to a larger untrusted network, usually the Internet. Why it says larger untrusted network, usually the Internet. I see it many places that internet is said to be untrusted network. Are there any reason for it?

    Read the article

  • Network connection on Linux

    - by Kevin
    A general question about network connection on Linux : once a network connection goes into time_wait, is it still tied to the process ? Does it still use resources like say filehandle ? Reason I ask is because once it goes into time_wait, lsof does not report it anymore. I guess that means that the network connection is no longer tied to the process and hence does not count against filehandle limit. Would like to confirm though.

    Read the article

  • Looking for an open source real-time network analysis program

    - by JrSysAdmin
    Can somebody recommend an open source real-time network analysis program? What I'm looking for the program to do is display a graph of bandwidth usage by IP within our internal network that can quickly be viewed any time we need to (typically when we want to quickly find out who is utilizing high amounts of bandwidth and slowing down the network). We ideally simply want to hook up a monitor on the wall of our server room to a system whose NIC will be in permissive mode to log all network activity in a visual manner which can easily be seen and running 24/7. Prefer open source as I do not have a budget for this project and prefer open source projects in general. I'd also prefer for this to be available for CentOS but any linux distro or Windows OS would be acceptable. Thanks!

    Read the article

  • Cannot connect to my VPN Server from another network

    - by SantaC
    ok here is the deal. I have a Windows 2008 R2 server with RRAS installed configured for VPN. I also have DHCP running. On my DC I have AD running and they're connected with my domain. I am only using one NIC though. As a client I have Windows 7. So I tried connecting to my VPN server through my own network, which worked fine, so the setup is correct. However, when I tried connecting to my VPN server on another network, it does not work. I went to my brothers home and tried connecting to my server but it did not pass. So on my VPN server I have ip: 192.168.2.99 At my brothers house, i did the configuration on his windows 7 and it cannot connect to that ip. I am operating on the 192.168.2.1 network and he is operating on the 192.168.0.1 network. So how do I configure his client in order to get it to work? I tried changing his ip to the 192.168.2.x network, but i am not sure you can do that. I need some help here what to do.

    Read the article

  • Stream computer screen to TV via network instead of a USB wireless link

    - by user24559
    I want to stream my computer screen (not just video or a limited amount of content) to my TV via the network. I know there are wireless devices that use USB to tranfer the screen to the TV. However, these are limited to a short distance. What I want to do is stream the data via the network so I can be anywhere within the network and have the data shown on the tv. I am looking for video and sound to transfer. I want the entire computer screen to transfer just like when you connect the computer to the tv via VGA or HDMI and the sound out using the 3.5mm plug. I have been unable to find a unit that allows for the entire computer screen to transfer via the network. I just find the ability to stream video. I am using Windows 7 Ultimate with a quad processor and 16 GB of memory so I have the power to handle the transfer. My tv is hdtv.

    Read the article

  • Why would my network slow down?

    - by monkthemighty
    The network at my work has about 40 computers on it and a quite a few printers. When there are a lot of people working the network will be slow. I can test the ping between my computer and the router and it will keep rising, sometimes to the point that it times out. The router we are using is running Ubuntu on a atom processor and it has 4gb of ram. When the network slows the process Ksoftirq will be using most if not all of the processing power. I have found that Ksoftirq is a process that handles irq requests. Also when the network slows down I have captured packets from the router and using tshark and looked at it using wireshark on my laptop. With the capture show a lot of packets with TCP Dup ACK and TCP Retransmissions. The destinations of the TCP Dup and TCP retransmissions are to most of the computers on the network but there are some that are far more than others. What could this problem be caused by?

    Read the article

  • Methods and practices for managing a network that has no internet connection

    - by FaultyJuggler
    Originally asked in Super User but realized this belongs here. Long story short, I am setting up a network with 32 servers of varying specs that will be used for testing and development. We will be using RedHat Linux, we also do not have a router as of yet and were looking into making one of the servers act as our router/DHCP etc. The small cluster will be on an isolated network with no internet. I can use external harddrives and discs to transfer anything from external sources into machines on the network, so this isn't a locked down secure network, it just won't have a direct connection to the outside world. I've worked on such setups before, but always long after they were setup. So I'm reaching out to see what everyone knows as far as how groups have handled initial setup and maintenance of such a situation. What is the best way to get them all configured and up to date? What are the best ways to automate updates, network wide installs, etc. With the only given that I have large multi-terabyte external hard drives that would be used to drop whatever files are needed onto a central server, how do i then distribute those files and install their contents? I've done perl scripting, some teammates have played with puppet, so we aren't completely in the dark, I just wanted to avoid reinventing the wheel since this is a common challenge.

    Read the article

  • USB Drive that simultaneously connects to more than one computer

    - by user2499
    Background: I have a portable USB drive that I use to make sure I have access to common files whenever at home, work, travel etc for cases when I may not have Internet/Network access of any kind. There are some cases when I have to work simultaneously on a laptop and a desktop computer, and for those cases I usually have to unplug this USB hard drive and move it between the two. Question: dual-computer USB drive? Is there a USB-based solution that would enable me to use this portable drive between two computers simultaneously? If there is not a USB-based solution, does anyone have alternative suggestions, consistent with the underlying rationale? Rationale: Sometimes I have to work on a desktop computer with locked-down networking capabilities (such as at the local photocopy shop) and it can be difficult to get a network configuration that allows dual-computer access without breaking things, or accidentally making my USB drive visible to the entire network. Basically what I need is a very simply LAN that is guaranteed to work regardless of the rules or constraints set by the network administrator for wherever I happen to be at the time. See also: http://superuser.com/questions/99274/how-to-connect-two-computers-with-usb

    Read the article

  • How to block access to addresses outside network (internet)

    - by devnull
    I have a homeserver, that is now connected to the internet with an own network device (ath0 - 192.168.1.x). It also has one more network interface (eth0 - 192.168.0.x). Soon I will get a second internet line that will be connected the second network. The server then has both networks with different internet lines available, but i only want it to connect to the internet on the old ath0 interface - not the new eth0 (192.168.0.x). Background of that constellation is that the new line has a volume-limit in traffic - the old hasn't and i need the new line for all mobile devices and laptops. The devices should be able to use the new network to connect to the internet and the server. The homeserver is a debian 6 with iptables and some already written rules for it. I need now a rule to block all outgoing internet access on the eth0 interface - i guess it could be something with --target != 192.168.0.0 but i did not succeed in finding the proper solution. Edit: found the solution: iptables -A OUTPUT -o eth0 -d 192.168.0.0/24 -m state --state NEW,ESTABLISHED -j ACCEPT With that setting, all traffic that uses the eth0 interface is only allowed if the destination is inside the network 192.168.0.x - all other traffic is denied .

    Read the article

  • Lost network on ubuntu server

    - by user1838473
    I have a virtual machine on Vsphere 5.0 running Ubuntu 12.04 when i put dinamic IP (/etc/network/interfaces) iface eth0 inet dhcp Ubuntu have network and i can do ping to google for example (8.8.8.8) but when i put static IP and configure resolv.conf My interfaces file: auto eth0 iface eth0 inet static address 192.168.1.54 gateway 192.168.1.1 netmask 255.255.255.0 it lost the network and i cant do ping to anything...i dont understand where is the problem... Thanks a lot

    Read the article

  • Need solution for Network/Servers.

    - by rehanplus
    Dear All, Please help me. I just joined a new Hospital and want some help managing my network. There are some requirements: Current Network: There is a D.S.L connection and that is terminated on a LINUX proxy and then connected to D-Link layer 2 switches and then providing internet to more then 200 PC's (Would be increasing to 1500 in couple of months). D-Link switches are not configured yet. Also there is one Database server Report server and an application server. In near Future Application should be accessed by local users as well as remote users from internet via our web server. We do have a sharing server and all these servers databases and PC's are on single sub net. Required Network: All i do want is to secure my network from outside access and just allowing specific users via web application and they will be submitting there record for patient card and appointment facility by means of application and entering there record (on our database) but not violating our network resources. Secondly in house users also need to access the same application and also internet but they must have some unique identity and rights (i.e. Finance lab dept. peoples do have limited access to that application). Notes: Should i create V LAN or break sub nets. Having a firewall will solve my issues? is a router needed on these type of scenario's. Currently all the access are restricted from Linux Proxy. Thanks.

    Read the article

  • Unidentified network in Win7

    - by gylns
    I connect the internet through Ad-hoc network, My machine uses win7 and another uses winows xp, There's no problem when I connect the XP machine, but if i disconnect and reconnect the net, then my local network is marked as "Unidentified network",unless restart the XP machine, I don't know why?

    Read the article

  • Colliding network addresses

    - by joepd
    A customer is using the same address space as the company network. I need to connect with Cisco VPN Client to the network of the customer, without affecting local connectivity. To keep all working, I connect from a VM to avoid network addressing collisions. This works, but I'm looking for a way to get rid of the VM. Is it possible to connect with Cisco VPN Client 4.8 from Windows 7, without changing the 'normal' routing? How to tell specific applications (most importantly: Putty, VNC, mstsc, psql) to resolve their routes to the VPN instead of the default network interface? Have been hearing about SOCKS-proxies, is that something that could be made to work? I fear that this is a a bit of a crude question, but I'd be happy to specify more details/context.

    Read the article

  • Oracle Partner Network Specialized

    - by luca.maghernino(at)oracle.com
    Eventi specialized Eventi di specializzazione Il prezzo a listino del training è di 2.700 euro a partecipante. Per i nostri Partner che aderiscono a questa iniziativa il costo è di 700 euro per partecipante. Il numero massimo di partecipanti per ciascuna sessione è di 15 persone. Per iscriverti clicca sulla data di tuo interesse: Codice Corso Data Location D64292GC10 OPN Oracle BI EE 10.1.3 Implementation Boot Camp Ed 1 (5 gg) 28 febbraio Milano D50102GC10 Oracle Database 11g: Workshop di amministrazione Ed 2 PRV 21 marzo -- 21 marzo Empoli D64735GC10 OPN Oracle ECM 10g R3 Implementation Boot Camp Ed 1 PRV (3 gg) 28 marzo Milano D50317GC20 Oracle Database 11g: Performance Tuning Ed 1 PRV (5 gg) 4 aprile -- 4 aprile Milano D53946GC10 Oracle SOA Suite 11g: Build Composite Applications (5 gg) 18 aprile Milano D50081GC20 Oracle Database 11g: New Features for Administrators DBA Release 2 (5 gg) * 09 maggio Milano *Oracle Database 11g: New Features for Administrators DBA Release 2: questo corso si rivoge ad amministratori di database in possesso della certificazione Orale Certified Professional 10g che desiderano effettuare l'upgrade al livello Oracle Certified Professional 11g ed è propedeutico al superamento dell'esame 1Z0_050 Oracle Database 11g: New Features for Administrators oppure ad amministratori di database che hanno una buona conoscenza della versione 10g e desiderano aggiornare le proprie competenze alla release 11g.

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • Redirect network logs from syslog to another file

    - by w0rldart
    I keep logging way to much info (not needed, for now) in my syslog, and not daily or hourly... but instant. If I want to watch for something in my syslog I just can't because the network log keeps interfering. So, how can I redirect network logs to another file and/or stop logging it? Dec 10 17:01:33 user kernel: [ 8716.000587] MediaState is connected Dec 10 17:01:33 user kernel: [ 8716.000599] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:01:33 user kernel: [ 8716.000601] ==>rt_ioctl_giwfreq 11 Dec 10 17:01:33 user kernel: [ 8716.000612] rt28xx_get_wireless_stats ---> Dec 10 17:01:33 user kernel: [ 8716.000615] <--- rt28xx_get_wireless_stats Dec 10 17:01:39 user kernel: [ 8722.000714] MediaState is connected Dec 10 17:01:39 user kernel: [ 8722.000729] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:01:39 user kernel: [ 8722.000732] ==>rt_ioctl_giwfreq 11 Dec 10 17:01:39 user kernel: [ 8722.000747] rt28xx_get_wireless_stats ---> Dec 10 17:01:39 user kernel: [ 8722.000751] <--- rt28xx_get_wireless_stats Dec 10 17:01:44 user kernel: [ 8726.904025] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:01:45 user kernel: [ 8728.003138] MediaState is connected Dec 10 17:01:45 user kernel: [ 8728.003153] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:01:45 user kernel: [ 8728.003157] ==>rt_ioctl_giwfreq 11 Dec 10 17:01:45 user kernel: [ 8728.003171] rt28xx_get_wireless_stats ---> Dec 10 17:01:45 user kernel: [ 8728.003175] <--- rt28xx_get_wireless_stats Dec 10 17:01:51 user kernel: [ 8734.004066] MediaState is connected Dec 10 17:01:51 user kernel: [ 8734.004079] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:01:51 user kernel: [ 8734.004082] ==>rt_ioctl_giwfreq 11 Dec 10 17:01:51 user kernel: [ 8734.004096] rt28xx_get_wireless_stats ---> Dec 10 17:01:51 user kernel: [ 8734.004099] <--- rt28xx_get_wireless_stats Dec 10 17:01:57 user kernel: [ 8740.004108] MediaState is connected Dec 10 17:01:57 user kernel: [ 8740.004119] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:01:57 user kernel: [ 8740.004121] ==>rt_ioctl_giwfreq 11 Dec 10 17:01:57 user kernel: [ 8740.004132] rt28xx_get_wireless_stats ---> Dec 10 17:01:57 user kernel: [ 8740.004135] <--- rt28xx_get_wireless_stats Dec 10 17:01:57 user kernel: [ 8740.436021] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:03 user kernel: [ 8746.005280] MediaState is connected Dec 10 17:02:03 user kernel: [ 8746.005294] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:02:03 user kernel: [ 8746.005298] ==>rt_ioctl_giwfreq 11 Dec 10 17:02:03 user kernel: [ 8746.005312] rt28xx_get_wireless_stats ---> Dec 10 17:02:03 user kernel: [ 8746.005315] <--- rt28xx_get_wireless_stats Dec 10 17:02:09 user kernel: [ 8752.004790] MediaState is connected Dec 10 17:02:09 user kernel: [ 8752.004804] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:02:09 user kernel: [ 8752.004808] ==>rt_ioctl_giwfreq 11 Dec 10 17:02:09 user kernel: [ 8752.004821] rt28xx_get_wireless_stats ---> Dec 10 17:02:09 user kernel: [ 8752.004825] <--- rt28xx_get_wireless_stats Dec 10 17:02:15 user kernel: [ 8757.984031] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:15 user kernel: [ 8758.004078] MediaState is connected Dec 10 17:02:15 user kernel: [ 8758.004094] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:02:15 user kernel: [ 8758.004097] ==>rt_ioctl_giwfreq 11 Dec 10 17:02:15 user kernel: [ 8758.004112] rt28xx_get_wireless_stats ---> Dec 10 17:02:15 user kernel: [ 8758.004116] <--- rt28xx_get_wireless_stats Dec 10 17:02:16 user kernel: [ 8759.492017] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:19 user kernel: [ 8762.002179] SCANNING, suspend MSDU transmission ... Dec 10 17:02:19 user kernel: [ 8762.004291] MlmeScanReqAction -- Send PSM Data frame for off channel RM, SCAN_IN_PROGRESS=1! Dec 10 17:02:19 user kernel: [ 8762.025055] SYNC - BBP R4 to 20MHz.l Dec 10 17:02:19 user kernel: [ 8762.027249] RT35xx: SwitchChannel#1(RF=8, Pwr0=30, Pwr1=25, 2T), N=0xF1, K=0x02, R=0x02 Dec 10 17:02:19 user kernel: [ 8762.170206] RT35xx: SwitchChannel#2(RF=8, Pwr0=30, Pwr1=25, 2T), N=0xF1, K=0x07, R=0x02 Dec 10 17:02:19 user kernel: [ 8762.318211] RT35xx: SwitchChannel#3(RF=8, Pwr0=30, Pwr1=25, 2T), N=0xF2, K=0x02, R=0x02 Dec 10 17:02:19 user kernel: [ 8762.462269] RT35xx: SwitchChannel#4(RF=8, Pwr0=30, Pwr1=25, 2T), N=0xF2, K=0x07, R=0x02 Dec 10 17:02:19 user kernel: [ 8762.606229] RT35xx: SwitchChannel#5(RF=8, Pwr0=30, Pwr1=25, 2T), N=0xF3, K=0x02, R=0x02 Dec 10 17:02:19 user kernel: [ 8762.750202] RT35xx: SwitchChannel#6(RF=8, Pwr0=30, Pwr1=25, 2T), N=0xF3, K=0x07, R=0x02 Dec 10 17:02:20 user kernel: [ 8762.894217] RT35xx: SwitchChannel#7(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF4, K=0x02, R=0x02 Dec 10 17:02:20 user kernel: [ 8763.038202] RT35xx: SwitchChannel#11(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF6, K=0x02, R=0x02 Dec 10 17:02:20 user kernel: [ 8763.040194] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:20 user kernel: [ 8763.040199] BAR(1) : Tid (0) - 03a3:037e Dec 10 17:02:20 user kernel: [ 8763.040387] SYNC - End of SCAN, restore to channel 11, Total BSS[03] Dec 10 17:02:20 user kernel: [ 8763.040400] ScanNextChannel -- Send PSM Data frame Dec 10 17:02:20 user kernel: [ 8763.040402] bFastRoamingScan ~~~~~~~~~~~~~ Get back to send data ~~~~~~~~~~~~~ Dec 10 17:02:20 user kernel: [ 8763.040405] SCAN done, resume MSDU transmission ... Dec 10 17:02:20 user kernel: [ 8763.047022] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:20 user kernel: [ 8763.047026] BAR(1) : Tid (0) - 03a3:03a5 Dec 10 17:02:21 user kernel: [ 8763.898130] bImprovedScan ............. Resume for bImprovedScan, SCAN_PENDING .............. Dec 10 17:02:21 user kernel: [ 8763.898143] SCANNING, suspend MSDU transmission ... Dec 10 17:02:21 user kernel: [ 8763.900245] MlmeScanReqAction -- Send PSM Data frame for off channel RM, SCAN_IN_PROGRESS=1! Dec 10 17:02:21 user kernel: [ 8763.921144] SYNC - BBP R4 to 20MHz.l Dec 10 17:02:21 user kernel: [ 8763.923339] RT35xx: SwitchChannel#8(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF4, K=0x07, R=0x02 Dec 10 17:02:21 user kernel: [ 8763.996019] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:21 user kernel: [ 8764.066221] RT35xx: SwitchChannel#9(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF5, K=0x02, R=0x02 Dec 10 17:02:21 user kernel: [ 8764.210212] RT35xx: SwitchChannel#10(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF5, K=0x07, R=0x02 Dec 10 17:02:21 user kernel: [ 8764.215536] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.215542] BAR(1) : Tid (0) - 0457:0452 Dec 10 17:02:21 user kernel: [ 8764.244000] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.244004] BAR(1) : Tid (0) - 0459:0456 Dec 10 17:02:21 user kernel: [ 8764.253019] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.253023] BAR(1) : Tid (0) - 045c:0458 Dec 10 17:02:21 user kernel: [ 8764.256677] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.256681] BAR(1) : Tid (0) - 045c:045b Dec 10 17:02:21 user kernel: [ 8764.259785] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.259788] BAR(1) : Tid (0) - 045d:045b Dec 10 17:02:21 user kernel: [ 8764.280467] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.280471] BAR(1) : Tid (0) - 045f:045c Dec 10 17:02:21 user kernel: [ 8764.282189] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:21 user kernel: [ 8764.282192] BAR(1) : Tid (0) - 045f:045e Dec 10 17:02:21 user kernel: [ 8764.354204] RT35xx: SwitchChannel#11(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF6, K=0x02, R=0x02 Dec 10 17:02:21 user kernel: [ 8764.356408] ScanNextChannel():Send PWA NullData frame to notify the associated AP! Dec 10 17:02:21 user kernel: [ 8764.498202] RT35xx: SwitchChannel#12(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF6, K=0x07, R=0x02 Dec 10 17:02:21 user kernel: [ 8764.642210] RT35xx: SwitchChannel#13(RF=8, Pwr0=30, Pwr1=28, 2T), N=0xF7, K=0x02, R=0x02 Dec 10 17:02:22 user kernel: [ 8764.790229] RT35xx: SwitchChannel#14(RF=8, Pwr0=30, Pwr1=28, 2T), N=0xF8, K=0x04, R=0x02 Dec 10 17:02:22 user kernel: [ 8764.934238] RT35xx: SwitchChannel#11(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF6, K=0x02, R=0x02 Dec 10 17:02:22 user kernel: [ 8764.935243] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:22 user kernel: [ 8764.935249] BAR(1) : Tid (0) - 048e:0485 Dec 10 17:02:22 user kernel: [ 8764.936423] SYNC - End of SCAN, restore to channel 11, Total BSS[05] Dec 10 17:02:22 user kernel: [ 8764.936436] ScanNextChannel -- Send PSM Data frame Dec 10 17:02:22 user kernel: [ 8764.936440] SCAN done, resume MSDU transmission ... Dec 10 17:02:22 user kernel: [ 8764.940529] RT35xx: SwitchChannel#11(RF=8, Pwr0=29, Pwr1=26, 2T), N=0xF6, K=0x02, R=0x02 Dec 10 17:02:22 user kernel: [ 8764.942178] CntlEnqueueForRecv(): BAR-Wcid(1), Tid (0) Dec 10 17:02:22 user kernel: [ 8764.942182] BAR(1) : Tid (0) - 0493:048e Dec 10 17:02:22 user kernel: [ 8764.942715] CNTL - All roaming failed, restore to channel 11, Total BSS[05] Dec 10 17:02:22 user kernel: [ 8764.948016] MMCHK - No BEACON. restore R66 to the low bound(56) Dec 10 17:02:22 user kernel: [ 8764.948307] ===>rt_ioctl_giwscan. 5(5) BSS returned, data->length = 1111 Dec 10 17:02:23 user kernel: [ 8766.048073] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:23 user kernel: [ 8766.552034] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:27 user kernel: [ 8770.001180] MediaState is connected Dec 10 17:02:27 user kernel: [ 8770.001197] ==>rt_ioctl_giwmode(mode=2) Dec 10 17:02:27 user kernel: [ 8770.001201] ==>rt_ioctl_giwfreq 11 Dec 10 17:02:27 user kernel: [ 8770.001219] rt28xx_get_wireless_stats ---> Dec 10 17:02:27 user kernel: [ 8770.001223] <--- rt28xx_get_wireless_stats Dec 10 17:02:28 user kernel: [ 8771.564020] QuickDRS: TxTotalCnt <= 15, train back to original rate Dec 10 17:02:29 user kernel: [ 8772.064031] QuickDRS: TxTotalCnt <= 15, train back to original rate

    Read the article

  • Error 0x6ba (RPC server is unavailable) when running sfc /scannow on Windows XP in Safe Mode

    - by leeand00
    I think that my mup.sys file is corrupt. I received the following error when trying to access a network share that was located on my Windows 7 box, from my Windows XP box: No network provider accepted the given network path. After reading this I attempted to follow the directions by rebooting my computer into safe mode. After I run "sfc /scannow" I receive the following error message: The specific error code is 0x000006ba [The RPC server is unavailable]. When I go into Services, it says that the Remote Procedure Call (RPC) service is running but that the Remote Procedure Call (RPC) Locator is not running. When I try to start the Remote Procedure Call (RPC) Locator, it gives me an error saying: Error 1084: This service cannot be started in Safe Mode What can I do about this? If it can't find the Remote Procedure Call service in safe mode?

    Read the article

  • Running sfc /scannow provides the error The specific error code is 0x000006ba [The RPC server is una

    - by leeand00
    I think that my mup.sys file is corrupted, I received the following error when trying to access a network share that was located on my Windows 7 box, from my Windows xp box: No network provider accepted the given network path. After reading this I attempted to follow the directions by entering my computer into safe mode. After I run "sfc /scannow" I receive the following error message: The specific error code is 0x000006ba [The RPC server is unavailable]. Additionally when I go into Services, it says that the Remote Procedure Call (RPC) service is running but that the Remote Procedure Call (RPC) Locator is not running. When I try to start the Remote Procedure Call (RPC) Locator, it gives me an error saying: Error 1084: This service cannot be started in Safe Mode So what can I do about this exactly? If it can't find the Remote Procedure Call service in safe mode?

    Read the article

  • Flash in browsers does not play sound accurately using Pulse network audio

    - by Dave M G
    I use PulseAudio to send sound over the LAN to an audio server. When playing any Flash media in Firefox or Chrome, the sound flutters, as if the volume were going up and down every second. The problem does not exhibit with any other software, and I think it's specific to how Flash interacts with my sound set up. How do I get Flash to play nice with the PulseAudio network sound server? Update I have discovered that I can stop the sound fluttering if I follow these steps: Start a Flash video Run pulseaudio --kill on the server Wait about 7 seconds After this, the PulseAudio server automatically respawns, and the sound in the Flash video is perfect. The problem now, though, is that I have to do this every time I start a Flash video. This is obviously not desireable. So, the question is, how do I make whatever it is that makes the sound work when I go through these steps stick so that I don't have to do them? Also, I've uploaded some PulseAudio log output to Pastebin, taken while attempting to play a Flash video, if that helps. I've tried to get logging details from Flash, but despite installing and enabling Flash for debugging, it has not generated any ouput at all. Details I have uploaded an example video of the problem onto Youtube. In the video you can see the opening of a Ted Talk video, and the sound flutters as it plays. The video also stutters while playing back. Here are my sound device output settings:

    Read the article

  • L2TP connection fails!

    - by a.toraby
    I've installed l2tp-ipsec-vpn but when I try to connect to the vpn server I get error 500. Here are the logs: Jun 17 12:54:37.449 ipsec_setup: Stopping Openswan IPsec... Jun 17 12:54:38.858 Stopping xl2tpd: xl2tpd. Jun 17 12:54:38.859 xl2tpd[1511]: death_handler: Fatal signal 15 received Jun 17 12:54:38.872 ipsec_setup: Starting Openswan IPsec U2.6.37/K3.2.0-23-generic... Jun 17 12:54:39.027 ipsec__plutorun: Starting Pluto subsystem... Jun 17 12:54:39.033 ipsec__plutorun: adjusting ipsec.d to /etc/ipsec.d Jun 17 12:54:39.037 recvref[30]: Protocol not available Jun 17 12:54:39.038 xl2tpd[2442]: This binary does not support kernel L2TP. Jun 17 12:54:39.038 xl2tpd[2444]: xl2tpd version xl2tpd-1.3.1 started on atp-ThinkPad-SL410 PID:2444 Jun 17 12:54:39.038 xl2tpd[2444]: Written by Mark Spencer, Copyright (C) 1998, Adtran, Inc. Jun 17 12:54:39.038 xl2tpd[2444]: Forked by Scott Balmos and David Stipp, (C) 2001 Jun 17 12:54:39.038 xl2tpd[2444]: Inherited by Jeff McAdams, (C) 2002 Jun 17 12:54:39.039 xl2tpd[2444]: Forked again by Xelerance (www.xelerance.com) (C) 2006 Jun 17 12:54:39.039 xl2tpd[2444]: Listening on IP address 0.0.0.0, port 1701 Jun 17 12:54:39.040 Starting xl2tpd: xl2tpd. Jun 17 12:54:39.062 ipsec__plutorun: 002 added connection description "L2TP" Jun 17 12:55:30.753 104 "L2TP" #1: STATE_MAIN_I1: initiate Jun 17 12:55:30.754 010 "L2TP" #1: STATE_MAIN_I1: retransmission; will wait 20s for response Jun 17 12:55:30.754 010 "L2TP" #1: STATE_MAIN_I1: retransmission; will wait 40s for response Jun 17 12:55:30.754 003 "L2TP" #1: ignoring Vendor ID payload [MS NT5 ISAKMPOAKLEY 00000008] Jun 17 12:55:30.754 003 "L2TP" #1: received Vendor ID payload [RFC 3947] method set to=109 Jun 17 12:55:30.754 003 "L2TP" #1: received Vendor ID payload [draft-ietf-ipsec-nat-t-ike-02_n] meth=106, but already using method 109 Jun 17 12:55:30.755 003 "L2TP" #1: ignoring Vendor ID payload [FRAGMENTATION] Jun 17 12:55:30.755 003 "L2TP" #1: ignoring Vendor ID payload [MS-Negotiation Discovery Capable] Jun 17 12:55:30.755 003 "L2TP" #1: ignoring Vendor ID payload [IKE CGA version 1] Jun 17 12:55:30.755 106 "L2TP" #1: STATE_MAIN_I2: sent MI2, expecting MR2 Jun 17 12:55:30.755 010 "L2TP" #1: STATE_MAIN_I2: retransmission; will wait 20s for response Jun 17 12:55:30.755 003 "L2TP" #1: NAT-Traversal: Result using RFC 3947 (NAT-Traversal): i am NATed Jun 17 12:55:30.755 108 "L2TP" #1: STATE_MAIN_I3: sent MI3, expecting MR3 Jun 17 12:55:30.756 004 "L2TP" #1: STATE_MAIN_I4: ISAKMP SA established {auth=OAKLEY_PRESHARED_KEY cipher=oakley_3des_cbc_192 prf=oakley_sha group=modp1024} Jun 17 12:55:30.756 117 "L2TP" #2: STATE_QUICK_I1: initiate Jun 17 12:55:30.756 010 "L2TP" #2: STATE_QUICK_I1: retransmission; will wait 20s for response Jun 17 12:55:30.756 003 "L2TP" #2: ignoring informational payload, type IPSEC_RESPONDER_LIFETIME msgid=6b03ff69 Jun 17 12:55:30.756 003 "L2TP" #2: NAT-Traversal: received 2 NAT-OA. ignored because peer is not NATed Jun 17 12:55:30.756 003 "L2TP" #2: our client subnet returned doesn't match my proposal - us:192.168.1.3/32 vs them:109.162.174.235/32 Jun 17 12:55:30.757 003 "L2TP" #2: Allowing questionable proposal anyway [ALLOW_MICROSOFT_BAD_PROPOSAL] Jun 17 12:55:30.757 004 "L2TP" #2: STATE_QUICK_I2: sent QI2, IPsec SA established transport mode {ESP=>0x23af21f8 <0xdb4a87b6 xfrm=AES_128-HMAC_SHA1 NATOA=none NATD=none DPD=none} Jun 17 12:55:31.759 xl2tpd[2444]: Connecting to host x.x.x.x, port 1701 Jun 17 12:55:32.021 xl2tpd[2444]: Connection established to x.x.x.x, 1701. Local: 4720, Remote: 200 (ref=0/0). Jun 17 12:55:32.023 xl2tpd[2444]: Calling on tunnel 4720 Jun 17 12:55:32.454 xl2tpd[2444]: Call established with x.x.x.x, Local: 9667, Remote: 3, Serial: 1 (ref=0/0) Jun 17 12:55:32.456 xl2tpd[2444]: start_pppd: I'm running: Jun 17 12:55:32.456 xl2tpd[2444]: "/usr/sbin/pppd" Jun 17 12:55:32.457 xl2tpd[2444]: "passive" Jun 17 12:55:32.458 xl2tpd[2444]: "nodetach" Jun 17 12:55:32.458 xl2tpd[2444]: ":" Jun 17 12:55:32.459 xl2tpd[2444]: "file" Jun 17 12:55:32.459 xl2tpd[2444]: "/etc/ppp/L2TP.options.xl2tpd" Jun 17 12:55:32.460 xl2tpd[2444]: "ipparam" Jun 17 12:55:32.461 xl2tpd[2444]: "x.x.x.x" Jun 17 12:55:32.462 xl2tpd[2444]: "/dev/pts/1" Jun 17 12:55:32.583 pppd[2711]: Plugin passprompt.so loaded. Jun 17 12:55:32.583 pppd[2711]: pppd 2.4.5 started by root, uid 0 Jun 17 12:55:32.619 pppd[2711]: Using interface ppp0 Jun 17 12:55:32.620 pppd[2711]: Connect: ppp0 <--> /dev/pts/1 Jun 17 12:55:33.693 pppd[2711]: /usr/bin/L2tpIPsecVpn exited with code 0 Jun 17 12:55:34.454 [ERROR 404] Authentication failed: closing connection to 'L2TP' Jun 17 12:55:34.456 pppd[2711]: MS-CHAP authentication failed: E=691 Authentication failure Jun 17 12:55:34.457 pppd[2711]: CHAP authentication failed Jun 17 12:55:34.461 Stopping xl2tpd: xl2tpd. Jun 17 12:55:34.462 xl2tpd[2444]: death_handler: Fatal signal 15 received Jun 17 12:55:34.463 pppd[2711]: Modem hangup Jun 17 12:55:34.463 pppd[2711]: Connection terminated. Jun 17 12:55:34.474 ipsec_setup: Stopping Openswan IPsec... Jun 17 12:55:34.482 pppd[2711]: Exit. Jun 17 12:55:35.587 ipsec_setup: ERROR: Module xfrm4_mode_transport is in use Jun 17 12:55:35.665 ipsec_setup: ERROR: Module esp4 is in use I had this problem by ubuntu 11.10 though I can easily connect to the server from windows. I use ubuntu 12.0 64bit

    Read the article

< Previous Page | 73 74 75 76 77 78 79 80 81 82 83 84  | Next Page >