Search Results

Search found 75091 results on 3004 pages for 'person who needs help'.

Page 788/3004 | < Previous Page | 784 785 786 787 788 789 790 791 792 793 794 795  | Next Page >

  • How to use a local Leopard Server Mail server acting "like" an Exchange mail server

    - by Richard Chevre
    We have a local Exchange 2003 server (company .local) who is collecting POP3 mail accounts on a distant (company .com) mailserver. The mails are collected by the Exchange server every 5-10 minutes and stored locally (on company .local), so the users can read them without going on the "real" mail server (company.com) What was explaned to me is that the mail collection is made with POP Now we are migrating on Snow Leopard Server. We have chosen to use a new extension for our local domain: .leo So our mailserver's FQDN is mail.company.leo, and the users have a user [email protected] formated mail address. A) All works fine except that I can't find how to tell the mail.company.leo that he must retreive the mails from the "real" public server (mail.company.com) I'm hoping to use IMAP and not POP. I can send mail using SMTP relay from mail.company.leo but (I know it's trivial) answering is not possible, even if I specify the reply-to as [email protected] (this seems to be related to A) ) I don't know if it's very complicated (I suspect not, but...) to achieve what I want to do, and I'm not a genius. But as I'm a little bit lost, I hopesomebody can or will help me. Solving this will allow us to use iCal invitations too, so a lot of services depends of these mailserver settings Some of you discuss the fact thta we choose to use a "new" tld with the .leo extension. We have no problem for that, we could use .local. no problem ;) We used .leo instead of .local just to differentiate the two systems (Exchange and SnowLeopardServer). The question was not about that, it was just to know if we can set a SnowLeopard mail server to act like an Exchange Server. Again thank you for your advice and help Richard Thanks in advance Richard

    Read the article

  • mysql startup, shtudown and logging on osx

    - by Joelio
    Hi, I am trying to troubleshoot some mysql problems (I have a table I cant seem to delete or drop, it hangs forever) I have 10.5.8 osx, I dont remember how/if I installed mysql, here is what I know: it automatically starts on boot the process looks like this: /usr/local/mysql/libexec/mysqld --basedir=/usr/local/mysql --datadir=/usr/local/mysql/var --pid-file=/usr/local/mysql/var/Joels-New-Pro.local.pid _mysql 96 0.0 0.0 75884 684 ?? Ss Sat06PM 0:00.02 /bin/sh /usr/local/mysql/bin/mysqld_safe when I run: /usr/local/mysql/libexec/mysqld --verbose --help it says: /usr/local/mysql/libexec/mysqld Ver 5.0.45 for apple-darwin9.1.0 on i686 (Source distribution) it seems to use my.cnf from /etc/my.cnf Now here are my questions: I dont see anything in the startupitems that remotely looks like mysql ls /Library/StartupItems/ BRESINKx86Monitoring ChmodBPF HP IO HP Trap Monitor Parallels ParallelsTransporter 1.) So how does it startup automatically? 2.) How do I start & stop this type of installation? Also, looking at the config, the logs have no values: /usr/local/mysql/libexec/mysqld --verbose --help|grep '^log' log (No default value) log-bin (No default value) log-bin-index (No default value) log-bin-trust-function-creators FALSE log-bin-trust-routine-creators FALSE log-error log-isam myisam.log log-queries-not-using-indexes FALSE log-short-format FALSE log-slave-updates FALSE log-slow-admin-statements FALSE log-slow-queries (No default value) log-tc tc.log log-tc-size 24576 log-update (No default value) log-warnings 1 3.) Does that mean there is no logging enabled in mysetup? thanks in advance! Joel

    Read the article

  • JAVASCRIPT ENABLED

    - by kirchoffs415
    HI, I hope somebody can help, i keep getting the following message when i log on-- Your Javascript is disabled. Limited functionality is available. it will stay for maybe a day sometimes two.I have uninstalled javascript and reinstalled but still the same. Iam using chrome. any help would be gratefull many thanks Dominic p.s. my system spec is as follows System InformationOS Name Microsoft® Windows Vista™ Home Premium Version 6.0.6002 Service Pack 2 Build 6002 Other OS Description Not Available OS Manufacturer Microsoft Corporation System Name DOM-PC System Manufacturer Dell Inc. System Model Inspiron 1545 System Type X86-based PC Processor Pentium(R) Dual-Core CPU T4200 @ 2.00GHz, 2000 Mhz, 2 Core(s), 2 Logical Processor(s) BIOS Version/Date Dell Inc. A05, 25/02/2009 SMBIOS Version 2.4 Windows Directory C:\Windows System Directory C:\Windows\system32 Boot Device \Device\HarddiskVolume3 Locale United Kingdom Hardware Abstraction Layer Version = "6.0.6002.18005" User Name DOM-PC\DOM Time Zone GMT Standard Time Installed Physical Memory (RAM) 3.00 GB Total Physical Memory 2.96 GB Available Physical Memory 1.38 GB Total Virtual Memory 5.89 GB Available Virtual Memory 4.25 GB Page File Space 3.00 GB Page File C:\pagefile.sys My System Specs

    Read the article

  • Event Log: atapi - the device did not respond within the timeout period - Freeze

    - by rjlopes
    Hi, I have a Windows Server 2003 that stops working randomly (displays image on monitor but is completely frozen), all I could found on the event log as causes were an error from atapi and a warning from msas2k3. The event log entries are: Event Type: Error Event Source: atapi Event Category: None Event ID: 9 Date: 22-07-2009 Time: 16:13:33 User: N/A Computer: SERVER Description: The device, \Device\Ide\IdePort0, did not respond within the timeout period. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 64 00 ......d. 0008: 00 00 00 00 09 00 04 c0 .......À 0010: 01 01 00 50 00 00 00 00 ...P.... 0018: f8 06 20 00 00 00 00 00 ø. ..... 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 01 00 00 00 ........ 0030: 00 00 00 00 07 00 00 00 ........ Event Type: Warning Event Source: msas2k3 Event Category: None Event ID: 129 Date: 22-07-2009 Time: 16:14:23 User: N/A Computer: SERVER Description: Reset to device, \Device\RaidPort0, was issued. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 68 00 ......h. 0008: 00 00 00 00 81 00 04 80 ......? 0010: 04 00 00 00 00 00 00 00 ........ 0018: 00 00 00 00 00 00 00 00 ........ 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 00 00 00 00 ........ 0030: 01 00 00 00 81 00 04 80 ......? Any hints?

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Can I have a single solid state drive and a RAID array on the same machine?

    - by jaminto
    Hi- To summarize, i'm looking to use a single solid state drive as my primary drive, and two conventional sata drives in a RAID 1 configuration for data. I am trying to install 64-bit Windows 7 onto this configuration. Is this possible? Here are the details: I built a desktop that has been running 64-bit Vista on two 500Gb in a RAID 1 array for a few years. I just purchased an Intel X25-M 80Gb Sata Solid-State Drive, and was planning on using this a my primary drive, and keeping the RAID 1 array as my data drive. I added the SSD drive and in the RAID setup, configured it as a RAID 0 array of only one disk. Then, I tried to do a clean install of windows 7 64-bit, but got stuck in the "Missing driver for CD/DVD drive" black hole of selecting driver files and Windows telling me that i don't have the appropriate driver for my hardware. The missing hardware is NOT a CD/DVD drive, since i'm installing off of my only CD/DVD drive. Plus at one point i was able to point it at a driver for my raid controller, and then my hard drives magically showed up as browsable sources for finding drivers for some other unnamed device that setup couldn't recognize. After a few hours of trying drivers (this was a very slow process) i decided to reboot and look at the BIOS settings. I'm using an ASUS M2A-VM motherboard which has an ATI SB600 RAID controller on board. I switched the "On board SATA Type" setting from "SATA" to "AHCI" thinking that since AHCI is an Intel thing, this would help. Unfortunately, this abandoned my RAID configuration, and my previously mirrored drives are showing up as separate drives when i boot into my current windows installation. Am i trying to do the impossible here? Should i just buy a separate SATA/RAID PCI card and plug the SSD into that? Any help would be greatly appreciated.

    Read the article

  • Atlassian Crucible very slow on large repository

    - by Mitch Lindgren
    Hi everyone, My company has been running a trial of Atlassian Crucible for some months now. For repositories where it's working properly, users have given very positive feedback about the tool. The problem I'm having is that we have several different projects, each with its own repository, and some of those repositories are very large. One repository in particular has a large number of branches and probably around 9,000 files per branch. Browsing that repository in Crucible is extremely slow. Crucible is running on a CentOS VM. The VM has 4GB of RAM, and I've set Crucible's maximum at 3GB, of which it is currently using 2GB. I've brought this up in a support ticket with Atlassian, and they suggested the following: In particular because you have a rather large SVN repository you will likely find that Fisheye will be creating a large index file on disk. To help improve performance a few things you can try are: Increasing the available memory available to Fisheye (see the document above). Migrating to an external database: confluence.atlassian.com/display/FISHEYE/Migrating+to+an+External+Database Excluding files and directories from your index that aren't needed: confluence.atlassian.com/display/FISHEYE/Allow+(Process) (Sorry for not hyperlinking; don't have the rep.) I've tried all of these things to an extent, but so far none have helped greatly. I was originally running Crucible on a Windows box with 2GB of RAM using the built in HSQL DB. Moving to MySQL on CentOS saw a performance increase for some repositories, and made Crucible much more stable, but did not seem to help much with our biggest repository. There are only so many files/branches I can exclude from indexing while maintaining the tool's usefulness. That being the case, does anyone have any tips on how to speed up Crucible on large repositories, without investing in insanely powerful hardware? Thanks! Edit: To clarify, since I didn't mention it explicitly above, I am using FishEye.

    Read the article

  • Visual Studio 2005 won't install on Windows 7

    - by Peanut
    Hi, My question relates very closely to this question: http://superuser.com/questions/34190/visual-studio-2005-sp1-refuses-to-install-in-windows-7 However this question hasn't provided the answer I'm looking for. I'm trying to install Visual Studio 2005 onto a clean Windows 7 (64 bit) box. However I keep getting the following error when the 'Microsoft Visual Studio 2005' component finishes installing ... Error 1935.An error occurred during the installation of assembly 'policy.8.0.Microsoft.VC80.OpenMP,type="win32-policy",version="8.0.50727.42",publicKeyToken="1fc8b3b9a1e18e3b",processorArchitecture="x86",Please refer to Help and Support for more information. HRESULT: 0x80073712. On my first attempt to install VS 2005 I got a warning about compatibility issues. I stopped at this point, downloaded the necessary service packs and restarted the installation from the beginning. Every since then I just get the error message above. I keep rolling back the installation and trying again ... it's but always the same error. Any help would be very much appreciated. Thanks.

    Read the article

  • Troubleshooting wireless connection problem / site survey?

    - by johnnyb10
    I just started in the IT department of a small company (200 users) and it's clear that one of the main problems that is driving everyone crazy is the spotty nature of the wireless connectivity throughout the office, particularly in certain conference rooms. This is a huge problem because the connection often drops during important presentations to clients. I was hired to help ease the load on the existing IT admin, who has done a great job, but is overloaded with many other tasks to deal with. So I would like to try to help out with this wireless issue. I am looking for advice on the best way to solve this problem--a realistic troubleshooting methodology that does not require me to spend any money. So far, I've experimented with Ekahau Heat Mapper, which is free and helps create a site survey. But I'm not exactly sure what I'm looking for or if there are other programs/tools/methods I should try as well. Any advice would be greatly appreciated. [Some background: The wireless setup consists of an HP ProCurve Mobility MSM (710?) controller that controls 10 access points throughout the building. There are three virtual wireless networks configured on the controller: one seems to be a default that cannot be changed, one is for internal employees and authenticates via Active Directory, and the third is a guest network for visitors. When I use HeatMapper, these show up as three different SSIDs, with different MAC addresses, all on the same channel. At first I thought maybe this would cause interference, but this seems to be the way the controller works;apparently, it automatically configures the channels to avoid interference from the other APs on the network.]

    Read the article

  • How can I manually install pecl_http on Ubuntu 9.10?

    - by Richard
    This is essentially a repost of http://stackoverflow.com/questions/4159369/ubuntu-9-04-pecl-extension-downloads-but-does-not-install. Hoping maybe someone can help me here. I've done this: sudo apt-get install php-pear sudo apt-get install php5-dev sudo apt-get install libcurl3-openssl-dev which installs fine. However, the next step: sudo pecl install pecl_http Doesn't install the extension, but merely downloads it. There are no error messages. So I have unpacked it and built it myself per http://php.net/manual/en/install.pecl.phpize.php Essentially: cd pecl_http phpize ./configure make make install I also make test'd to check all ok - and it failed one test: HttpRequest, which is kind of fundamental to this package. And indeed this doesn't work: $r = new HttpRequest('http://www.google.com'); $r->send; echo $r->getResponseCode(); No request is sent, the response code is zero, but no errors either. How can I get this damn thing installed? Is this a bug? Am I doing something wrong? Any alternatives, workarounds? Help appreciated. Thanks

    Read the article

  • Problems sending email using .Net's SmtpClient

    - by Jason Haley
    I've been looking through questions on Stackoverflow and Serverfault but haven't found the same problem mentioned - though that may be because I just don't know enough about how email works to understand that some of the questions are really the same as mine ... here's my situation: I have a web application that uses .Net's SmtpClient to send email. The configuration of the SmtpClient uses a smtp server, username and password. The SmtpClient code executes on a server that has an ip address not in the domain the smtp server is in. In most cases the emails go without a problem - but not AOL (and maybe others - but that is one we know for sure right now). When I look at the headers in the message that was kicked back from AOL it has one less line than the successful messages hotmail gets: AOL Bad Message: Received: from WEBSVRNAME ([##.###.###.###]) by domainofsmtp.com with MailEnable ESMTP; Mon, 18 Jun 2012 09:48:24 -0500 MIME-Version: 1.0 From: "[email protected]" <[email protected]> ... Good Hotmail Message: Received: from mail.domainofsmtp.com ([###.###.###.###]) by subdomainsof.hotmail.com with Microsoft SMTPSVC(6.0.3790.4900); Thu, 21 Jun 2012 09:29:13 -0700 Received: from WEBSVRNAME ([##.###.###.###]) by domainofsmtp.com with MailEnable ESMTP; Thu, 21 Jun 2012 11:29:03 -0500 MIME-Version: 1.0 From: "[email protected]" <[email protected]> ... Notice the hotmail message headers has an additional line. I'm confused as to why the Web server's name and ip address are even in the headers since I thought I was using the SmtpClient to go through the smtp server (hence the need for the username and password of a valid email box). I've read about SPFs, DKIM and SenderID's but at this point I'm not sure if I would need to do something with the web server (and its ip/domain) or the domain the smtp is coming from. Has anyone had to do anything similiar before? Am I using the smtp server as a relay? Any help on how to describe what I'm doing would also help.

    Read the article

  • Slow upload speeds with pfsense virtual appliance

    - by Justin Shin
    I have a pfSense virtual appliance set up in front of a Windows server. The pfSense appliance has been configured with two L2L IPSec VPN sites and not too much else. The appliance has two vNics which both exist on the same VLAN, but one is "WAN" and the other is "LAN." When I run speedtest.net on my Windows server when I have configured it to use a static WAN address and gateway, I get great speeds - maybe around 50 down, 15 up. However, when I configure it with a private IP address, I get similar download speeds but terrible upload speeds - around 2 or 3 Mbps consistently. I used Wireshark to see what gives but there didn't appear to be too much helpful information there, or I just could not find it. Besides the L2L VPNs, other configurations include: Automatic Outbound NAT Virtual P-ARP IP for the Windows Server WAN Firewall rule to allow * to * on RDP WAN Firewall rule to allow * to * (enabled this just for testing... didn't help!) No DHCP or any other services besides IPSec VPN No Errors LAN or WAN No collisions LAN or WAN I would be happy to post the full config file if it would help. I've been scratching my head at this one all day!

    Read the article

  • What causes "A disk read error occurred, Press Ctrl + Alt + Del to restart"?

    - by Mehrdad
    I have a virtual machine containing Windows XP SP3. When I resized the VHD file (and the embedded partition), and tried booting, I got: A disk read error occurred Press Ctrl + Alt + Del to restart Some notes: FixBoot and FixMBR don't help. ChkDsk doesn't help. The partition is indeed active. The partition starts at sector 63 (it also did so before the problem) of cylinder 1, head 1, and is marked as type 0x07 (NTFS) My host OS reads the VHD and the partition completely fine I'm interested in knowing the cause rather than the fix. So "re-format the disk", "reinstall Windows", etc. aren't valid solutions. It's a virtual machine after all... I have nothing to lose, so I don't care about fixing it. I just want to know what's causing this problem, in case I run into it again on a physical machine (which I have done before). More info: The layout of the original, dynamic VHD (which works correctly): +-----------------------------------------------------------------------------+ ¦ Disk: 3 MBR/GPT: MBR ¦ ¦ Size: 127.00GB CHS: 16578 255 63 ¦ ¦ Sectors: 266338304 Disk Signature: 0xEE3EEE3E ¦ ¦ Partitions: 1 Partition Order: 1 ¦ ¦ Media Type: Fixed Interface: SCSI ¦ ¦ Description: Msft Virtual Disk ¦ +-----------------------------------------------------------------------------¦ ¦Pos Idx Type/Name Size Boot Hide Start Sector Total Sectors DL Vol Label ¦ +--- --- --------- ---- ---- ---- -------------- -------------- -- -----------¦ ¦ 1 1 07-NTFS 1.5G Yes No 63 3,148,677 F: <None> ¦ +-----------------------------------------------------------------------------+ The layout of the resized, fixed-size VHD (which doesn't work): +-----------------------------------------------------------------------------+ ¦ Disk: 3 MBR/GPT: MBR ¦ ¦ Size: 1.50GB CHS: 196 255 63 ¦ ¦ Sectors: 3149824 Disk Signature: 0xEE3EEE3E ¦ ¦ Partitions: 1 Partition Order: 1 ¦ ¦ Media Type: Fixed Interface: SCSI ¦ ¦ Description: Msft Virtual Disk ¦ +-----------------------------------------------------------------------------¦ ¦Pos Idx Type/Name Size Boot Hide Start Sector Total Sectors DL Vol Label ¦ +--- --- --------- ---- ---- ---- -------------- -------------- -- -----------¦ ¦ 1 1 07-NTFS 1.5G Yes No 63 3,148,677 F: <None> ¦ +-----------------------------------------------------------------------------+

    Read the article

  • win8: access denied to external USB disk; update access rights fails

    - by Gerard
    I use to work with 2 laptops (vista and win7), my work being files on an external usb disk. My oldest laptop broke down, so I bought a new one. I had no option other than take win8. 1/ I suspect something changed with access rights, as my external disk suffered some "access denied" problem on win8. I was prompted (by win8) somehow to fix the access rights, which I tried to do, getting to the properties - security. This process was very slow and ended up saying "disk is not ready". Additonnally, the usb somehow was not recognized anymore. 2/ Back to win7, I was warned that my disk needed to be verified, which I did. In this process, some files were lost (most of them i could recover from the folder found00x, but I have some backup anyway). Also, I don't know why, but under win7, all the folder showed with a lock. 3/ Then back again to win8. Same problem : access denied to my disk + no way to change access rights as it gets stuck "disk is not ready". Now I am pretty sure there is some kind of bug or inconsistence in win8 / win7. I did 2/ and 3/ a few times. At some point, I also got an access denied in win7. I could restore access rigths to the disk to "system" (properties - security - EDIT for full control to group "system" ...). But then I still get the same access right pb on win8, and getting stuck in the process to restore full control to "system" -- and "admin" groups. Now, after I tried for more than 3 days, I am losing my patience with that bloody win8 which I did not want to buy but had no choice. I upgraded win8 with the windows updates available. Does not help. Anybody can help me ?

    Read the article

  • Installed Paragon HFS+ for Windows 8, now my pc won't recognize the external firewire drive

    - by Steve
    I'm not incredibly knowledgeable about computers and I really need some help. Just got a Seagate external firewire drive this morning. I downloaded the necessary pc driver (Paragon HFS+ for Windows 8) through their website per the instructions that came with the drive. After installation, I restarted and the pc recognized the firewire drive just fine. About three hours into copying files from my pc to the firewire drive, it gave me an error and told me the files couldn't be copied. When I clicked to get out of the message, the computer crashed. After an hour of it trying to repair itself in safe mode, it restored me to an earlier version before the system crashed. Here's my current dilemma: The Paragon HFS+ is still showing up in my programs as installed, but the Device Manager is not recognizing the drive. When I try to uninstall and reinstall Paragon, it interrupts me with a message saying "The setup must update files or services that cannot be updated while the system is running" and basically gives me the finger. I have no idea what to do now, as it won't let me uninstall and reinstall Paragon, and I have no idea why it crashed my computer in the first place. Is there possibly another Mac - PC firewire driver I can try downloading instead? I really don't know what I'm doing and any help would be greatly appreciated.

    Read the article

  • Setting up a Pagefile and Partition in Server 2008

    - by Brett Powell
    I am setting up 18 new machines for our company, and I have instructions from my new boss on setting up a Pagefile and Partition. I have looked at their existing machines to base the new setups off of, but there is no consistency between any 2 machines, which has left me extremely frustrated to say the least. My instructions are... 1) Set a static pagefile (use recommended value as max/min), set it on SSD if SSD available. 2) Make 3 partitions: C: is used for OS and install files D: is used for backups on machines with a SSD. On machines without SSD create a D: partition for pagefile (2*installed RAM for partition size) E: must be the partition hosting user files I have never messed with Pagefiles before, and looking at their existing machines is offering no help. My questions are... 1) As the machines I am setting up have no SSD (just 2 SATA drives) does it sound like the Pagefile should be setup on the C: (primary) drive or the D:? The instructions are vague so I have no idea. 2) As C: and D: are both Physical drives, does it sound like C: should be partitioned out to create the E: drive or D:? Thanks for any help I can get. I am extremely stressed out under a massive workload right now, and these vague instructions are quite infuriating.

    Read the article

  • MMC crashes on Windows Server 2008 x64 - Exchange console, event viewer

    - by David M Williams
    Help! I don't know what happened; this server has been very reliable but suddenly began having problems with a particular .NET 2.0 web site simply hanging - it wouldn't load at all. However, another ASP.NET site was still fine. Reinstalling the site didn't fix it, nor did deleting and re-creating the application within IIS. Trying the event viewer was met with a horrifying "Microsoft Management Console has stopped working". Some Googling led me to believe the .NET framework was the problem. I found a tool called the .NET cleanup tool - http://blogs.msdn.com/astebner/pages/8904493.aspx - which cleaned out .NET entirely. I reinstalled .NET 1.1 and 3.5 (which installed 2.0 and 3.0 as well). Using the .NET verification tool - http://blogs.msdn.com/astebner/pages/8999004.aspx - I believe these have all installed ok. However, my server is in worse shape now. The Exchange 2010 Management Console crashes with an MMC error and now my other (previously reliable) .NET web app now hangs on loading too. I thought I should use Computer Management to remove and re-add the application and web server roles but sure enough, MMC crashes. If anyone can help I will be extremely grateful. Thank you !

    Read the article

  • Magento Apache Config & Memory Issues

    - by cheshirepine
    I have a Magento installation on a VPS that is giving me a headache. This particular VPS has a reasonable spec - 2gb Memory and 50gb storage. It runs a single domain, with a single Magento install - and nothing else. About 5 months ago we started having issues. Every so often (about once every 2 or 3 weeks) the VPS would crash - all processes stopped and the only way to restart the container is via Virtuozzo. Now, however its 2 or 3 times a week. My VPS hosts confirm I am breaching the 2gb memory limit, at which point all VPS processes are killed to stop it bringing the entire node down. I have not made any config changes to it at all - I was running New Relic on it for a short while, but have removed that in case it was contributing to the issues. I can see nothing in the logs which indicates an issue and we have no CRON jobs running at the time the crashes happen. The site generates steady, but not huge amounts of traffic (averaging usually less than 100 visits per day) Is there anything in particular I should have done to the Apache or PHP configs to help? Im not a massivley experienced Apache admin, but know more than enough to solve most problems... Failing that, any other ideas that might help? Can't afford for this site to be down this much.

    Read the article

  • Can't Login to phpPgAdmin

    - by Devin
    I'm trying to set up phpPgAdmin on my test machine so that I can interface with PostgreSQL without always having to use the psql CLI. I have PostgreSQL 9.1 installed via the RPM repository, while I installed phpPgAdmin 5.0.4 "manually" (by extracting the archive from the phpPgAdmin website). For the record, my host OS is CentOS 6.2. I made the following configuration changes already: PostgreSQL Inside pg_hba.conf, I changed all METHODs to md5. I gave the postgres account a password I added a new account named webuser with a password (note that I did not do anything else to the account, so I can't exactly say that I know what permissions it has and all) phpPgAdmin config.inc.php Changed the line $conf['servers'][0]['host'] = ''; to $conf['servers'][0]['host'] = '127.0.0.1'; (I've also tried using localhost as the value there). Set $conf['extra_login_security'] to false. Whenever I try to log in to phpPgAdmin, I get "Login failed", even if I use successful credentials (ones that work in psql). I've tried to go through some of the steps noted in Question 3 in the FAQ, but it hasn't worked out well so far there. It likely does not help that this is my first day working with PostgreSQL. I'm farily familiar with MySQL, but I have to use PostgreSQL for the project I'm working on. Could anyone offer some help for how to set up phpPgAdmin on CentOS 6.2? If I've done something terribly wrong in my configuration so far, it's no big deal to blow something/everything away, as it's not like I've stored any data there yet! I appreciate any insight you may have!

    Read the article

  • Cannot Delete Item "Could Not Find This Item" issue

    - by aronchick
    A friend sent a long a file (a .rar) he wanted me to check out for him before he installed it. I downloaded it and unrared it with no problems, but it was full of .exe's instead of the intended contents (fonts) so I advised him to delete it immediately and not use. I then proceeded to do the same, but the folder simply will not delete. Oddly the files went fine, and I never ran anything, but this is what I'm seeing: Could not find this item This is no longer located in C:\Users\This_User\Desktop. verify the item's location and try again. I've tried the following things with no help: Using "Unlocker" to Unlock and delete Using move on reboot and rebooting Using PendMoves (from sysinternals) and rebooting Elevating a cmd line, doing a dir /x to get the short name of the folder, and then del 'shortna~1' Moving the folder to a new folder and then trying to delete the parent folder I'm on Windows 7 RTM, very fresh install. Any thoughts? Update: Just to confirm, I've run Hijack this and half a dozen other malware detectors, and everything came back clean (no extra processes, no other obvious badness). Rebooting in safe mode didn't help either.

    Read the article

  • Passenger not booting Rails App

    - by firecall
    I'm at the end of ability, so time to ask for help. My hosting company are moving me to a new server. I've got my own VPS. It's a fresh CentOS 5 install with Plesk 9.5.2 Essentially Passenger just doesnt seem to be booting the Rails app. It's like it doesnt see it's a Rails app to be booted. I've got Rails 3.0 install with Ruby 1.9.2 built from source. I can run Bundle Install and that works. I've currently got Passenger 3 RC1 installed as per here, but have tried v2 as well. My conf/vhost.conf file looks like this: DocumentRoot /var/www/vhosts/foosite.com.au/httpdocs/public/ RackEnv development #Options Indexes I've got a /etc/httpd/conf.d/passenger.conf file which looks like this: LoadModule passenger_module /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4/ext/apache2/mod_passenger.so PassengerRoot /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4 PassengerRuby /usr/local/bin/ruby PassengerLogLevel 2 and all I get is a 403 forbidden or the directory listing if I enable Indexes. I dont know what else to do! Yikes. There's nothing in the Apache error log that I can see. The new server admin isnt much help as I think he's a bit junior and says he doesnt know about Rails... sigh :/ I'm a programmer and server admin isnt my bag :(

    Read the article

  • emacs error: "Symbol's value as variable is void: hostname"

    - by Florian Pilz
    After I installed emacs this error occurs every time on startup. It prevents me from installing plugins, e.g. auctex via aptitude. I already tried to install a plugin by hand (rails for ruby), but doesn't work. The error doesn't contain the message "hostname", but the hostname of my PC is displayed ("bloodredangel-ubuntu"). I changed my hostname to "bloodredangel", but the error message stays the same. While I changed my hostname I saw that in /etc/hostname were two entries: 127.0.0.1 bloodredangel-ubuntu I already asked this question in an ubuntu forum but they couldn't help. They recognised an misconfigured /etc/hosts file, which I corrected, but from time to time these incorrect configurations get attached by something. I didn't add them by hand, maybe it has something to do with the issue. The misconfigurations looked like this: 127.0.0.1 127.0.0.1 bloodredangel-ubuntu localhost.localdomain localhost 127.0.0.1 127.0.0.1:8080 bloodredangel-ubuntu localhost.localdomain localhost I didn't found a solution on the internet, so I hope I will find help here finally.

    Read the article

  • GRE Tunnel over IPsec with Loopback

    - by Alek
    I'm having a really hard time trying to estabilish a VPN connection using a GRE over IPsec tunnel. The problem is that it involves some sort of "loopback" connection which I don't understand -- let alone be able to configure --, and the only help I could find is related to configuring Cisco routers. My network is composed of a router and a single host running Debian Linux. My task is to create a GRE tunnel over an IPsec infrastructure, which is particularly intended to route multicast traffic between my network, which I am allowed to configure, and a remote network, for which I only bear a form containing some setup information (IP addresses and phase information for IPsec). For now it suffices to estabilish a communication between this single host and the remote network, but in the future it will be desirable for the traffic to be routed to other machines on my network. As I said this GRE tunnel involves a "loopback" connection which I have no idea of how to configure. From my previous understanding, a loopback connection is simply a local pseudo-device used mostly for testing purposes, but in this context it might be something more specific that I do not have the knowledge of. I have managed to properly estabilish the IPsec communication using racoon and ipsec-tools, and I believe I'm familiar with the creation of tunnels and addition of addresses to interfaces using ip, so the focus is on the GRE step. The worst part is that the remote peers do not respond to ping requests and the debugging of the general setup is very difficult due to the encrypted nature of the traffic. There are two pairs of IP addresses involved: one pair for the GRE tunnel peer-to-peer connection and one pair for the "loopback" part. There is also an IP range involved, which is supposed to be the final IP addresses for the hosts inside the VPN. My question is: how (or if) can this setup be done? Do I need some special software or another daemon, or does the Linux kernel handle every aspect of the GRE/IPsec tunneling? Please inform me if any extra information could be useful. Any help is greatly appreciated.

    Read the article

  • Fedora 17 - Dropping into debug shell after attempted partitioning

    - by i.h4d35
    So I tried creating a new partition on Fedora 17 using fdisk as follows: Command (m for help): n Command action e extended p primary partition (1-4) p Partition number (1-4): 1 First cylinder (2048-823215039, default 2048): Using default value 2048 Last cylinder or +size or +sizeM or +sizeK (1-9039, default 9039): +15G Once this was done,instead of formatting the partition I created, I ran the partprobe command to write the changes to the partition table. On rebooting the computer, it drops to the debug shell and gives me the error as follows: dracut warning:unable to process initqueue dracut warning:/dev/disk/by-uuid/vg_mymachine does not exist dropping to debug shell dracut:/# While trying to run fsck on the said partition from the debug shell, it says "etc/fstab not found" and inside /etc I see a fstab.empty file. Is it now possible to retrieve what I have from the computer? Any help would be appreciated. Thanks in advance Edit: I've also tried the following steps for additional troubleshooting: I tried to boot using the Fedora disk and tried the rescue mode - says no Linux partition detected. I tried to create an fstab file by combining the entries from blkid and the /etc/mtab file and using the UUIDs from the mtab file - It didn't work. As soon as I rebooted the machine, it promptly dropped me in to the debug shell and the fstab file which i created wansn't there anymore in /etc (part of this solution)

    Read the article

  • How do i tell if my drivers are up to date on Acer?

    - by joe
    Hoping some kind souls can help me out ? I got a blue screen the other day after trying to load sandboxie. So its obviously conflicting with something. I checked if my drivers were up to date on my acer aspire one AOD270 on this intel based site; http://www.drivermanager.com/en/down...tel&Logo=intel Its showing i have 2 drivers that need updating ; Intel NM10 Express chipset and the Realtek PCIE Cardreader. I have no idea whether to do the update via the Intel Driver update site or the Acer drivers download page? I then ran Bluescreenview and on the dump file its showing ; ''caused by driver'' igdkmd32.sys ''file description'' Intel (R) WDDM Kernel mode driver ''product name''Intel Graphics Accelerator Drivers for Windows 7(R) I bought the laptop here in SE Asia about a year ago. The ''HOT!! NEW download tool'' on the acer drivers site (below) doesnt seem to work and the info about removing and installing drivers is limited. Not sure what to trust on non acer/manufacturer sites. http://support.acer.com/us/en/produc...1&modelId=4040 I've located the igdkmd32.sys file inside the INTEL GRAPHICS MEDIA ACCELERATOR 3600 SERIES 8.14.8.1064. When i click on ''update driver'' in control panel it searches and says its up to date. In windows maintenance it says this intel had a problem, but no solution. For all i know my drivers could be up to date and its something else. Can anybody advise a dummy step by step the process i should follow ? I've never done this before. eg do i delete the old driver first and then download the new one.how much of a problem i could cause by downloading this type of thing wrongly? As yet i havent downloaded any drivers. I've asked on other forums but no luck as yet. Thanks for any help!

    Read the article

< Previous Page | 784 785 786 787 788 789 790 791 792 793 794 795  | Next Page >