Search Results

Search found 44747 results on 1790 pages for 'breadth first'.

Page 83/1790 | < Previous Page | 79 80 81 82 83 84 85 86 87 88 89 90  | Next Page >

  • SQLAuthority News – Pluralsight Course Review – Practices for Software Startups – Part 1 of 2

    - by pinaldave
    This is first part of the two part series of Practices for Software Startup Pluralsight Course. The course is written by Stephen Forte (Blog | Twitter). Stephen Forte is the Chief Strategy Officer of the venture backed company, Telerik, a leading vendor of developer and team productivity tools. Stephen is also a Certified Scrum Master, Certified Scrum Professional, PMP, and also speaks regularly at industry conferences around the world. He has written several books on application and database development.  Stephen is also a board member of the Scrum Alliance. Startups – Everybodies Dream Start-up companies are an important topic right now – everyone wants to start their own business.  It is also important to remember that all companies were a start up at one point – from your corner store to the giants like Microsoft and Apple.  Research proves that not every start-up succeeds, in fact, most will fail before their first year.  There are many reasons for this, and this could be due to the fact that there are many stages to a start-up company, and stumbling at any of these stages can lead to failure.  It is important to understand what makes a start-up company succeed at all its hurdles to become successful.  It is even important to define success.  For most start-ups this would mean becoming their own independently functioning company or to be bought out for a hefty profit by a larger company.  The idea of making a hefty profit by living your dream is extremely important, and you can even think of start-ups as the new craze.  That’s why studying them is so important – they are very popular, but things have changed a lot since their inception. Starting the Startups Beginning a start-up company used to be difficult, but now facilities and information is widely available, and it is much easier.  But that means it is much easier to fail, also.  Previously to start your own company, everything was planned and organized, resources were ensured and backed up before beginning; even the idea of starting your own business was a big thing.  Now anybody can do it, and the steps are simple and outlines everywhere – you can get online software and easily outsource , cloud source, or crowdsource a lot of your material.  But without the type of planning previously required, things can often go badly. New Products – New Ideas – New World There are so many fantastic new products, but they don’t reach success all the time.  I find start-up companies very interesting, and whenever I meet someone who is interested in the subject or already starting their own company, I always ask what they are doing, their plans, goals, market, etc.  I am sorry to say that in most cases, they cannot answer my questions.  It is true that many fantastic ideas fail because of bad decisions.  These bad decisions were not made intentionally, but people were simply unaware of what they should be doing.  This will always lead to failure.  But I am happy to say that all these issues can be gone because Pluralsight is now offering a course all about start-ups by Stephen Forte.  Stephen is a start up leader.  He has successfully started many companies and most are still going strong, or have gone on to even bigger and better things. Beginning Course on Startup I have always thought start-ups are a fascinating subject, and decided to take his course, but it is three hours long.  This would be hard to fit into my busy work day all at once, so I decided to do half of his course before my daughter wakes up, and the other half after she goes to sleep.  The course is divided into six modules, so this would be easy to do.  I began the first chapter early in the morning, at 5 am.  Stephen jumped right into the middle of the subject in the very first module – designing your business plan.  The first question you will have to answer to yourself, to others, and to investors is: What is your product and when will we be able to see it?  So a very important concept is a “minimal viable product.”  This means setting goals for yourself and your product.  We all have large dreams, but your minimal viable product doesn’t have to be your final vision at the very first.  For example: Apple is a giant company, but it is still evolving.  Steve Jobs didn’t envision the iPhone 6 at the very beginning.  He had to start at the first iPhone and do his market research, and the idea evolved into the technology you see now.  So for yourself, you should decide a beginning and stop point.  Do your market research.  Determine who you want to reach, what audience you want for your product.  You can have a great idea that simply will not work in the market, do need, bottlenecks, lack of resources, or competition.  There is a lot of research that needs to be done before you even write a business plan, and Stephen covers it in the very first chapter. The Team – Unique Key to Success After jumping right into the subject in the very first module, I wondered what Stephen could have in store for me for the rest of the course.  Chapter number two is building a team.  Having a team is important regardless of what your startup is.  You can be a true visionary with endless ideas and energy, but one person can still not do everything.  It is important to decide from the very beginning if you will have cofounders, team leaders, and how many employees you’ll need.  Even more important, you’ll need to decide what kind of team you want – what personalities, skills, and type of energy you want each of your employees to bring.  Do you want to have an A+ team with a B- idea, or do you have a B- idea that needs an A+ team to sell it?  Stephen asks all the hard questions!  I was especially impressed by his insight on developing.  You have to decide if you need developers, how many, and what their skills should be. I found this insight extremely useful for everyday usage, not just for start-up companies.  I would apply this kind of information in management at any position.  An amazing team will build an amazing product – and that doesn’t matter if you’re a start-up company or a small team working for a much larger business. Customer Development – The Ultimate Obective Chapter three was about customer development. According to Stephen, there are four different steps to develop a customer base.  The first question to ask yourself is if you are envisioning a large customer base buying a few products each, or a small, dedicated base that buys a lot of your product – quantity vs. Quality.  He also discusses how to earn, retain, and get more customers.  He also says that each customer should be placed in a different role – some will be like investors, who regularly spend with you and invest their money in your business.  It is then your job to take that investment and turn it into a better product in the future.  You need to deal with their money properly – think of it is as theirs as investors, not yours as profit.  At the end of this module I felt that only Stephen could provide this kind of insight, and then he listed all the resources he took his information from.  I have never seen a group of people so passionate about their customers. It was indeed a long day for me. In tomorrow’s part 2 we will discuss rest of the three module and also will see a quick video of the Practices for Software Startup Pluralsight Course. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Best Practices, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Where is the mistake ?

    - by mr.bio
    Hi ... i am implementing a simple linked list in c++. I have a mistake and i don't see it :( #include <stdexcept> #include <iostream> struct Node { Node(Node *next, int value): next(next), value(value) { } Node *next; int value; }; class List { Node *first; // Erstes Element , 0 falls die Liste leer ist int len; // Laenge der liste Node *nthNode(int index); // Hilfsfunktion : O( index ) public: // Default - Konstruktor ( Laenge 0): O (1) List():first(0),len(0){ } // Copy - Konstruktor : O(other.len) List(const List & other){ }; // Zuweisungs - Operator O(len +other.len) List &operator=(const List &other) { clear(); if(!other.len) return *this; Node *it = first = new Node(0,other.first->value); for (Node *n = other.first->next; n; n = n->next) { it = it->next = new Node(0, n->value); } len = other.len; return *this; } // Destruktor ( gibt den Speicher von allen Nodes frei ): O( len ) ~List(){ }; // Haengt der Liste ein Element hinten an: O( len ) void push_back(int value){ }; // Fuegt am Anfang der Liste ein Element ein : O (1) void push_front(int value){ Node* front = new Node(0,value); if(first){ first = front; front->next = 0; }else{ front->next = first; first = front; } len++; }; // gibt eine Referenz auf das index -te Element zurueck : O( index ) int &at(int index){ int count = 0 ; int ret ; Node *it = first; for (Node *n = first->next; n; n = n->next) { if(count==index) ret = n->value; count++; } return ret ; }; // Entfernt alle Elemente : O(len) void clear(){ }; // Zeigt alle Elemente an: hier : O( len * len ) void show() { std::cout << " List [" << len << " ]:{ "; for (int i = 0; i < len; ++i) { std::cout << at(i) << (i == len - 1 ? '}' : ','); } std::cout << std::endl; } }; /* * */ int main() { List l; // l. push_back(1); // l. push_back(2); l. push_front(7); l. push_front(8); l. push_front(9); l.show(); // List(l). show(); } it works ... but the output is : List [3 ]:{ 0,134520896,9484585}

    Read the article

  • LinkedList Wrong Display(string builder)

    - by Chris
    Hello, The following program is a basic linked list divided in 3 classes. In the tester class (main) i add several numbers to the list (sorted). But insteed of getting the numbers as a result i get the result: LinkedList.LinkedList Is something wrong with the stringbuilder (the program was first in java where a string buffer was used, but that should be the same i think?) LinkedListTester.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace LinkedList { public class LinkedListTester { static void Main(string[] args) { LinkedList ll = new LinkedList(); ll.addDataSorted(5); ll.addDataSorted(7); ll.addDataSorted(13); ll.addDataSorted(1); ll.addDataSorted(17); ll.addDataSorted(8); Console.WriteLine(ll); } } }/LinkedList/ LinkedList.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace LinkedList { public class LinkedList { //toestand private LinkedListNode first; private LinkedListNode last; //gedrag public LinkedList() { first = null; last = null; } public void addDataInFront(int data) { first = new LinkedListNode(data, first); if (last == null){ last = first; } }/*addDataInFront*/ public void addDataToBack(int data) { if (first == null) { addDataInFront(data); } else { last.setNext(new LinkedListNode(data, null)); last = last.getNext(); } }/*addDataToBack*/ public void addDataSorted(int data) { if (first == null || first.getData() > data) { addDataInFront(data); } else { LinkedListNode currentNode = first; while (currentNode.getNext() != null && currentNode.getNext().getData() < data) { currentNode = currentNode.getNext(); } currentNode.setNext(new LinkedListNode(data, currentNode.getNext())); currentNode = currentNode.getNext(); if (currentNode.getNext() == null) { last = currentNode; } } }/*addDataSorted*/ public String toString() { StringBuilder Buf = new StringBuilder(); LinkedListNode currentNode = first; while (currentNode != null) { Buf.Append(currentNode.getData()); Buf.Append(' '); currentNode = currentNode.getNext(); } return Buf.ToString(); }/*toString*/ }/*LinkedList*/ }/LinkedList/ LinkedListNode: using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace LinkedList { public class LinkedListNode { //toestand private int data; private LinkedListNode next; private LinkedListNode previous; //gedrag public LinkedListNode(int data, LinkedListNode next) { this.data = data; this.next = next; this.previous = null; } public LinkedListNode(int data, LinkedListNode next, LinkedListNode previous) { this.data = data; this.next = next; this.previous = previous; } public LinkedListNode getNext() { return next; } public LinkedListNode getPrevious() { return previous; } public void setNext(LinkedListNode next) { this.next = next; } public void setPrevious(LinkedListNode previous) { this.previous = previous; } public int getData() { return data; } }/*LinkedListNode*/ }/LinkedList/

    Read the article

  • Object reference not set to an instance of an object- Linked List Example

    - by Zoro Roronoa
    I am seeing following errors : Object reference not set to an instance of an object! Check to determinate if the object is null before calling the method! I'am new with C#,and I made a program for Sorted Linked Lists. Here is the code where the error comes! public void Insert(double data) { Link newLink = new Link(data); Link current = first; Link previous = null; if (first == null) { first = newLink; } else { while (data > current.DData && current != null) { previous = current; current = current.Next; } previous.Next = newLink; newLink.Next = current; } } It says that the current referenc is null while (data current.DData && current != null), but I assigned it current = first; Please Help ! The rest is the complete code of the Program! class Link { double dData; Link next=null; public Link Next { get { return next; } set { next = value; } } public double DData { get { return dData; } set { dData = value; } } public Link(double dData) { this.dData = dData; } public void DisplayLink() { Console.WriteLine("Link : "+ dData); } } class SortedList { Link first; public SortedList() { first = null; } public bool IsEmpty() { return (this.first == null); } public void Insert(double data) { Link newLink = new Link(data); Link current = first; Link previous = null; if (first == null) { first = newLink; } else { while (data > current.DData && current != null) { previous = current; current = current.Next; } previous.Next = newLink; newLink.Next = current; } } public Link Remove() { Link temp = first; first = first.Next; return temp; } public void DisplayList() { Link current; current = first; Console.WriteLine("Display the List!"); while (current != null) { current.DisplayLink(); current = current.Next; } } } class SortedListApp { public void TestSortedList() { SortedList newList = new SortedList(); newList.Insert(20); newList.Insert(22); newList.Insert(100); newList.Insert(1000); newList.Insert(15); newList.Insert(11); newList.DisplayList(); newList.Remove(); newList.DisplayList(); } }

    Read the article

  • error in IIS7 but not on IIS6

    - by Brad
    I have a website that is we are now deploying to windows 2008 servers that has worked in the past on IIS6 without a problem. It is using .net 2 framework. Most of the website works. Just when we create a screen report over a certain size on the server we get this error. Event code: 3005 Event message: An unhandled exception has occurred. Event time: 6/2/2010 10:40:17 AM Event time (UTC): 6/2/2010 3:40:17 PM Event ID: 1b719ad45d444f949ecc9cbc23f49720 Event sequence: 10 Event occurrence: 1 Event detail code: 0 Application information: Application domain: /LM/W3SVC/3/ROOT-1-129199668164927170 Trust level: Full Application Virtual Path: / Application Path: c:\web\PatronAccess\ Machine name: WIN2008DEV Process information: Process ID: 4712 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: HttpException Exception message: Invalid viewstate. Request information: Request URL: http://win2008dev/WebResource.axd?d=xCXKkHAeSYHWbCg.gif Request path: /WebResource.axd User host address: 172.17.2.66 User: Is authenticated: False Authentication Type: Thread account name: NT AUTHORITY\NETWORK SERVICE Thread information: Thread ID: 6 Thread account name: NT AUTHORITY\NETWORK SERVICE Is impersonating: False Stack trace: at System.Web.UI.Page.DecryptStringWithIV(String s, IVType ivType) at System.Web.Handlers.AssemblyResourceLoader.System.Web.IHttpHandler.ProcessRequest(HttpContext context) at System.Web.HttpApplication.CallHandlerExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() at System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) Custom event details: And this one. A process serving application pool 'PatronAccess' suffered a fatal communication error with the Windows Process Activation Service. The process id was '4596'. The data field contains the error number. I have a debug of the application pool but I don't know where to go from here. * wait with pending attach Symbol search path is: Executable search path is: ModLoad: 00bd0000 00bd8000 c:\windows\system32\inetsrv\w3wp.exe ModLoad: 77380000 774a7000 C:\Windows\system32\ntdll.dll ModLoad: 75cb0000 75d8b000 C:\Windows\system32\kernel32.dll ModLoad: 75b60000 75c26000 C:\Windows\system32\ADVAPI32.dll ModLoad: 75df0000 75eb2000 C:\Windows\system32\RPCRT4.dll ModLoad: 76500000 765aa000 C:\Windows\system32\msvcrt.dll ModLoad: 76250000 762ed000 C:\Windows\system32\USER32.dll ModLoad: 75ae0000 75b2b000 C:\Windows\system32\GDI32.dll ModLoad: 75ec0000 76004000 C:\Windows\system32\ole32.dll ModLoad: 731a0000 731d6000 c:\windows\system32\inetsrv\IISUTIL.dll ModLoad: 75330000 75421000 C:\Windows\system32\CRYPT32.dll ModLoad: 75490000 754a2000 C:\Windows\system32\MSASN1.dll ModLoad: 758e0000 758fe000 C:\Windows\system32\USERENV.dll ModLoad: 758c0000 758d4000 C:\Windows\system32\Secur32.dll ModLoad: 75b30000 75b5d000 C:\Windows\system32\WS2_32.dll ModLoad: 774e0000 774e6000 C:\Windows\system32\NSI.dll ModLoad: 75ac0000 75ade000 C:\Windows\system32\IMM32.DLL ModLoad: 772b0000 77378000 C:\Windows\system32\MSCTF.dll ModLoad: 774f0000 774f9000 C:\Windows\system32\LPK.DLL ModLoad: 75c30000 75cad000 C:\Windows\system32\USP10.dll ModLoad: 74d30000 74d51000 C:\Windows\system32\NTMARTA.DLL ModLoad: 77500000 7754a000 C:\Windows\system32\WLDAP32.dll ModLoad: 75990000 75997000 C:\Windows\system32\PSAPI.DLL ModLoad: 754b0000 754c1000 C:\Windows\system32\SAMLIB.dll ModLoad: 744c0000 744ce000 c:\windows\system32\inetsrv\w3wphost.dll ModLoad: 77550000 775dd000 C:\Windows\system32\OLEAUT32.dll ModLoad: 72ec0000 72f12000 c:\windows\system32\inetsrv\nativerd.dll ModLoad: 742a0000 742cf000 C:\Windows\system32\XmlLite.dll ModLoad: 72e60000 72e90000 c:\windows\system32\inetsrv\IISRES.DLL ModLoad: 74f40000 74f7b000 C:\Windows\system32\rsaenh.dll ModLoad: 72f40000 72f86000 C:\Windows\system32\mscoree.dll ModLoad: 75d90000 75de8000 C:\Windows\system32\SHLWAPI.dll ModLoad: 74600000 7479e000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_6.0.6001.18000_none_5cdbaa5a083979cc\comctl32.dll ModLoad: 72310000 728a0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorwks.dll ModLoad: 72dc0000 72e5b000 C:\Windows\WinSxS\x86_microsoft.vc80.crt_1fc8b3b9a1e18e3b_8.0.50727.3053_none_d08d7bba442a9b36\MSVCR80.dll ModLoad: 75a30000 75ab4000 C:\Windows\system32\CLBCatQ.DLL ModLoad: 728a0000 728d0000 C:\Windows\system32\mlang.dll ModLoad: 6c7d0000 6c801000 C:\Windows\system32\inetsrv\iiscore.dll ModLoad: 71fd0000 71fd7000 c:\windows\system32\inetsrv\W3TP.dll ModLoad: 74480000 74489000 c:\windows\system32\inetsrv\w3dt.dll ModLoad: 71fb0000 71fbb000 C:\Windows\system32\HTTPAPI.dll ModLoad: 752f0000 7532a000 C:\Windows\system32\slc.dll ModLoad: 6cad0000 6caf8000 C:\Windows\system32\faultrep.dll ModLoad: 75050000 75058000 C:\Windows\system32\VERSION.dll ModLoad: 74b80000 74b8f000 C:\Windows\system32\NLAapi.dll ModLoad: 75290000 752a9000 C:\Windows\system32\IPHLPAPI.DLL ModLoad: 75250000 75285000 C:\Windows\system32\dhcpcsvc.DLL ModLoad: 754d0000 754fc000 C:\Windows\system32\DNSAPI.dll ModLoad: 75240000 75247000 C:\Windows\system32\WINNSI.DLL ModLoad: 75210000 75231000 C:\Windows\system32\dhcpcsvc6.DLL ModLoad: 750b0000 750eb000 C:\Windows\System32\mswsock.dll ModLoad: 73920000 73928000 C:\Windows\System32\winrnr.dll ModLoad: 73720000 7372f000 C:\Windows\system32\napinsp.dll ModLoad: 74d00000 74d05000 C:\Windows\System32\wshtcpip.dll ModLoad: 75140000 75145000 C:\Windows\System32\wship6.dll ModLoad: 73910000 73916000 C:\Windows\system32\rasadhlp.dll ModLoad: 6ca00000 6ca06000 C:\Windows\System32\inetsrv\cachuri.dll ModLoad: 6c9f0000 6c9f8000 C:\Windows\System32\inetsrv\cachfile.dll ModLoad: 6c9e0000 6c9e6000 C:\Windows\System32\inetsrv\cachtokn.dll ModLoad: 6c9d0000 6c9de000 C:\Windows\System32\inetsrv\cachhttp.dll ModLoad: 6c960000 6c96e000 C:\Windows\System32\inetsrv\compstat.dll ModLoad: 6c930000 6c938000 C:\Windows\System32\inetsrv\defdoc.dll ModLoad: 6c910000 6c919000 C:\Windows\System32\inetsrv\dirlist.dll ModLoad: 6c6b0000 6c6b8000 C:\Windows\System32\inetsrv\protsup.dll ModLoad: 6c6a0000 6c6ad000 C:\Windows\System32\inetsrv\static.dll ModLoad: 6c690000 6c69b000 C:\Windows\System32\inetsrv\authanon.dll ModLoad: 6c680000 6c68b000 C:\Windows\System32\inetsrv\authbas.dll ModLoad: 6c630000 6c63e000 C:\Windows\System32\inetsrv\authsspi.dll ModLoad: 755b0000 75625000 C:\Windows\system32\NETAPI32.dll ModLoad: 6c620000 6c62b000 C:\Windows\System32\inetsrv\modrqflt.dll ModLoad: 6c610000 6c61d000 C:\Windows\System32\inetsrv\custerr.dll ModLoad: 6c5c0000 6c5c8000 C:\Windows\System32\inetsrv\loghttp.dll ModLoad: 6c330000 6c337000 C:\Windows\System32\inetsrv\iisreqs.dll ModLoad: 728f0000 728f7000 C:\Windows\system32\WSOCK32.dll ModLoad: 6c1f0000 6c20e000 C:\Windows\System32\inetsrv\isapi.dll ModLoad: 6c000000 6c011000 C:\Windows\System32\inetsrv\filter.dll ModLoad: 6c320000 6c328000 C:\Windows\System32\inetsrv\validcfg.dll ModLoad: 6a2a0000 6a30d000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\webengine.dll ModLoad: 60060000 60067000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\aspnet_filter.dll ModLoad: 6c310000 6c319000 C:\Windows\system32\inetsrv\wbhst_pm.dll ModLoad: 765b0000 770c0000 C:\Windows\system32\shell32.dll ModLoad: 70d10000 71807000 C:\Windows\assembly\NativeImages_v2.0.50727_32\mscorlib\17f572b09facdc5fda9431558eb7a26e\mscorlib.ni.dll ModLoad: 70580000 70d05000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System\52e1ea3c7491e05cda766d7b3ce3d559\System.ni.dll ModLoad: 03990000 044d3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web\96071d36e4d44ebb31a3b46f08fdc732\System.Web.ni.dll ModLoad: 75770000 757cf000 C:\Windows\system32\sxs.dll ModLoad: 72ac0000 72bb1000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Configuration\e6001d416f7c468334934a2c6a41c631\System.Configuration.ni.dll ModLoad: 71890000 71dc6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Xml\7208ffa39630e9b923331f9df0947a12\System.Xml.ni.dll ModLoad: 66580000 667bc000 C:\Windows\assembly\NativeImages_v2.0.50727_32\Microsoft.JScript\1543943b86269c9bebd5cf7a3fe7f55b\Microsoft.JScript.ni.dll ModLoad: 74460000 74468000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_global.asax.cyzjkxpg.dll ModLoad: 65d20000 65e7c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\10097bf6\5f9a08ec_fffcca01\PatronAccess.DLL ModLoad: 72030000 7208b000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorjit.dll ModLoad: 68ab0000 68bca000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Extensio#\3b4cb090536bf6b0dfae8cefaeeadb9f\System.Web.Extensions.ni.dll ModLoad: 64020000 64033000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorsec.dll ModLoad: 73c40000 73c6d000 C:\Windows\system32\WINTRUST.dll ModLoad: 774b0000 774d9000 C:\Windows\system32\imagehlp.dll ModLoad: 73690000 73715000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_5.82.6001.18000_none_886786f450a74a05\COMCTL32.dll ModLoad: 75170000 751a5000 C:\Windows\system32\ncrypt.dll ModLoad: 751b0000 751f5000 C:\Windows\system32\BCRYPT.dll ModLoad: 74d90000 74da5000 C:\Windows\system32\GPAPI.dll ModLoad: 73520000 7353b000 C:\Windows\system32\cryptnet.dll ModLoad: 73440000 73446000 C:\Windows\system32\SensApi.dll ModLoad: 73a50000 73a65000 C:\Windows\system32\Cabinet.dll ModLoad: 6ae30000 6ae3a000 C:\Windows\system32\inetsrv\gzip.dll ModLoad: 69e50000 69e6a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_kal6czmb.dll ModLoad: 69e10000 69e3c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_b1efcjqz.dll ModLoad: 69bd0000 69c26000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e8a04837\0093847c_5153ca01\Infragistics2.WebUI.UltraWebTab.v9.2.DLL ModLoad: 5e480000 5e95e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\719ff0ee\00c37169_5153ca01\Infragistics2.Web.v9.2.DLL ModLoad: 67c90000 67d1a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\ba3b912a\00d19870_5153ca01\Infragistics2.WebUI.Shared.v9.2.DLL ModLoad: 656a0000 6587a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6470a692\14d22a05_ef2ac901\AjaxControlToolkit.DLL ModLoad: 66960000 66ae8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Drawing\6312464f64727a2a50d5ce3fd73ad1bb\System.Drawing.ni.dll ModLoad: 6e690000 6ece3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll ModLoad: 64e70000 65144000 C:\Windows\assembly\GAC_32\System.Data\2.0.0.0__b77a5c561934e089\System.Data.dll ModLoad: 69c70000 69ca2000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_zwtn5a73.dll ModLoad: 69e70000 69e8e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_qijxg7dv.dll ModLoad: 645a0000 647bf000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Mobile\b472cb382c17ffc3cb1a91ce12d90bf1\System.Web.Mobile.ni.dll ModLoad: 69c30000 69c66000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.RegularE#\e6b57c0506ec849c6706cb5617ad7372\System.Web.RegularExpressions.ni.dll ModLoad: 6c300000 6c30a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web__hyepzhd.dll ModLoad: 69e00000 69e08000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\5ef208f7\b68a494a_e840c901\SessionTimeoutControl.DLL ModLoad: 69d50000 69d5c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\619d48f7\0f695f01_fdfcca01\AgNetDataPro.DLL ModLoad: 69cd0000 69ce8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\dc1703ed\00e1c635_caeaca01\xfnlnet.DLL ModLoad: 73d50000 73efb000 C:\Windows\WinSxS\x86_microsoft.windows.gdiplus_6595b64144ccf1df_1.0.6001.18175_none_9e7bbe54c9c04bca\gdiplus.dll (16cc.14e0): Break instruction exception - code 80000003 (first chance) eax=7ffa6000 ebx=00000000 ecx=00000000 edx=7740d094 esi=00000000 edi=00000000 eip=773c7dfe esp=051ff774 ebp=051ff7a0 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00000246 ntdll!DbgBreakPoint: 773c7dfe cc int 3 0:021 g (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=00000479 ecx=00000000 edx=019d21f8 esi=019d1f18 edi=019ba74c eip=013849ed esp=0499ea44 ebp=0499f15c iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 013849ed 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g ModLoad: 65890000 65a55000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Services\2fa835ce2dcace4fc7c0009f102efc79\System.Web.Services.ni.dll ModLoad: 6f2b0000 6f34d000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.ni.dll ModLoad: 10000000 10020000 System.EnterpriseServices.Wrapper.dll ModLoad: 00e50000 00e70000 System.EnterpriseServices.Wrapper.dll ModLoad: 66da0000 66de8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.Wrapper.dll ModLoad: 10000000 10020000 C:\Windows\assembly\GAC_32\System.EnterpriseServices\2.0.0.0__b03f5f7f11d50a3a\System.EnterpriseServices.Wrapper.dll ModLoad: 6ab40000 6ab4c000 image6ab40000 ModLoad: 04950000 0495c000 image04950000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 049d0000 049f0000 image049d0000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\da3b70a0\00e9280f_c1f4c201\ICSharpCode.SharpZipLib.DLL ModLoad: 5eb40000 5f01e000 Infragistics2.Web.v9.2.dll ModLoad: 05a00000 05ede000 Infragistics2.Web.v9.2.dll ModLoad: 694d0000 694fa000 image694d0000 ModLoad: 049d0000 049fa000 image049d0000 ModLoad: 68cc0000 68cea000 image68cc0000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 image69470000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\f77351ae\00582c74_5153ca01\Infragistics2.WebUI.Misc.v9.2.DLL ModLoad: 67d20000 67daa000 image67d20000 ModLoad: 04e70000 04efa000 image04e70000 ModLoad: 643e0000 64598000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05a00000 05bb8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63ac0000 63c78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\9acf477c\0030eeb6_5153ca01\Infragistics2.WebUI.UltraWebChart.v9.2.DLL ModLoad: 60570000 607b6000 image60570000 ModLoad: 05d80000 05fc6000 image05d80000 ModLoad: 64350000 64596000 image64350000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 image5edd0000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\30e4a2ff\00dfbf77_5153ca01\Infragistics2.WebUI.UltraWebGrid.v9.2.DLL ModLoad: 67d50000 67da6000 image67d50000 ModLoad: 04e70000 04ec6000 image04e70000 ModLoad: 68cb0000 68ce4000 image68cb0000 ModLoad: 04e70000 04ea4000 image04e70000 ModLoad: 68790000 687c4000 image68790000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 image688f0000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\2420cb22\00a1ab83_5153ca01\Infragistics2.WebUI.WebCombo.v9.2.DLL ModLoad: 66d50000 66da0000 image66d50000 ModLoad: 04f80000 04fd0000 image04f80000 ModLoad: 67d60000 67db0000 image67d60000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 image66d00000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6ceab935\00b28e76_5153ca01\Infragistics2.WebUI.WebDataInput.v9.2.DLL ModLoad: 11000000 1112e000 image11000000 ModLoad: 05a50000 05b7e000 image05a50000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e99fdd05\00c79c09_d868c301\itextsharp.DLL ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e70000 04e7e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\0e724536\00922343_54dfc701\LinkPointAPI-cs.DLL ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04e90000 04e98000 image04e90000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\859797c4\00eb5fc5_bed8c401\LinkPointTransaction.DLL ModLoad: 65e80000 65fdc000 PatronAccess.dll ModLoad: 05a50000 05bac000 PatronAccess.dll ModLoad: 6ab40000 6ab48000 SessionTimeoutControl.dll ModLoad: 04e90000 04e98000 SessionTimeoutControl.dll ModLoad: 6ab80000 6ab8e000 WebServices.dll ModLoad: 04e90000 04e9e000 WebServices.dll ModLoad: 6ab40000 6ab4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\21555aa5\5f498093_fefcca01\WebServices.DLL ModLoad: 694e0000 694f8000 image694e0000 ModLoad: 04f80000 04f98000 image04f80000 ModLoad: 661c0000 6624e000 System.ServiceModel.Web.dll ModLoad: 05a50000 05ade000 System.ServiceModel.Web.dll ModLoad: 5d850000 5ddfc000 System.ServiceModel.dll ModLoad: 06220000 067cc000 System.ServiceModel.dll ModLoad: 65ef0000 65fe0000 System.Runtime.Serialization.dll ModLoad: 05eb0000 05fa0000 System.Runtime.Serialization.dll ModLoad: 694e0000 694fe000 SMDiagnostics.dll ModLoad: 04f80000 04f9e000 SMDiagnostics.dll ModLoad: 65be0000 65d1c000 System.Web.Extensions.dll ModLoad: 067d0000 0690c000 System.Web.Extensions.dll ModLoad: 67d40000 67dac000 System.IdentityModel.dll ModLoad: 05ae0000 05b4c000 System.IdentityModel.dll ModLoad: 687a0000 687c2000 System.IdentityModel.Selectors.dll ModLoad: 04fa0000 04fc2000 System.IdentityModel.Selectors.dll ModLoad: 66c90000 66cf4000 Microsoft.Transactions.Bridge.dll ModLoad: 05b50000 05bb4000 Microsoft.Transactions.Bridge.dll ModLoad: 69130000 69146000 System.Web.Abstractions.dll ModLoad: 051b0000 051c6000 System.Web.Abstractions.dll ModLoad: 65150000 651f6000 System.Core.dll ModLoad: 06910000 069b6000 System.Core.dll ModLoad: 64440000 644ea000 System.Data.Linq.dll ModLoad: 069c0000 06a6a000 System.Data.Linq.dll ModLoad: 66d50000 66d9c000 System.Data.Services.Client.dll ModLoad: 06a70000 06abc000 System.Data.Services.Client.dll ModLoad: 68cd0000 68cf0000 System.Data.Services.Design.dll ModLoad: 05210000 05230000 System.Data.Services.Design.dll ModLoad: 5eb00000 5edc2000 System.Data.Entity.dll ModLoad: 06ac0000 06d82000 System.Data.Entity.dll ModLoad: 66af0000 66b16000 System.Xml.Linq.dll ModLoad: 05fa0000 05fc6000 System.Xml.Linq.dll ModLoad: 661c0000 6624e000 C:\Windows\assembly\GAC_MSIL\System.ServiceModel.Web\3.5.0.0__31bf3856ad364e35\System.ServiceModel.Web.dll ModLoad: 64520000 6459e000 System.WorkflowServices.dll ModLoad: 06d90000 06e0e000 System.WorkflowServices.dll ModLoad: 63af0000 63c80000 System.Workflow.ComponentModel.dll ModLoad: 06e10000 06fa0000 System.Workflow.ComponentModel.dll ModLoad: 64320000 6443a000 System.Workflow.Activities.dll ModLoad: 06fa0000 070ba000 System.Workflow.Activities.dll ModLoad: 62cf0000 62d78000 System.Workflow.Runtime.dll ModLoad: 070c0000 07148000 System.Workflow.Runtime.dll ModLoad: 68cb0000 68cc6000 Microsoft.Build.Utilities.dll ModLoad: 07150000 07166000 Microsoft.Build.Utilities.dll ModLoad: 6ab80000 6ab8c000 Microsoft.Build.Framework.dll ModLoad: 05230000 0523c000 Microsoft.Build.Framework.dll ModLoad: 07170000 07214000 Microsoft.Build.Tasks.dll ModLoad: 07220000 072c4000 Microsoft.Build.Tasks.dll ModLoad: 64520000 6459e000 C:\Windows\assembly\GAC_MSIL\System.WorkflowServices\3.5.0.0__31bf3856ad364e35\System.WorkflowServices.dll ModLoad: 5d610000 5d84e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Runtime.Seri#\a33b3b88fd575b703ba4212c677880ae\System.Runtime.Serialization.ni.dll ModLoad: 605a0000 606a6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.IdentityModel\3bfbe737873becead614d1504e7d5684\System.IdentityModel.ni.dll ModLoad: 5ab70000 5bbf7000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.ServiceModel\7115815b53ec561932345e16fbeea968\System.ServiceModel.ni.dll ModLoad: 61440000 6201e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Windows.Forms\1941d7639299344ae28fb6b23da65247\System.Windows.Forms.ni.dll ModLoad: 5d190000 5d3c4000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Core\a0522cb280c09b3441e1889502ca145a\System.Core.ni.dll ModLoad: 60a00000 61433000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Design\d3fa02f8a34329c8b84c004afaea7054\System.Design.ni.dll (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff314 edi=018907f8 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=0186ed04 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=01858380 eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=017758a4 ecx=00000000 edx=00000000 esi=017fd078 edi=018b6afc eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Stack overflow - code c00000fd (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=020504b4 ecx=000001d1 edx=0000001b esi=020503d4 edi=073f2998 eip=6eaf0ed3 esp=073f2980 ebp=073f30ec iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 * WARNING: Unable to verify checksum for C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll System_Data_ni!_bidW103 (System_Data_ni+0x460ed3): 6eaf0ed3 f3ab rep stos dword ptr es:[edi] Any help would be appricated.

    Read the article

  • error in IIS7 but not on IIS6

    - by Brad
    I have a website that is we are now deploying to windows 2008 servers that has worked in the past on IIS6 without a problem. It is using .net 2 framework. Most of the website works. Just when we create a screen report over a certain size on the server we get this error. Event code: 3005 Event message: An unhandled exception has occurred. Event time: 6/2/2010 10:40:17 AM Event time (UTC): 6/2/2010 3:40:17 PM Event ID: 1b719ad45d444f949ecc9cbc23f49720 Event sequence: 10 Event occurrence: 1 Event detail code: 0 Application information: Application domain: /LM/W3SVC/3/ROOT-1-129199668164927170 Trust level: Full Application Virtual Path: / Application Path: c:\web\PatronAccess\ Machine name: WIN2008DEV Process information: Process ID: 4712 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: HttpException Exception message: Invalid viewstate. Request information: Request URL: http://win2008dev/WebResource.axd?d=xCXKkHAeSYHWbCg.gif Request path: /WebResource.axd User host address: 172.17.2.66 User: Is authenticated: False Authentication Type: Thread account name: NT AUTHORITY\NETWORK SERVICE Thread information: Thread ID: 6 Thread account name: NT AUTHORITY\NETWORK SERVICE Is impersonating: False Stack trace: at System.Web.UI.Page.DecryptStringWithIV(String s, IVType ivType) at System.Web.Handlers.AssemblyResourceLoader.System.Web.IHttpHandler.ProcessRequest(HttpContext context) at System.Web.HttpApplication.CallHandlerExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() at System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) Custom event details: And this one. A process serving application pool 'PatronAccess' suffered a fatal communication error with the Windows Process Activation Service. The process id was '4596'. The data field contains the error number. I have a debug of the application pool but I don't know where to go from here. * wait with pending attach Symbol search path is: Executable search path is: ModLoad: 00bd0000 00bd8000 c:\windows\system32\inetsrv\w3wp.exe ModLoad: 77380000 774a7000 C:\Windows\system32\ntdll.dll ModLoad: 75cb0000 75d8b000 C:\Windows\system32\kernel32.dll ModLoad: 75b60000 75c26000 C:\Windows\system32\ADVAPI32.dll ModLoad: 75df0000 75eb2000 C:\Windows\system32\RPCRT4.dll ModLoad: 76500000 765aa000 C:\Windows\system32\msvcrt.dll ModLoad: 76250000 762ed000 C:\Windows\system32\USER32.dll ModLoad: 75ae0000 75b2b000 C:\Windows\system32\GDI32.dll ModLoad: 75ec0000 76004000 C:\Windows\system32\ole32.dll ModLoad: 731a0000 731d6000 c:\windows\system32\inetsrv\IISUTIL.dll ModLoad: 75330000 75421000 C:\Windows\system32\CRYPT32.dll ModLoad: 75490000 754a2000 C:\Windows\system32\MSASN1.dll ModLoad: 758e0000 758fe000 C:\Windows\system32\USERENV.dll ModLoad: 758c0000 758d4000 C:\Windows\system32\Secur32.dll ModLoad: 75b30000 75b5d000 C:\Windows\system32\WS2_32.dll ModLoad: 774e0000 774e6000 C:\Windows\system32\NSI.dll ModLoad: 75ac0000 75ade000 C:\Windows\system32\IMM32.DLL ModLoad: 772b0000 77378000 C:\Windows\system32\MSCTF.dll ModLoad: 774f0000 774f9000 C:\Windows\system32\LPK.DLL ModLoad: 75c30000 75cad000 C:\Windows\system32\USP10.dll ModLoad: 74d30000 74d51000 C:\Windows\system32\NTMARTA.DLL ModLoad: 77500000 7754a000 C:\Windows\system32\WLDAP32.dll ModLoad: 75990000 75997000 C:\Windows\system32\PSAPI.DLL ModLoad: 754b0000 754c1000 C:\Windows\system32\SAMLIB.dll ModLoad: 744c0000 744ce000 c:\windows\system32\inetsrv\w3wphost.dll ModLoad: 77550000 775dd000 C:\Windows\system32\OLEAUT32.dll ModLoad: 72ec0000 72f12000 c:\windows\system32\inetsrv\nativerd.dll ModLoad: 742a0000 742cf000 C:\Windows\system32\XmlLite.dll ModLoad: 72e60000 72e90000 c:\windows\system32\inetsrv\IISRES.DLL ModLoad: 74f40000 74f7b000 C:\Windows\system32\rsaenh.dll ModLoad: 72f40000 72f86000 C:\Windows\system32\mscoree.dll ModLoad: 75d90000 75de8000 C:\Windows\system32\SHLWAPI.dll ModLoad: 74600000 7479e000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_6.0.6001.18000_none_5cdbaa5a083979cc\comctl32.dll ModLoad: 72310000 728a0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorwks.dll ModLoad: 72dc0000 72e5b000 C:\Windows\WinSxS\x86_microsoft.vc80.crt_1fc8b3b9a1e18e3b_8.0.50727.3053_none_d08d7bba442a9b36\MSVCR80.dll ModLoad: 75a30000 75ab4000 C:\Windows\system32\CLBCatQ.DLL ModLoad: 728a0000 728d0000 C:\Windows\system32\mlang.dll ModLoad: 6c7d0000 6c801000 C:\Windows\system32\inetsrv\iiscore.dll ModLoad: 71fd0000 71fd7000 c:\windows\system32\inetsrv\W3TP.dll ModLoad: 74480000 74489000 c:\windows\system32\inetsrv\w3dt.dll ModLoad: 71fb0000 71fbb000 C:\Windows\system32\HTTPAPI.dll ModLoad: 752f0000 7532a000 C:\Windows\system32\slc.dll ModLoad: 6cad0000 6caf8000 C:\Windows\system32\faultrep.dll ModLoad: 75050000 75058000 C:\Windows\system32\VERSION.dll ModLoad: 74b80000 74b8f000 C:\Windows\system32\NLAapi.dll ModLoad: 75290000 752a9000 C:\Windows\system32\IPHLPAPI.DLL ModLoad: 75250000 75285000 C:\Windows\system32\dhcpcsvc.DLL ModLoad: 754d0000 754fc000 C:\Windows\system32\DNSAPI.dll ModLoad: 75240000 75247000 C:\Windows\system32\WINNSI.DLL ModLoad: 75210000 75231000 C:\Windows\system32\dhcpcsvc6.DLL ModLoad: 750b0000 750eb000 C:\Windows\System32\mswsock.dll ModLoad: 73920000 73928000 C:\Windows\System32\winrnr.dll ModLoad: 73720000 7372f000 C:\Windows\system32\napinsp.dll ModLoad: 74d00000 74d05000 C:\Windows\System32\wshtcpip.dll ModLoad: 75140000 75145000 C:\Windows\System32\wship6.dll ModLoad: 73910000 73916000 C:\Windows\system32\rasadhlp.dll ModLoad: 6ca00000 6ca06000 C:\Windows\System32\inetsrv\cachuri.dll ModLoad: 6c9f0000 6c9f8000 C:\Windows\System32\inetsrv\cachfile.dll ModLoad: 6c9e0000 6c9e6000 C:\Windows\System32\inetsrv\cachtokn.dll ModLoad: 6c9d0000 6c9de000 C:\Windows\System32\inetsrv\cachhttp.dll ModLoad: 6c960000 6c96e000 C:\Windows\System32\inetsrv\compstat.dll ModLoad: 6c930000 6c938000 C:\Windows\System32\inetsrv\defdoc.dll ModLoad: 6c910000 6c919000 C:\Windows\System32\inetsrv\dirlist.dll ModLoad: 6c6b0000 6c6b8000 C:\Windows\System32\inetsrv\protsup.dll ModLoad: 6c6a0000 6c6ad000 C:\Windows\System32\inetsrv\static.dll ModLoad: 6c690000 6c69b000 C:\Windows\System32\inetsrv\authanon.dll ModLoad: 6c680000 6c68b000 C:\Windows\System32\inetsrv\authbas.dll ModLoad: 6c630000 6c63e000 C:\Windows\System32\inetsrv\authsspi.dll ModLoad: 755b0000 75625000 C:\Windows\system32\NETAPI32.dll ModLoad: 6c620000 6c62b000 C:\Windows\System32\inetsrv\modrqflt.dll ModLoad: 6c610000 6c61d000 C:\Windows\System32\inetsrv\custerr.dll ModLoad: 6c5c0000 6c5c8000 C:\Windows\System32\inetsrv\loghttp.dll ModLoad: 6c330000 6c337000 C:\Windows\System32\inetsrv\iisreqs.dll ModLoad: 728f0000 728f7000 C:\Windows\system32\WSOCK32.dll ModLoad: 6c1f0000 6c20e000 C:\Windows\System32\inetsrv\isapi.dll ModLoad: 6c000000 6c011000 C:\Windows\System32\inetsrv\filter.dll ModLoad: 6c320000 6c328000 C:\Windows\System32\inetsrv\validcfg.dll ModLoad: 6a2a0000 6a30d000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\webengine.dll ModLoad: 60060000 60067000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\aspnet_filter.dll ModLoad: 6c310000 6c319000 C:\Windows\system32\inetsrv\wbhst_pm.dll ModLoad: 765b0000 770c0000 C:\Windows\system32\shell32.dll ModLoad: 70d10000 71807000 C:\Windows\assembly\NativeImages_v2.0.50727_32\mscorlib\17f572b09facdc5fda9431558eb7a26e\mscorlib.ni.dll ModLoad: 70580000 70d05000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System\52e1ea3c7491e05cda766d7b3ce3d559\System.ni.dll ModLoad: 03990000 044d3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web\96071d36e4d44ebb31a3b46f08fdc732\System.Web.ni.dll ModLoad: 75770000 757cf000 C:\Windows\system32\sxs.dll ModLoad: 72ac0000 72bb1000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Configuration\e6001d416f7c468334934a2c6a41c631\System.Configuration.ni.dll ModLoad: 71890000 71dc6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Xml\7208ffa39630e9b923331f9df0947a12\System.Xml.ni.dll ModLoad: 66580000 667bc000 C:\Windows\assembly\NativeImages_v2.0.50727_32\Microsoft.JScript\1543943b86269c9bebd5cf7a3fe7f55b\Microsoft.JScript.ni.dll ModLoad: 74460000 74468000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_global.asax.cyzjkxpg.dll ModLoad: 65d20000 65e7c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\10097bf6\5f9a08ec_fffcca01\PatronAccess.DLL ModLoad: 72030000 7208b000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorjit.dll ModLoad: 68ab0000 68bca000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Extensio#\3b4cb090536bf6b0dfae8cefaeeadb9f\System.Web.Extensions.ni.dll ModLoad: 64020000 64033000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorsec.dll ModLoad: 73c40000 73c6d000 C:\Windows\system32\WINTRUST.dll ModLoad: 774b0000 774d9000 C:\Windows\system32\imagehlp.dll ModLoad: 73690000 73715000 C:\Windows\WinSxS\x86_microsoft.windows.common-controls_6595b64144ccf1df_5.82.6001.18000_none_886786f450a74a05\COMCTL32.dll ModLoad: 75170000 751a5000 C:\Windows\system32\ncrypt.dll ModLoad: 751b0000 751f5000 C:\Windows\system32\BCRYPT.dll ModLoad: 74d90000 74da5000 C:\Windows\system32\GPAPI.dll ModLoad: 73520000 7353b000 C:\Windows\system32\cryptnet.dll ModLoad: 73440000 73446000 C:\Windows\system32\SensApi.dll ModLoad: 73a50000 73a65000 C:\Windows\system32\Cabinet.dll ModLoad: 6ae30000 6ae3a000 C:\Windows\system32\inetsrv\gzip.dll ModLoad: 69e50000 69e6a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_kal6czmb.dll ModLoad: 69e10000 69e3c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_b1efcjqz.dll ModLoad: 69bd0000 69c26000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e8a04837\0093847c_5153ca01\Infragistics2.WebUI.UltraWebTab.v9.2.DLL ModLoad: 5e480000 5e95e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\719ff0ee\00c37169_5153ca01\Infragistics2.Web.v9.2.DLL ModLoad: 67c90000 67d1a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\ba3b912a\00d19870_5153ca01\Infragistics2.WebUI.Shared.v9.2.DLL ModLoad: 656a0000 6587a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6470a692\14d22a05_ef2ac901\AjaxControlToolkit.DLL ModLoad: 66960000 66ae8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Drawing\6312464f64727a2a50d5ce3fd73ad1bb\System.Drawing.ni.dll ModLoad: 6e690000 6ece3000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll ModLoad: 64e70000 65144000 C:\Windows\assembly\GAC_32\System.Data\2.0.0.0__b77a5c561934e089\System.Data.dll ModLoad: 69c70000 69ca2000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_zwtn5a73.dll ModLoad: 69e70000 69e8e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web_qijxg7dv.dll ModLoad: 645a0000 647bf000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Mobile\b472cb382c17ffc3cb1a91ce12d90bf1\System.Web.Mobile.ni.dll ModLoad: 69c30000 69c66000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.RegularE#\e6b57c0506ec849c6706cb5617ad7372\System.Web.RegularExpressions.ni.dll ModLoad: 6c300000 6c30a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\App_Web__hyepzhd.dll ModLoad: 69e00000 69e08000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\5ef208f7\b68a494a_e840c901\SessionTimeoutControl.DLL ModLoad: 69d50000 69d5c000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\619d48f7\0f695f01_fdfcca01\AgNetDataPro.DLL ModLoad: 69cd0000 69ce8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\dc1703ed\00e1c635_caeaca01\xfnlnet.DLL ModLoad: 73d50000 73efb000 C:\Windows\WinSxS\x86_microsoft.windows.gdiplus_6595b64144ccf1df_1.0.6001.18175_none_9e7bbe54c9c04bca\gdiplus.dll (16cc.14e0): Break instruction exception - code 80000003 (first chance) eax=7ffa6000 ebx=00000000 ecx=00000000 edx=7740d094 esi=00000000 edi=00000000 eip=773c7dfe esp=051ff774 ebp=051ff7a0 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00000246 ntdll!DbgBreakPoint: 773c7dfe cc int 3 0:021 g (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=00000479 ecx=00000000 edx=019d21f8 esi=019d1f18 edi=019ba74c eip=013849ed esp=0499ea44 ebp=0499f15c iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 013849ed 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g ModLoad: 65890000 65a55000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Web.Services\2fa835ce2dcace4fc7c0009f102efc79\System.Web.Services.ni.dll ModLoad: 6f2b0000 6f34d000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.ni.dll ModLoad: 10000000 10020000 System.EnterpriseServices.Wrapper.dll ModLoad: 00e50000 00e70000 System.EnterpriseServices.Wrapper.dll ModLoad: 66da0000 66de8000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.EnterpriseSe#\ae383808b3f5ee9287358378f9a2cad3\System.EnterpriseServices.Wrapper.dll ModLoad: 10000000 10020000 C:\Windows\assembly\GAC_32\System.EnterpriseServices\2.0.0.0__b03f5f7f11d50a3a\System.EnterpriseServices.Wrapper.dll ModLoad: 6ab40000 6ab4c000 image6ab40000 ModLoad: 04950000 0495c000 image04950000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 049d0000 049f0000 image049d0000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 image049a0000 ModLoad: 04a40000 04a60000 image04a40000 ModLoad: 049a0000 049c0000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\da3b70a0\00e9280f_c1f4c201\ICSharpCode.SharpZipLib.DLL ModLoad: 5eb40000 5f01e000 Infragistics2.Web.v9.2.dll ModLoad: 05a00000 05ede000 Infragistics2.Web.v9.2.dll ModLoad: 694d0000 694fa000 image694d0000 ModLoad: 049d0000 049fa000 image049d0000 ModLoad: 68cc0000 68cea000 image68cc0000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 image69470000 ModLoad: 04e40000 04e6a000 image04e40000 ModLoad: 69470000 6949a000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\f77351ae\00582c74_5153ca01\Infragistics2.WebUI.Misc.v9.2.DLL ModLoad: 67d20000 67daa000 image67d20000 ModLoad: 04e70000 04efa000 image04e70000 ModLoad: 643e0000 64598000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05a00000 05bb8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63ac0000 63c78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 05bc0000 05d78000 Infragistics2.WebUI.UltraWebChart.v9.2.dll ModLoad: 63900000 63ab8000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\9acf477c\0030eeb6_5153ca01\Infragistics2.WebUI.UltraWebChart.v9.2.DLL ModLoad: 60570000 607b6000 image60570000 ModLoad: 05d80000 05fc6000 image05d80000 ModLoad: 64350000 64596000 image64350000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 image5edd0000 ModLoad: 05fd0000 06216000 image05fd0000 ModLoad: 5edd0000 5f016000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\30e4a2ff\00dfbf77_5153ca01\Infragistics2.WebUI.UltraWebGrid.v9.2.DLL ModLoad: 67d50000 67da6000 image67d50000 ModLoad: 04e70000 04ec6000 image04e70000 ModLoad: 68cb0000 68ce4000 image68cb0000 ModLoad: 04e70000 04ea4000 image04e70000 ModLoad: 68790000 687c4000 image68790000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 image688f0000 ModLoad: 04eb0000 04ee4000 image04eb0000 ModLoad: 688f0000 68924000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\2420cb22\00a1ab83_5153ca01\Infragistics2.WebUI.WebCombo.v9.2.DLL ModLoad: 66d50000 66da0000 image66d50000 ModLoad: 04f80000 04fd0000 image04f80000 ModLoad: 67d60000 67db0000 image67d60000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 image66d00000 ModLoad: 05a00000 05a50000 image05a00000 ModLoad: 66d00000 66d50000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\6ceab935\00b28e76_5153ca01\Infragistics2.WebUI.WebDataInput.v9.2.DLL ModLoad: 11000000 1112e000 image11000000 ModLoad: 05a50000 05b7e000 image05a50000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 image11000000 ModLoad: 05d80000 05eae000 image05d80000 ModLoad: 11000000 1112e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\e99fdd05\00c79c09_d868c301\itextsharp.DLL ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e70000 04e7e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 LinkPointAPI-cs.dll ModLoad: 04e80000 04e8e000 LinkPointAPI-cs.dll ModLoad: 04df0000 04dfe000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\0e724536\00922343_54dfc701\LinkPointAPI-cs.DLL ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04e90000 04e98000 image04e90000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 image04e70000 ModLoad: 04ea0000 04ea8000 image04ea0000 ModLoad: 04e70000 04e78000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\859797c4\00eb5fc5_bed8c401\LinkPointTransaction.DLL ModLoad: 65e80000 65fdc000 PatronAccess.dll ModLoad: 05a50000 05bac000 PatronAccess.dll ModLoad: 6ab40000 6ab48000 SessionTimeoutControl.dll ModLoad: 04e90000 04e98000 SessionTimeoutControl.dll ModLoad: 6ab80000 6ab8e000 WebServices.dll ModLoad: 04e90000 04e9e000 WebServices.dll ModLoad: 6ab40000 6ab4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 WebServices.dll ModLoad: 04ef0000 04efe000 WebServices.dll ModLoad: 69d40000 69d4e000 C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\048afd31\e1f306b4\assembly\dl3\21555aa5\5f498093_fefcca01\WebServices.DLL ModLoad: 694e0000 694f8000 image694e0000 ModLoad: 04f80000 04f98000 image04f80000 ModLoad: 661c0000 6624e000 System.ServiceModel.Web.dll ModLoad: 05a50000 05ade000 System.ServiceModel.Web.dll ModLoad: 5d850000 5ddfc000 System.ServiceModel.dll ModLoad: 06220000 067cc000 System.ServiceModel.dll ModLoad: 65ef0000 65fe0000 System.Runtime.Serialization.dll ModLoad: 05eb0000 05fa0000 System.Runtime.Serialization.dll ModLoad: 694e0000 694fe000 SMDiagnostics.dll ModLoad: 04f80000 04f9e000 SMDiagnostics.dll ModLoad: 65be0000 65d1c000 System.Web.Extensions.dll ModLoad: 067d0000 0690c000 System.Web.Extensions.dll ModLoad: 67d40000 67dac000 System.IdentityModel.dll ModLoad: 05ae0000 05b4c000 System.IdentityModel.dll ModLoad: 687a0000 687c2000 System.IdentityModel.Selectors.dll ModLoad: 04fa0000 04fc2000 System.IdentityModel.Selectors.dll ModLoad: 66c90000 66cf4000 Microsoft.Transactions.Bridge.dll ModLoad: 05b50000 05bb4000 Microsoft.Transactions.Bridge.dll ModLoad: 69130000 69146000 System.Web.Abstractions.dll ModLoad: 051b0000 051c6000 System.Web.Abstractions.dll ModLoad: 65150000 651f6000 System.Core.dll ModLoad: 06910000 069b6000 System.Core.dll ModLoad: 64440000 644ea000 System.Data.Linq.dll ModLoad: 069c0000 06a6a000 System.Data.Linq.dll ModLoad: 66d50000 66d9c000 System.Data.Services.Client.dll ModLoad: 06a70000 06abc000 System.Data.Services.Client.dll ModLoad: 68cd0000 68cf0000 System.Data.Services.Design.dll ModLoad: 05210000 05230000 System.Data.Services.Design.dll ModLoad: 5eb00000 5edc2000 System.Data.Entity.dll ModLoad: 06ac0000 06d82000 System.Data.Entity.dll ModLoad: 66af0000 66b16000 System.Xml.Linq.dll ModLoad: 05fa0000 05fc6000 System.Xml.Linq.dll ModLoad: 661c0000 6624e000 C:\Windows\assembly\GAC_MSIL\System.ServiceModel.Web\3.5.0.0__31bf3856ad364e35\System.ServiceModel.Web.dll ModLoad: 64520000 6459e000 System.WorkflowServices.dll ModLoad: 06d90000 06e0e000 System.WorkflowServices.dll ModLoad: 63af0000 63c80000 System.Workflow.ComponentModel.dll ModLoad: 06e10000 06fa0000 System.Workflow.ComponentModel.dll ModLoad: 64320000 6443a000 System.Workflow.Activities.dll ModLoad: 06fa0000 070ba000 System.Workflow.Activities.dll ModLoad: 62cf0000 62d78000 System.Workflow.Runtime.dll ModLoad: 070c0000 07148000 System.Workflow.Runtime.dll ModLoad: 68cb0000 68cc6000 Microsoft.Build.Utilities.dll ModLoad: 07150000 07166000 Microsoft.Build.Utilities.dll ModLoad: 6ab80000 6ab8c000 Microsoft.Build.Framework.dll ModLoad: 05230000 0523c000 Microsoft.Build.Framework.dll ModLoad: 07170000 07214000 Microsoft.Build.Tasks.dll ModLoad: 07220000 072c4000 Microsoft.Build.Tasks.dll ModLoad: 64520000 6459e000 C:\Windows\assembly\GAC_MSIL\System.WorkflowServices\3.5.0.0__31bf3856ad364e35\System.WorkflowServices.dll ModLoad: 5d610000 5d84e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Runtime.Seri#\a33b3b88fd575b703ba4212c677880ae\System.Runtime.Serialization.ni.dll ModLoad: 605a0000 606a6000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.IdentityModel\3bfbe737873becead614d1504e7d5684\System.IdentityModel.ni.dll ModLoad: 5ab70000 5bbf7000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.ServiceModel\7115815b53ec561932345e16fbeea968\System.ServiceModel.ni.dll ModLoad: 61440000 6201e000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Windows.Forms\1941d7639299344ae28fb6b23da65247\System.Windows.Forms.ni.dll ModLoad: 5d190000 5d3c4000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Core\a0522cb280c09b3441e1889502ca145a\System.Core.ni.dll ModLoad: 60a00000 61433000 C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Design\d3fa02f8a34329c8b84c004afaea7054\System.Design.ni.dll (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff314 edi=018907f8 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1454): CLR exception - code e0434f4d (first chance) (16cc.1454): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=0186ed04 eip=071a62fc esp=0499ee88 ebp=0499eef4 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:018 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=01776038 ecx=00000000 edx=00000000 esi=017ff200 edi=01858380 eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Access violation - code c0000005 (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=017758a4 ecx=00000000 edx=00000000 esi=017fd078 edi=018b6afc eip=071a62fc esp=0742ee98 ebp=0742ef04 iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 071a62fc 8b01 mov eax,dword ptr [ecx] ds:0023:00000000=???????? 0:020 g (16cc.1358): Stack overflow - code c00000fd (first chance) First chance exceptions are reported before any exception handling. This exception may be expected and handled. eax=00000000 ebx=020504b4 ecx=000001d1 edx=0000001b esi=020503d4 edi=073f2998 eip=6eaf0ed3 esp=073f2980 ebp=073f30ec iopl=0 nv up ei pl zr na pe nc cs=001b ss=0023 ds=0023 es=0023 fs=003b gs=0000 efl=00010246 * WARNING: Unable to verify checksum for C:\Windows\assembly\NativeImages_v2.0.50727_32\System.Data\813556b5a2722045b0ea14467fd00227\System.Data.ni.dll System_Data_ni!_bidW103 (System_Data_ni+0x460ed3): 6eaf0ed3 f3ab rep stos dword ptr es:[edi] Any help would be appricated.

    Read the article

  • Adding Polynomials (Linked Lists)......Bug Help

    - by Brian
    I have written a program that creates nodes that in this class are parts of polynomials and then the two polynomials get added together to become one polynomial (list of nodes). All my code compiles so the only problem I am having is that the nodes are not inserting into the polynomial via the insert method I have in polynomial.java and when running the program it does create nodes and displays them in the 2x^2 format but when it comes to add the polynomials together it displays o as the polynomials, so if anyone can figure out whats wrong and what I can do to fix it it would be much appreciated. Here is the code: import java.util.Scanner; class Polynomial{ public termNode head; public Polynomial() { head = null; } public boolean isEmpty() { return (head == null); } public void display() { if (head == null) System.out.print("0"); else for(termNode cur = head; cur != null; cur = cur.getNext()) { System.out.println(cur); } } public void insert(termNode newNode) { termNode prev = null; termNode cur = head; while (cur!=null && (newNode.compareTo(cur)<0)) { prev = null; cur = cur.getNext(); } if (prev == null) { newNode.setNext(head); head = newNode; } else { newNode.setNext(cur); prev.setNext(newNode); } } public void readPolynomial(Scanner kb) { boolean done = false; double coefficient; int exponent; termNode term; head = null; //UNLINK ANY PREVIOUS POLYNOMIAL System.out.println("Enter 0 and 0 to end."); System.out.print("coefficient: "); coefficient = kb.nextDouble(); System.out.println(coefficient); System.out.print("exponent: "); exponent = kb.nextInt(); System.out.println(exponent); done = (coefficient == 0 && exponent == 0); while(!done) { Polynomial poly = new Polynomial(); term = new termNode(coefficient,exponent); System.out.println(term); poly.insert(term); System.out.println("Enter 0 and 0 to end."); System.out.print("coefficient: "); coefficient = kb.nextDouble(); System.out.println(coefficient); System.out.print("exponent: "); exponent = kb.nextInt(); System.out.println(exponent); done = (coefficient==0 && exponent==0); } } public static Polynomial add(Polynomial p, Polynomial q) { Polynomial r = new Polynomial(); double coefficient; int exponent; termNode first = p.head; termNode second = q.head; termNode sum = r.head; termNode term; while (first != null && second != null) { if (first.getExp() == second.getExp()) { if (first.getCoeff() != 0 && second.getCoeff() != 0); { double addCoeff = first.getCoeff() + second.getCoeff(); term = new termNode(addCoeff,first.getExp()); sum.setNext(term); first.getNext(); second.getNext(); } } else if (first.getExp() < second.getExp()) { sum.setNext(second); term = new termNode(second.getCoeff(),second.getExp()); sum.setNext(term); second.getNext(); } else { sum.setNext(first); term = new termNode(first.getNext()); sum.setNext(term); first.getNext(); } } while (first != null) { sum.setNext(first); } while (second != null) { sum.setNext(second); } return r; } } Here is my Node class: class termNode implements Comparable { private int exp; private double coeff; private termNode next; public termNode(double coefficient, int exponent) { coeff = coefficient; exp = exponent; next = null; } public termNode(termNode inTermNode) { coeff = inTermNode.coeff; exp = inTermNode.exp; } public void setData(double coefficient, int exponent) { coefficient = coeff; exponent = exp; } public double getCoeff() { return coeff; } public int getExp() { return exp; } public void setNext(termNode link) { next = link; } public termNode getNext() { return next; } public String toString() { if (exp == 0) { return(coeff + " "); } else if (exp == 1) { return(coeff + "x"); } else { return(coeff + "x^" + exp); } } public int compareTo(Object other) { if(exp ==((termNode) other).exp) return 0; else if(exp < ((termNode) other).exp) return -1; else return 1; } } And here is my Test class to run the program. import java.util.Scanner; class PolyTest{ public static void main(String [] args) { Scanner kb = new Scanner(System.in); Polynomial r; Polynomial p = new Polynomial(); System.out.println("Enter first polynomial."); p.readPolynomial(kb); Polynomial q = new Polynomial(); System.out.println(); System.out.println("Enter second polynomial."); q.readPolynomial(kb); r = Polynomial.add(p,q); System.out.println(); System.out.print("The sum of "); p.display(); System.out.print(" and "); q.display(); System.out.print(" is "); r.display(); } }

    Read the article

  • Is TCP/IP encapsulation MSB or LSB?

    - by Justin
    Application data sent over TCP experiences multiple encapsulations: The application data is encapsulated within one or many TCP fragments The TCP fragment is encapsulated within one or many IP datagrams The IP datagram is encapsulated within one or many Ethernet frames It turns out Ethernet frames are sent most-significant byte first, and within each byte, most-significant bit first. What about the multiple encapsulations? Are they performed MSB first or LSB first?

    Read the article

  • Running 1 DC physically and a second virtually

    - by stead1984
    I plan to create my first DC and forest on a physical server, then I want to run a second DC on a virtual server that will replicate the first DC. I understand that this will provide redundancy for AD that if the first domain controller went down the second would resume until the first is back online. Would this work and how?

    Read the article

  • Error compiling / linking e text editor on Linux

    - by jckdnk111
    The code compiles without too much complaint, but the last step fails with the error below. There is some discussion about it on the e forum, but still no answer. [LD] e ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x0): multiple definition of `_pcre_OP_lengths' .objs.release/cx_pcre_tables.o:(.rodata+0x0): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x70): multiple definition of `_pcre_utf8_table1' .objs.release/cx_pcre_tables.o:(.rodata+0x70): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x88): multiple definition of `_pcre_utf8_table1_size' .objs.release/cx_pcre_tables.o:(.rodata+0x88): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x8c): multiple definition of `_pcre_utf8_table2' .objs.release/cx_pcre_tables.o:(.rodata+0x8c): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0xa4): multiple definition of `_pcre_utf8_table3' .objs.release/cx_pcre_tables.o:(.rodata+0xa4): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0xc0): multiple definition of `_pcre_utf8_table4' .objs.release/cx_pcre_tables.o:(.rodata+0xc0): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x180): multiple definition of `_pcre_utt_names' .objs.release/cx_pcre_tables.o:(.rodata+0x100): first defined here /usr/bin/ld: Warning: size of symbol `_pcre_utt_names' changed from 657 in .objs.release/cx_pcre_tables.o to 740 in ../external/out.release/lib/libpcre.a(pcre_tables.o) ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x480): multiple definition of `_pcre_utt' .objs.release/cx_pcre_tables.o:(.rodata+0x3a0): first defined here /usr/bin/ld: Warning: size of symbol `_pcre_utt' changed from 630 in .objs.release/cx_pcre_tables.o to 696 in ../external/out.release/lib/libpcre.a(pcre_tables.o) ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x738): multiple definition of `_pcre_utt_size' .objs.release/cx_pcre_tables.o:(.rodata+0x618): first defined here .objs.release/cx_pcre_exec.o: In function `match(doc_byte_iter, unsigned char const*, doc_byte_iter, int, match_data*, unsigned long, eptrblock*, int, unsigned int)': cx_pcre_exec.cpp:(.text+0x1c2a): undefined reference to `_pcre_ord2utf8(int, unsigned char*)' .objs.release/eauibook.o: In function `eAuiNotebook::LoadPerspective(wxString const&)': eauibook.cpp:(.text+0x9ad): undefined reference to `wxTabFrame::SetTabCtrlHeight(int)' .objs.release/PreviewDlg.o: In function `global constructors keyed to _ZN10PreviewDlg13sm_eventTableE': PreviewDlg.cpp:(.text+0x11b2): undefined reference to `wxEVT_WEB_TITLECHANGE' PreviewDlg.cpp:(.text+0x11ee): undefined reference to `wxEVT_WEB_DOMCONTENTLOADED' .objs.release/PreviewDlg.o: In function `PreviewDlg::RefreshBrowser(PreviewDlg::cxUpdateMode)': PreviewDlg.cpp:(.text+0x2a47): undefined reference to `wxWebControl::OpenURI(wxString const&, unsigned int, wxWebPostData*, bool)' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnWebDocumentComplete(wxWebEvent&)': PreviewDlg.cpp:(.text+0x3259): undefined reference to `wxWebControl::GetCurrentURI() const' .objs.release/PreviewDlg.o: In function `PreviewDlg::PreviewDlg(EditorFrame&)': PreviewDlg.cpp:(.text+0x4984): undefined reference to `wxWebControl::IsInitialized()' PreviewDlg.cpp:(.text+0x49c5): undefined reference to `wxWebControl::wxWebControl(wxWindow*, int, wxPoint const&, wxSize const&)' PreviewDlg.cpp:(.text+0x562f): undefined reference to `wxWebControl::InitEngine(wxString const&)' .objs.release/PreviewDlg.o: In function `PreviewDlg::PreviewDlg(EditorFrame&)': PreviewDlg.cpp:(.text+0x68e4): undefined reference to `wxWebControl::IsInitialized()' PreviewDlg.cpp:(.text+0x6925): undefined reference to `wxWebControl::wxWebControl(wxWindow*, int, wxPoint const&, wxSize const&)' PreviewDlg.cpp:(.text+0x758f): undefined reference to `wxWebControl::InitEngine(wxString const&)' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnButtonForward(wxCommandEvent&)': PreviewDlg.cpp:(.text+0x132): undefined reference to `wxWebControl::GoForward()' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnButtonBack(wxCommandEvent&)': PreviewDlg.cpp:(.text+0x182): undefined reference to `wxWebControl::GoBack()' ../ecore/libecore.so(cxInternal.o): In function `cxInternal::MoveOldSettings(eSettings&)': cxInternal.cpp:(.text+0x4d29): undefined reference to `eSettings::SetPageSettings(unsigned int, wxString const&, doc_id, int, int, wxString const&, std::vector<unsigned int, std::allocator<unsigned int> > const&, std::vector<cxBookmark, std::allocator<cxBookmark> > const&, eSettings::SubPage)' collect2: ld returned 1 exit status make: *** [e] Error 1 EDIT: Forgot the link http://github.com/etexteditor/e

    Read the article

  • Haskell Parsec Numeration

    - by Martin
    I'm using Text.ParserCombinators.Parsec and Text.XHtml to parse an input like this: - First type A\n -- First type B\n - Second type A\n -- First type B\n --Second type B\n And my output should be: <h11 First type A\n</h1 <h21.1 First type B\n</h2 <h12 Second type A\n</h2 <h22.1 First type B\n</h2 <h22.2 Second type B\n</h2 I have come to this part, but I cannot get any further: title1= do{ ;(count 1 (char '-')) ;s <- many1 anyChar newline ;return (h1 << s) } title2= do{ ;(count 2 (char '--')) ;s <- many1 anyChar newline ;return (h1 << s) } text=do { ;many (choice [try(title1),try(title2)]) } main :: IO () main = do t putStr "Error: " print err Right x - putStrLn $ prettyHtml x This is ok, but it does not include the numbering. Any ideas? Thanks!

    Read the article

  • Specifying a no-indent for a list, with LaTeX

    - by Andreas Grech
    I have the following: This is just normal text... \begin{enumerate} \item First Item ?\\\\ This is the text of the first item \item Second Item ?\\\\ This is the text of the second item \end{enumerate} Which renders the following: This is just normal text... 1. First Item ? This is the text of the first item 2. Second Item ? This is the text of the second item I want to specify that the text of the items has no indentation. Basically, I want it to be rendered like such: This is just normal text... 1. First Item ? This is the text of the first item 2. Second Item ? This is the text of the second item How can I specify this form of no indentation?

    Read the article

  • php compare array keys, not values

    - by user271619
    I am successfully using the array_key_exists(), as described by php.net Example: <?php $search_array = array('first' => 1, 'second' => 4); if (array_key_exists('first', $search_array)) { echo "The 'first' element is in the array"; } ?> But, take out the values, and it doesn't work. <?php $search_array = array('first', 'second'); if (array_key_exists('first', $search_array)) { echo "The 'first' element is in the array"; } ?> Not sure how to only compare 2 arrays by their keys only.

    Read the article

  • Browser back button broken between hidden div's

    - by Linda
    First of all, these pages will never be on the web but will be in internal memory. They are a group of linked documents---an ebook. http://www.anmldr.com/testdivs When I click on the link in the first div, the second div becomes visible and the first div is hidden. The problem is with the browser's back button. If you then click on the back button, the URL updates but the first div does not show again. How can I correct the back button so that the first div shows? The link from the second div to the first div works fine but it is the browser back button that I do not know how to work with. Thanks, Linda P.S. These are using CSS3 so it is better to use a WebKit based browser.

    Read the article

  • Jquery load DIV inside another DIV at same page

    - by Sergio
    HTML: <div class="someclass" rel="first">text 1</div> <div class="someclass" rel="second">text 2</div></div></div> <div class="info_ly">here is some text</div> <div class="first" > the first DIV </div> <div class="second" > the second DIV </div> CSS: .first{ display:none} .second{ display:none} Jquery: $(".someclass").click(function() { $(".info_ly").html($(this).attr('rel')); }); I want to call and load the "rel" DIV inside "info_ly" DIV. With this Jquery code I get only text "first" or "second" inside "info_ly" DIV. How can I load the DIV with the class "first" or DIV with the class "second" inside "info_ly" DIV?

    Read the article

  • Advice about a good Java book?

    - by camac1
    Hi people, I am new to Java but have experience programming in C/C++/C#. I wanted to learn Java SE 6 first before moving to Java EE 6. After making some research online for appropriate Java SE 6 books, I found that these are appropriate for me to get an excellent idea of Java SE 6: 1) Head First Java, 2nd Edition 2) An Intermediate Level Book <----------- 3) Effective Java (2nd Edition) 4) Java Concurrency in Practice 5) Java Generics and Collections 6) Java Concise Reference Series: Swing And AWT 7) Java Reflection in Action However, I am having trouble choosing an Intermediate Level Book which will provide me with breadth and depth in Java SE 6. I was thinking about the book "Thinking in Java (4th Edition)"....Unfortunately, its deals with Java SE 5 and not the latest version. Could anybody please advice me an intermediate level book which could provide me with breadth and depth in Java SE 6. Regards

    Read the article

  • Help with this reg. exp. in PHP

    - by Jonathan
    Hi, i don't know about regular expressions, I asked here for one that: gets either anything up to the first parenthesis/colon or the first word inside the first parenthesis. This was the answer: preg_match('/(?:^[^(:]+|(?<=^\\()[^\\s)]+)/', $var, $match); I need an improvement, I need to get either anything up to the first parenthesis/colon/quotation marks or the first word inside the first parenthesis. So if I have something like: $var = 'story "The Town in Hell"s Backyard'; // I get this: $match = 'story'; $var = "screenplay (based on)"; // I get this: $match = 'screenplay'; $var = "(play)"; // I get this: $match = 'play'; $var = "original screen"; // I get this: $match = 'original screen'; Thanks!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Why has my computer started to make noises when I turn it on after I put it into sleep mode for the first time a week ago?

    - by Acid2
    I would usually have my pc on all day and fully shut it down at night time before I went to bed. I decided to put it into sleep mode instead the other day and everything was fine but when I woke it from sleep, I was presented with the blue screen of death and it started with some weird noise that sounded like some spinning part was off balance or possibly hitting something periodically. Sounds like it could be a fan or maybe the HDD. I'm not sure why sleep mode would mess up the hardware. Anyway, now sometimes, randomly, when I turn my computer on from a previous shut down, I still get to hear the noise but the start-up is normal. Sometimes I don't hear anything for the entire duration while I have it on and sometimes it goes away after a few minutes and sometimes it doesn't and I have to restart, like it isn't going away right now. I can hear the noise as I type this. Anyone got possible solutions? I don't want to open the system and mess up other stuff. I'm also not sure if I should take it somewhere to have it fixed - it might not make the noise then and work like normal and nothing would seem like needing to be fixed. Add: I'm running Windows 7, if that's of any relevance.

    Read the article

  • DOM class injection in PHP

    - by Adam Kiss
    idea Via jQuery, I was able to mark all :first-child and :last-child elements in document (well, almost all :)) with class first which could I later style (i.e. first li in ul#navigation would be easily adressable as ul#navigation .first). I used following code: var $f = $('*:first-child') $f.addClass('first'); var $l = $('body *:last-child') $l.addClass('last'); question Now, my question is if it's possible to do the same via php, so non-JS users/gadgets could have the same effects and additional styling and also it would be less overkill on browser. So, is it possible to capture output, parse it as html and inject this class easily in php?

    Read the article

  • PHP: Is there an elegant way to foreach through multiple items (groups) at a time?

    - by acheong87
    Given an array of N items: $arr = array('a', 'b', 'c', 'd', 'e', 'f'); What's the most elegant way to loop through in groups of M items (assuming N is divisible by M)? I tried foreach (array_chunk($arr, 2) as list($first, $second)) { // do stuff with $first and $second } but this resulted in a syntax error. In other words, I want to emulate what in Tcl would look like this: set arr [a b c d e f] foreach {first second} $arr { // do stuff with $first and $second } For now I've resorted to the obvious measure: foreach (array_chunk($arr, 2) as $group) { $first = $group[0]; $second = $group[1]; // do stuff with $first and $second } But I'm hoping someone has a more elegant method...

    Read the article

  • Excel file reading with 2007 office connection string.

    - by p-vasuu
    Actually in my system having 2007 office then i am reading the 2003 .xls file with using the 2007 connection string string ConnectionString = "Provider=Microsoft.ACE.OLEDB.12.0;Data Source=" + Filename + ";Extended Properties=\"Excel 8.0;HDR=YES;\""; data is not reading. But if the first row first column data length is lessthen 255 then the following first columns data is cutting up to 255 character. If the First row first column is morethan the 255 character then the following first columns data is reading fine. Is there any back word computability is there?

    Read the article

  • recursively reverse linked list.

    - by Amanda
    I am implementing a function to recursively reverse a linked-list, but getting seg-fault. typedef struct _node { int data; struct _node *next; } Node, *NodeP; NodeP recursiveReverseList(NodeP first){ if(first == NULL) return NULL; if(first->next == NULL) return head; NodeP rest = recursiveReverseList(head->next); rest->next = first; first->next = NULL; return first; } Can you please help. P.S. The iterative version is working fine though. Its not homework. Just practicing C.

    Read the article

  • C++ : Swapping template class elements of different types?

    - by metamemetics
    template< class T1, class T2 > class Pair { T1 first; T2 second; }; I'm being asked to write a swap() method so that the first element becomes the second and the second the first. I have: Pair<T2,T1> swap() { return Pair<T2,T1>(second, first); } But this returns a new object rather than swapping, where I think it needs to be a void method that changes its own data members. Is this possible to do since T1 and T2 are potentially different class types? In other words I can't simply set temp=first, first=second, second=temp because it would try to convert them to different types. I'm not sure why you would potentially want to have a template object that changes order of its types as it seems that would cause confusion but that appears to be what I'm being asked to do.

    Read the article

  • How to check whether iterators form a contiguous memory zone?

    - by Vincent
    I currently have the following function to read an array or a vector of raw data (_readStream is a std::ifstream) : template<typename IteratorType> inline bool MyClass::readRawData( const IteratorType& first, const IteratorType& last, typename std::iterator_traits<IteratorType>::iterator_category* = nullptr ) { _readStream.read(reinterpret_cast<char*>(&*first), (last-first)*sizeof(*first)); return _readStream.good(); } First question : does this function seem ok for you ? As we read directly a block of memory, it will only work if the memory block from first to last is contiguous in memory. How to check that ?

    Read the article

< Previous Page | 79 80 81 82 83 84 85 86 87 88 89 90  | Next Page >