Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 838/998 | < Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >

  • Moving to an arbitrary position in a file in Python

    - by B Rivera
    Let's say that I routinely have to work with files with an unknown, but large, number of lines. Each line contains a set of integers (space, comma, semicolon, or some non-numeric character is the delimiter) in the closed interval [0, R], where R can be arbitrarily large. The number of integers on each line can be variable. Often times I get the same number of integers on each line, but occasionally I have lines with unequal sets of numbers. Suppose I want to go to Nth line in the file and retrieve the Kth number on that line (and assume that the inputs N and K are valid --- that is, I am not worried about bad inputs). How do I go about doing this efficiently in Python 3.1.2 for Windows? I do not want to traverse the file line by line. I tried using mmap, but while poking around here on SO, I learned that that's probably not the best solution on a 32-bit build because of the 4GB limit. And in truth, I couldn't really figure out how to simply move N lines away from my current position. If I can at least just "jump" to the Nth line then I can use .split() and grab the Kth integer that way. The nuance here is that I don't just need to grab one line from the file. I will need to grab several lines: they are not necessarily all near each other, the order in which I get them matters, and the order is not always based on some deterministic function. Any ideas? I hope this is enough information. Thanks!

    Read the article

  • Where is rebol fill-pen documented (to get glow effect on a round rectangle) ?

    - by Rebol Tutorial
    There is some discussion here about fill-pen http://www.mail-archive.com/[email protected]/msg02019.html But I can't see documentation about cubic, diamond, etc... effect for fill-pen in rebol's official doc ? I'm trying to draw some round rectangle with glowing effect but don't really understand the parameters I'm playing with so I can't get exactly what I'd like (I'd like the glow effect starting from the center not from the dark left top corner): view layout [ box 278x185 effect [ ; default box face size is 100x100 draw [ anti-alias on ; information for the next draw element (not required) line-width 2.5 ; number of pixels in width of the border pen black ; color of the edge of the next draw element ; fill pen is a little complex: ;fill-pen 10x10 0 90 0 1 1 0.0.0 255.0.0 255.0.255 fill-pen radial 20x20 5 55 5 5 10 0.0.0 55.0.5 55.0.5 ; the draw element box ; another box drawn as an effect 15 ; size of rounding in pixels 0x0 ; upper left corner 278x170 ; lower right corner ] ] ]

    Read the article

  • In App Purchase Unique Identifying Data

    - by dageshi
    O.K so I'm writing a iPhone travel guide, you purchase a subscription to a travel guide for 3 months, it downloads a fairly hefty database and for 3 months that database gets updated weekly with new stuff. Now what I'd like to do is make the user enter their email address as a one off action before they purchase their first guide, for China say. The purpose for doing this is 1) To allow me to contact the user by email when they add a note/tip for a particular place (the app will allow them to send notes & information to me) 2) To Uniquely identify who has purchased the subscription so that if they wipe their device and reinstall the app they can plug the email address in and pickup their subscriptions again. Or so they can use the same subscription on another device they own. My concerns are 1) Will Apple allow the email method of restoring functionality to a second or restored device? 2) As long as I tell the user what I'm using their email address for (aka I won't sell it to anyone else and use it for X purposes) will it be o.k to ask for said email address? And as a side note, can I tack the devices unique id onto my server comms to track devices or is apple going to through a hissy fit about that as well?

    Read the article

  • Storing date/times as UTC in database

    - by James
    I am storing date/times in the database as UTC and computing them inside my application back to local time based on the specific timezone. Say for example I have the following date/time: 01/04/2010 00:00 Say it is for a country e.g. UK which observes DST (Daylight Savings Time) and at this particular time we are in daylight savings. When I convert this date to UTC and store it in the database it is actually stored as: 31/03/2010 23:00 As the date would be adjusted -1 hours for DST. This works fine when your observing DST at time of submission. However, what happens when the clock is adjusted back? When I pull that date from the database and convert it to local time that particular datetime would be seen as 31/03/2009 23:00 when in reality it was processed as 01/04/2010 00:00. Correct me if I am wrong but isn't this a bit of a flaw when storing times as UTC? Example of Timezone conversion Basically what I am doing is storing the date/times of when information is being submitted to my system in order to allow users to do a range report. Here is how I am storing the date/times: public DateTime LocalDateTime(string timeZoneId) { var tzi = TimeZoneInfo.FindSystemTimeZoneById(timeZoneId); return TimeZoneInfo.ConvertTimeFromUtc(DateTime.UtcNow, tzi).ToLocalTime(); } Storing as UTC: var localDateTime = LocalDateTime("AUS Eastern Standard Time"); WriteToDB(localDateTime.ToUniversalTime());

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Why can't I display a unicode character in the Python Interpreter on Mac OS X Terminal.app?

    - by apphacker
    If I try to paste a unicode character such as the middle dot: · in my python interpreter it does nothing. I'm using Terminal.app on Mac OS X and when I'm simply in in bash I have no trouble: :~$ · But in the interpreter: :~$ python Python 2.6.1 (r261:67515, Feb 11 2010, 00:51:29) [GCC 4.2.1 (Apple Inc. build 5646)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> ^^ I get nothing, it just ignores that I just pasted the character. If I use the escape \xNN\xNN representation of the middle dot '\xc2\xb7', and try to convert to unicode, trying to show the dot causes the interpreter to throw an error: >>> unicode('\xc2\xb7') Traceback (most recent call last): File "<stdin>", line 1, in <module> UnicodeDecodeError: 'ascii' codec can't decode byte 0xc2 in position 0: ordinal not in range(128) I have setup 'utf-8' as my default encoding in sitecustomize.py so: >>> sys.getdefaultencoding() 'utf-8' What gives? It's not the Terminal. It's not Python, what am I doing wrong?! This question is not related to this question, as that indivdiual is able to paste unicode into his Terminal.

    Read the article

  • Still don't understand file upload-folder permissions

    - by Camran
    I have checked out articles and tutorials. I don't know what to do about the security of my picture upload-folder. It is pictures for classifieds which should be uploaded to the folder. This is what I want: Anybody may upload images to the folder. The images will be moved to another folder, by another php-code later on (automatic). Only I may manually remove them, as well as another php file on the server which automatically empties the folder after x-days. What should I do here? The images are uploaded via a php-upload script. This script checks to see if the extension of the file is actually a valid image-file. When I try this: chmod 755 images the images wont be uploaded. But like this it works: chmod 777 images But 777 is a security risk right? Please give me detailed information... The Q is, what to do to solve this problem, not info about what permissions there are etc etc... Thanks If you need more info let me know...

    Read the article

  • Mysql many to many problem (leaderborad/scoreboard)

    - by zoko2902
    Hi all! I'm working on a small project in regards of the upcoming World Cup. I'm building a roster/leaderboard/scoredboard based on groups with national teams. The idea is to have information on all upcoming matches within the group or in the knockout phase (scores, time of the match, match stats etc.). Currently I'm stuck with the DB in that I can't come up with a query that would return paired teams in a row. I have these 3 tables: CREATE TABLE IF NOT EXISTS `wc_team` ( `id` INT NOT NULL AUTO_INCREMENT , `name` VARCHAR(45) NULL , `description` VARCHAR(250) NULL , `flag` VARCHAR(45) NULL , `image` VARCHAR(45) NULL , `added` TIMESTAMP NULL DEFAULT CURRENT_TIMESTAMP , PRIMARY KEY (`id`) , CREATE TABLE IF NOT EXISTS `wc_match` ( `id` INT NOT NULL AUTO_INCREMENT , `score` VARCHAR(6) NULL , `date` DATE NULL , `time` VARCHAR(45) NULL , `added` TIMESTAMP NULL DEFAULT CURRENT_TIMESTAMP , PRIMARY KEY (`id`) , CREATE TABLE IF NOT EXISTS `wc_team_has_match` ( `wc_team_id` INT NOT NULL , `wc_match_id` INT NOT NULL , PRIMARY KEY (`wc_team_id`, `wc_match_id`) , I've simplified the tables so we don't go in the wrong direction. Now I've tried al kinds of joins and groupings I could think of, but I never seem to get. Example guery: SELECT t.wc_team_id,t.wc_match_id,c.id.c.name,d.id,d.name FROM wc_team_has_match AS t LEFT JOIN wc_match AS s ON t.wc_match_id = s.id LEFT JOIN wc_team AS c ON t.wc_team_id = c.id LEFT JOIN wc_team AS d ON t.wc_team_id = d.id Which returns: wc_team_id wc_match_id id name id name 16 5 16 Brazil 16 Brazil 18 5 18 Argentina 18 Argentina But what I really want is: wc_team_id wc_match_id id name id name 16 5 16 Brazil 18 Argentina Keep in mind that a group has more matches I want to see all those matches not only one. Any pointer or suggestion would be extremly appreciated since I'm stuck like a duck on this one :).

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

  • Bing Map on Windows Phone - add click events to pushpins; display more details

    - by Will Gill
    I have a WP Phone app using a Bing Map control. I have an array of objects, and each object has a location. I iterate the array to place the pins on the map (see below). I have a touch event bound to each pin to allow the user to tap the pin to start an action. Now - I would like, on tap, to show information from the object that relates to that pin to be shown in a textbox. How can I retrieve the object from the array that corresponds to the pushpin that was tapped/clicked? foreach (wikiResult result in arrayResults) { double lat = double.Parse(result.Latitude, CultureInfo.InvariantCulture); double lng = double.Parse(result.Longitude, CultureInfo.InvariantCulture); statusTextBlock.Text = result.Latitude + " " + result.Longitude + " " + lat + " " + lng; GeoCoordinate d = new GeoCoordinate(lat, lng); Pushpin pin; pin = new Pushpin(); pin.Location = d; pin.Content = result.Name; pin.MouseLeftButtonUp += new MouseButtonEventHandler(pin1_MouseLeftButtonUp); myMap.Children.Add(pin); } void pin1_MouseLeftButtonUp(object sender, MouseButtonEventArgs e) { //display the content from the object in a text box } Many thanks in advance!

    Read the article

  • Forces to prompt download box IE

    - by Bruno Costa
    Hello, I'm having a problem with some reports in the application I'm doing manutention I've a button that does a postback to the server and do some information and then get back to the cliente and open a popup to download the report. private void grid_ItemCommand(object source, System.Web.UI.WebControls.DataGridCommandEventArgs e) { ... ClientScript.RegisterClientScriptBlock(this.GetType(), "xxx", "<script>javascript:window.location('xx.aspx?m=x','xxx','width=750,height=350,directories=no,location=no,menubar=no,scrollbars,status=no,toolbar=no,resizable=yes,left=50,top=50');</script>"); } Then in xxx.aspx I've the code: Response.ClearContent(); Response.ClearHeaders(); Response.TransmitFile(tempFileName); Response.Flush(); Response.Close(); File.Delete(tempFileName); Response.End(); This works fine if IE option Automatic prompting for file downloads is enabled. But by default this is disabled and I need to force the download box to be prompting. Can I do anything without change a lot of code? Thanks.

    Read the article

  • Why is Firefox so bloated? [closed]

    - by bvandrunen
    First off I am a developer who loves firebug and other development tools (and no Chrome firebug lite does not cut it) and am just utterly frustrated when I have been using Firefox lately. It is at the point where I use Chrome for absolutely everything but web development but am still frustrated that I had to switch where half a year ago or more Firefox was fine. Why can't there be a Firefox lite? One that is free from all the bloat that has been plaguing Firefox recently. Also if there are any tools or tips that I can free up my Firefox that would be great. I am using the newest version + as few add-ons as possible. EDIT: I have tried Chrome Developer Tools and I do like them...but I can't get passed the firebug lite extension of Chrome. Some of the developer tools are great but sometimes they just have too much information. I extensively use Firebug/myphp admin. Both of these work much much better in Firefox then Chrome. But I hate that it takes me so much longer to load and use everything.

    Read the article

  • Python: Created nested dictionary from list of paths

    - by sberry2A
    I have a list of tuples the looks similar to this (simplified here, there are over 14,000 of these tuples with more complicated paths than Obj.part) [ (Obj1.part1, {<SPEC>}), (Obj1.partN, {<SPEC>}), (ObjK.partN, {<SPEC>}) ] Where Obj goes from 1 - 1000, part from 0 - 2000. These "keys" all have a dictionary of specs associated with them which act as a lookup reference for inspecting another binary file. The specs dict contains information such as the bit offset, bit size, and C type of the data pointed to by the path ObjK.partN. For example: Obj4.part500 might have this spec, {'size':32, 'offset':128, 'type':'int'} which would let me know that to access Obj4.part500 in the binary file I must unpack 32 bits from offset 128. So, now I want to take my list of strings and create a nested dictionary which in the simplified case will look like this data = { 'Obj1' : {'part1':{spec}, 'partN':{spec} }, 'ObjK' : {'part1':{spec}, 'partN':{spec} } } To do this I am currently doing two things, 1. I am using a dotdict class to be able to use dot notation for dictionary get / set. That class looks like this: class dotdict(dict): def __getattr__(self, attr): return self.get(attr, None) __setattr__ = dict.__setitem__ __delattr__ = dict.__delitem__ The method for creating the nested "dotdict"s looks like this: def addPath(self, spec, parts, base): if len(parts) > 1: item = base.setdefault(parts[0], dotdict()) self.addPath(spec, parts[1:], item) else: item = base.setdefault(parts[0], spec) return base Then I just do something like: for path, spec in paths: self.lookup = dotdict() self.addPath(spec, path.split("."), self.lookup) So, in the end self.lookup.Obj4.part500 points to the spec. Is there a better (more pythonic) way to do this?

    Read the article

  • Reversible numerical calculations in Prolog

    - by user8472
    While reading SICP I came across logic programming chapter 4.4. Then I started looking into the Prolog programming language and tried to understand some simple assignments in Prolog. I found that Prolog seems to have troubles with numerical calculations. Here is the computation of a factorial in standard Prolog: f(0, 1). f(A, B) :- A > 0, C is A-1, f(C, D), B is A*D. The issues I find is that I need to introduce two auxiliary variables (C and D), a new syntax (is) and that the problem is non-reversible (i.e., f(5,X) works as expected, but f(X,120) does not). Naively, I expect that at the very least C is A-1, f(C, D) above may be replaced by f(A-1,D), but even that does not work. My question is: Why do I need to do this extra "stuff" in numerical calculations but not in other queries? I do understand (and SICP is quite clear about it) that in general information on "what to do" is insufficient to answer the question of "how to do it". So the declarative knowledge in (at least some) math problems is insufficient to actually solve these problems. But that begs the next question: How does this extra "stuff" in Prolog help me to restrict the formulation to just those problems where "what to do" is sufficient to answer "how to do it"?

    Read the article

  • How do I run NUnit in debug mode from Visual Studio?

    - by Jon Cage
    I've recently been building a test framework for a bit of C# I've been working on. I have NUnit set up and a new project within my workspace to test the component. All works well if I load up my unit tests from Nunit (v2.4), but I've got to the point where it would be really useful to run in debug mode and set some break points. I've tried the suggestions from several guides which all suggest changing the 'Debug' properties of the test project: Start external program: C:\Program Files\NUnit 2.4.8\bin\nunit-console.exe Command line arguments: /assembly: <full-path-to-solution>\TestDSP\bin\Debug\TestDSP.dll I'm using the console version there, but have tried the calling the GUI as well. Both give me the same error when I try and start debugging: Cannot start test project 'TestDSP' because the project does not contain any tests. Is this because I normally load \DSP.nunit into the Nunit GUI and that's where the tests are held? I'm beginning to think the problem may be that VS wants to run it's own test framework and that's why it's failing to find the NUnit tests? [Edit] To those asking about test fixtures, one of my .cs files in the TestDSP project looks roughly like this: namespace Some.TestNamespace { // Testing framework includes using NUnit.Framework; [TestFixture] public class FirFilterTest { /// <summary> /// Tests that a FirFilter can be created /// </summary> [Test] public void Test01_ConstructorTest() { ...some tests... } } } ...I'm pretty new to C# and the Nunit test framework so it's entirely possible I've missed some crucial bit of information ;-) [FINAL SOLUTION] The big problem was the project I'd used. If you pick: Other Languages->Visual C#->Test->Test Project ...when you're choosing the project type, Visual Studio will try and use it's own testing framework as far as I can tell. You should pick a normal c# class library project instead and then the instructions in my selected answer will work.

    Read the article

  • Looking to reimplement build toolchain from bash/grep/sed/awk/(auto)make/configure to something more

    - by wash
    I currently maintain a few boxes that house a loosely related cornucopia of coding projects, databases and repositories (ranging from a homebrew *nix distro to my class notes), maintained by myself and a few equally pasty-skinned nerdy friends (all of said cornucopia is stored in SVN). The vast majority of our code is in C/C++/assembly (a few utilities are in python/perl/php, we're not big java fans), compiled in gcc. Our build toolchain typically consists of a hodgepodge of make, bash, grep, sed and awk. Recent discovery of a Makefile nearly as long as the program it builds (as well as everyone's general anxiety with my cryptic sed and awking) has motivated me to seek a less painful build system. Currently, the strongest candidate I've come across is Boost Build/Bjam as a replacement for GNU make and python as a replacement for our build-related bash scripts. Are there any other C/C++/asm build systems out there worth looking into? I've browsed through a number of make alternatives, but I haven't found any that are developed by names I know aside from Boost's. (I should note that an ability to easily extract information from svn commandline tools such as svnversion is important, as well as enough flexibility to configure for builds of asm projects as easily as c/c++ projects)

    Read the article

  • Testing a method used from an abstract class

    - by Bas
    I have to Unit Test a method (runMethod()) that uses a method from an inhereted abstract class to create a boolean. The method in the abstract class uses XmlDocuments and nodes to retrieve information. The code looks somewhat like this (and this is extremely simplified, but it states my problem) namespace AbstractTestExample { public abstract class AbstractExample { public string propertyValues; protected XmlNode propertyValuesXML; protected string getProperty(string propertyName) { XmlDocument doc = new XmlDocument(); doc.Load(new System.IO.StringReader(propertyValues)); propertyValuesXML= doc.FirstChild; XmlNode node = propertyValuesXML.SelectSingleNode(String.Format("property[name='{0}']/value", propertyName)); return node.InnerText; } } public class AbstractInheret : AbstractExample { public void runMethod() { bool addIfContains = (getProperty("AddIfContains") == null || getProperty("AddIfContains") == "True"); //Do something with boolean } } } So, the code wants to get a property from a created XmlDocument and uses it to form the result to a boolean. Now my question is, what is the best solution to make sure I have control over the booleans result behaviour. I'm using Moq for possible mocking. I know this code example is probably a bit fuzzy, but it's the best I could show. Hope you guys can help.

    Read the article

  • Why do I get a security warning in visual studio 2008 when creating a project?

    - by MikeG
    This is the error, it's basically a security warning (And here's the text grabbed off the dialog box) Security Warning for WindowsApplication4 __________________________I The WindowsApplication4 project file has been customized and could present a security risk by executing custom build steps when opened in Microsoft Visual Studio. If this project came from an untrustwoithy source, it could cause damage to your computer or compromise your private information. More Details Project load options 0 Load project for browsing Opens the project in Microsoft Visual Studio with increased security. This option allows you to browse the contents of the project, but some functionality, such as IntelliSense, is restricted, When a project is loaded for browsing, actions such as building, cleaning, publishing, or opening designers could still remain unsafe. Load project normally Opens the project normally in Microsoft Visual Studio. Use this option if you trust the source and understand the potential risks involved. Microsoft Visual Studio does not restrict any project functionality and will not prompt you again for this project. Ask me for every project in this solution OK L Cancel When click the more details button get this: Microsoft Visual Studio __ An item referring to the file was found in the project file “C:\Users\mgriffiths\Documents\Visual Studio 2008\ProjectATemp\Win dowsApplication4\WindowsApplicdtion4\W in dowsApplication4.vbproj”. Since this file is located within a system directory, root directory, or network share, it could be harmful to write to this file. OK

    Read the article

  • Learning libraries without books or tutorials

    - by Kawili-wili
    While many ask questions about where to find good books or tutorials, I'd like to take the opposite tack. I consider myself to be an entry-level programmer ready to move up to mid-level. I have written code in c, c++, c#, perl, python, clojure, vb, and java, so I'm not completely clueless. Where I see a problem in moving to the next level is learning to make better use of the literally hundreds upon hundreds of libraries available out there. I seem paralyzed unless there is a specific example in a book or tutorial to hand-hold me, yet I often read in various forums where another programmer attempts to assist with a question. He/she will look through the docs or scan the available classes/methods in their favorite IDE and seem to grok what's going on in a relatively short period of time, even if they had no previous experience with that specific library or function. I yearn to break the umbilical chord of constantly spending hour upon hour searching and reading, searching and reading, searching and reading. Many times there is no book or tutorial, or if there is, the discussion glosses over my specific needs or the examples shown are too far off the path for the usage I had in mind or the information is outdated and makes use of deprecated components or the library itself has fallen out of mainstream, yet is still perfectly usable (but no docs, books, or tutorials to hand-hold). My question is: In the absence of books or tutorials, what is the best way to grok new or unfamiliar libraries? I yearn to slicken the grok path so I can get down to the business of doing what I love most -- coding.

    Read the article

  • getting jpeg error

    - by bhaskaragr29
    <?php function LoadPNG() { /* Attempt to open */ //require_once 'resizex.php'; $imgname="/home2/puneetbh/public_html/prideofhome/wp-content/uploads/268995481image_11.png"; //$im = @imagecreatefrompng($imgname); $img= imagecreatefromstring(file_get_contents($imgname)); //$im=imagecreatefrompng('images/frame.png'); $im= imagecreatefromjpeg('images/frame.jpeg'); //imagealphablending($img, false); //imagesavealpha($img, true); //$img=resizex("$url",60,65,1); imagecopymerge($im,$img,105,93,0, 0,275,258,100); /* See if it failed */ if(!$im) { /* Create a blank image */ $im = imagecreatetruecolor(150, 30); $bgc = imagecolorallocate($im, 255, 255, 255); $tc = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, 150, 30, $bgc); /* Output an error message */ imagestring($im, 1, 5, 5, 'Error loading ' . $imgname, $tc); } return $im; } $img = LoadPNG(); header('Content-type: image/jpeg'); imagejpeg($im); imagedestroy($im); imagedestroy($img); ?> i am getting error arning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: gd-jpeg: JPEG library reports unrecoverable error: in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: 'images/frame.jpeg' is not a valid JPEG file in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecopymerge(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 16 Warning: Cannot modify header information - headers already sent by (output started at /home2/puneetbh/public_html/prideapp/frame.php:11) in /home2/puneetbh/public_html/prideapp/frame.php on line 34 Warning: imagejpeg(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 35 Warning: imagedestroy(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 36

    Read the article

  • What is best practice about having one-many hibernate

    - by Patrick
    Hi all, I believe this is a common scenario. Say I have a one-many mapping in hibernate Category has many Item Category: @OneToMany( cascade = {CascadeType.ALL},fetch = FetchType.LAZY) @JoinColumn(name="category_id") @Cascade( value = org.hibernate.annotations.CascadeType.DELETE_ORPHAN ) private List<Item> items; Item: @ManyToOne(targetEntity=Category.class,fetch=FetchType.EAGER) @JoinColumn(name="category_id",insertable=false,updatable=false) private Category category; All works fine. I use Category to fully control Item's life cycle. But, when I am writing code to update Category, first I get Category out from DB. Then pass it to UI. User fill in altered values for Category and pass back. Here comes the problem. Because I only pass around Category information not Item. Therefore the Item collection will be empty. When I call saveOrUpdate, it will clean out all associations. Any suggestion on what's best to address this? I think the advantage of having Category controls Item is to easily main the order of Item and not to confuse bi-directly. But what about situation that you do want to just update Category it self? Load it first and merge? Thank you.

    Read the article

  • adding a div with data()

    - by Dizzy Bryan High
    Hi people am generating a list of flash swfs, the information comes from an ajax call which returns a json object which i loop through to create the rows of data using my makeAppRow function. makeAppRow = function(myData){ var myStr = '<div class="fileEntry">' myStr = myStr +'<div class="appDate">'+dateFormat(myData.date_swf, "dS mmmm, yyyy, h:MM TT")+'</div>' myStr = myStr +'<div class="appName">'+myData.name_swf+'</div>' myStr = myStr +'<div class="appOptions" data>' myStr = myStr +'<div class="gotoAppBtn" data-options="'+myData+'">Open App</div>' myStr = myStr +'</div>' myStr = myStr +'</div>' $('#appData').append(myStr); } I need the json data to be attached to the gotoAppBtn so that when its clicked i can read in the data from the attached json object and use it in my click function, as you can see ive been trying to embed the data using the html5 data but i cant get it to work. <div class="gotoAppBtn" data-options="'+myData+'">Open App</div> i have a function so that when the button is clicked it loads in an swf. $('.gotoAppBtn').live('click', function(){ //alert('button clicked') var myData = $(this).data("options") alert('../userfiles/'+myData.id_ugp+'/'+myData.id_swf+'/'+myData.launchfile_swf+'') console.log(myData); var flashvars = {}; var params = {}; params.menu = "false"; params.quality = "best"; params.scale = "noscale"; var attributes = {}; attributes.id = "flashAppDisplay"; attributes.name = "flashAppDisplay"; swfobject.embedSWF( '../userfiles/'+myData.id_ugp+'/'+myData.id_swf+'/'+myData.launchfile_swf+'', 'flashAppDisplay', myData.width_swf, myData.height_swf, myData.version_swf ,"../FAVideo/expressInstall.swf", flashvars, params, attributes) }); but the data does not seem to be there, any pointers on where i am going wrong, or a better way to achive this???

    Read the article

  • Meta tag depending of selected language and title

    - by lena
    Hi, I'm aware about Google ignore most of the time, meta tag and use content. (This is not the point here) I'm working on an existing web site, not created by me. I need a quick solution, I guess with variables. The website construction: (no known template system) index.html which is presentation page with language selection index.php which embeding menu, content, footer several content pages that are embedded by index.php What I need to do only for those 2 pages welcome_en.html and welcome_fr.html (these pages are embedded so no header possible on these page) to have different page title (browser title) and different META tag. Any solution is welcome Thanks extra information Language detection on index.php: <?php $lang = $_GET['lang']; $page = $_GET['page']; if ($_GET['page'] == "" || !$_GET['page']) { $page = "welcome"; } if ($_GET['lang'] == "" || !$_GET['lang']) { $lang = "_fr"; } ? <td><img src="images/ban02<?php echo "$lang" ?>.jpg" width="531" height="60" <?php if ($_GET['lang'] == "_fr" || $_GET['lang'] == "" || !$_GET['lang']) { echo "alt='text'";} else if ($_GET['lang'] == "_en") {echo "alt='text'"; } ?>></td> for the embeded menu, footer ect like this one <?php include "menu.php"; ?> for the embedded content <?php //echo "$page$lang.html"; $lang = preg_replace('/[^a-z0-9_ ]/i', '', $_GET['lang']); $page = preg_replace('/[^a-z0-9_ ]/i', '', $_GET['page']); include $page . $lang . ".html"; ?>

    Read the article

  • Fastest XML parser for small, simple documents in Java

    - by Varkhan
    I have to objectify very simple and small XML documents (less than 1k, and it's almost SGML: no namespaces, plain UTF-8, you name it...), read from a stream, in Java. I am using JAXP to process the data from my stream into a Document object. I have tried Xerces, it's way too big and slow... I am using Dom4j, but I am still spending way too much time in org.dom4j.io.SAXReader. Does anybody out there have any suggestion on a faster, more efficient implementation, keeping in mind I have very tough CPU and memory constraints? [Edit 1] Keep in mind that my documents are very small, so the overhead of staring the parser can be important. For instance I am spending as much time in org.xml.sax.helpers.XMLReaderFactory.createXMLReader as in org.dom4j.io.SAXReader.read [Edit 2] The result has to be in Dom format, as I pass the document to decision tools that do arbitrary processing on it, like switching code based on the value of arbitrary XPaths, but also extracting lists of values packed as children of a predefined node. [Edit 3] In any case I eventually need to load/parse the complete document, since all the information it contains is going to be used at some point. (This question is related to, but different from, http://stackoverflow.com/questions/373833/best-xml-parser-for-java )

    Read the article

  • Populate asp.net MVC Index page with data from the database

    - by Sunil Ramu
    I have a web application in which I need to fetch data from the database and display in the index page. As you know, asp.net mvc has given options to edit delete etc... I need to populate the page using the conventional DB way and it uses a stored procedure to retrieve results. I dont want to use LINQ. This is my model entity class using System; using System.Collections.Generic; using System.Linq; using System.Web; namespace LogMVCApp.Models { public class Property { public int Id { get; set; } public string LogInId { get; set; } public string Username { get; set; } public string Action { get; set; } public string Information { get; set; } public bool Passed{get; set; } public string LogType { get; set; } } } and I need to retrieve data using something like this... var conString = ConfigurationManager.ConnectionStrings["connection"].ToString(); var conn = new SqlConnection(conString); var command = new SqlCommand("LogInsert", conn){CommandType=CommandType.StoredProcedure};

    Read the article

< Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >