Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 839/998 | < Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >

  • Why can't I display a unicode character in the Python Interpreter on Mac OS X Terminal.app?

    - by apphacker
    If I try to paste a unicode character such as the middle dot: · in my python interpreter it does nothing. I'm using Terminal.app on Mac OS X and when I'm simply in in bash I have no trouble: :~$ · But in the interpreter: :~$ python Python 2.6.1 (r261:67515, Feb 11 2010, 00:51:29) [GCC 4.2.1 (Apple Inc. build 5646)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> ^^ I get nothing, it just ignores that I just pasted the character. If I use the escape \xNN\xNN representation of the middle dot '\xc2\xb7', and try to convert to unicode, trying to show the dot causes the interpreter to throw an error: >>> unicode('\xc2\xb7') Traceback (most recent call last): File "<stdin>", line 1, in <module> UnicodeDecodeError: 'ascii' codec can't decode byte 0xc2 in position 0: ordinal not in range(128) I have setup 'utf-8' as my default encoding in sitecustomize.py so: >>> sys.getdefaultencoding() 'utf-8' What gives? It's not the Terminal. It's not Python, what am I doing wrong?! This question is not related to this question, as that indivdiual is able to paste unicode into his Terminal.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Learning libraries without books or tutorials

    - by Kawili-wili
    While many ask questions about where to find good books or tutorials, I'd like to take the opposite tack. I consider myself to be an entry-level programmer ready to move up to mid-level. I have written code in c, c++, c#, perl, python, clojure, vb, and java, so I'm not completely clueless. Where I see a problem in moving to the next level is learning to make better use of the literally hundreds upon hundreds of libraries available out there. I seem paralyzed unless there is a specific example in a book or tutorial to hand-hold me, yet I often read in various forums where another programmer attempts to assist with a question. He/she will look through the docs or scan the available classes/methods in their favorite IDE and seem to grok what's going on in a relatively short period of time, even if they had no previous experience with that specific library or function. I yearn to break the umbilical chord of constantly spending hour upon hour searching and reading, searching and reading, searching and reading. Many times there is no book or tutorial, or if there is, the discussion glosses over my specific needs or the examples shown are too far off the path for the usage I had in mind or the information is outdated and makes use of deprecated components or the library itself has fallen out of mainstream, yet is still perfectly usable (but no docs, books, or tutorials to hand-hold). My question is: In the absence of books or tutorials, what is the best way to grok new or unfamiliar libraries? I yearn to slicken the grok path so I can get down to the business of doing what I love most -- coding.

    Read the article

  • CanCan polymorphic resource access problem

    - by Call 'naive' True
    Hi everybody, i don't quite understand how to restrict access to links in this particular case with CanCan. I always get "Edit" link displayed. So i believe the problem is in my incorrect definition of cancan methods(load_ and authorize_). I have CommentsController like that: class CommentsController < ApplicationController before_filter :authenticate_user! load_resource :instance_name => :commentable authorize_resource :article def index @commentable = find_commentable #loading our generic object end ...... private def find_commentable params.each { |name, value| if name =~ /(.+)_id$/ return $1.classify.constantize.includes(:comments => :karma).find(value) end } end end and i have in comments/index.html.erb following code that render file from other controller: <%= render :file => "#{get_commentable_partial_name(@commentable)}/show.html.erb", :collection => @commentable %> you can think about "#{get_commentable_partial_name(@commentable)}" like just "articles" in this case. Content of "articles/show.html.erb": <% if can? :update, @commentable %> <%= link_to 'Edit', edit_article_path(@commentable) %> | <% end %> my ability.rb: class Ability include CanCan::Ability def initialize(user) user ||= User.new # guest user if user.role? :admin can :manage, :all elsif user.role? :author can :read, [Article, Comment, Profile] can :update, Article, :user_id => user.id end end end relations with models is: class Comment < ActiveRecord::Base belongs_to :commentable, :polymorphic => true, :dependent => :destroy ... end class Article < ActiveRecord::Base has_many :comments, :as => :commentable, :dependent => :destroy ... end i have tried debug this issue like that user = User.first article = Article.first ability = Ability.new(user) ability.can?(:update, article) and i always get "= true" in ability check Note: user.role == author and article.user_id != user.id if you need more information please write thank's for your time && sorry for my english

    Read the article

  • Blackberry Asynchronous HTTP Requests - How?

    - by Kai
    The app I'm working on has a self contained database. The only time I need HTTP request is when the user first loads the app. I do this by calling a class that verifies whether or not a local DB exists and, if not, create one with the following request: HttpRequest data = new HttpRequest("http://www.somedomain.com/xml", "GET", this); data.start(); This xml returns a list of content, all of which have images that I want to fetch AFTER the original request is complete and stored. So something like this won't work: HttpRequest data = new HttpRequest("http://www.somedomain.com/xml", "GET", this); data.start(); HttpRequest images = new HttpRequest("http://www.somedomain.com/xmlImages", "GET", this); images.start(); Since it will not treat this like an asynchronous request. I have not found much information on adding callbacks to httpRequest, or any other method I could use to ensure operation 2 does not execute until operation 1 is complete. Any help would be appreciated. Thanks

    Read the article

  • How to find which file is open in eclipse editor without using IEditorPart?

    - by Destructor
    I want to know which file (or even project is enough) is opened in eclipse editor? I know we can do this once we get IEditorPart from doSetInput method, IFile file = ((IFileEditorInput) iEditorPart).getFile(); But I want the name of file without using IEditorPart, how can I do the same? Checking which is the selected file in project explorer is not of much help because, user can select multiple files at once and open all simultaneously and I did not way to distinguish which file opened at what time. Adding more info: I have an editor specified for a particular type of file, now every time it opens, during intializing editor I have some operation to do based on project properties. While initializing editor, I need the file handle (of the one which user opened/double clicked) or the corresponding project handle. I have my editor something this way: public class MyEditor extends TextEditor{ @Override protected void initializeEditor() { setSourceViewerConfiguration(new MySourceViewerConfiguration( CDTUITools.getColorManager(), store, "MyPartitions", this)); } //other required methods @Override protected void doSetInput(IEditorInput input) throws CoreException { if(input instanceof IFileEditorInput) { IFile file = ((IFileEditorInput) input).getFile(); } } } as I have done in the doSetInput() method , I want the file handle(even project handle is sufficient). But the problem is in initializeEditor() function there is no reference to editorInput, hence I am unable to get the file handle. In the source viewer configuration file, I set the code scanners and this needs some project specific information that will set the corresponding rules.

    Read the article

  • Android ArrayList<Location> passing between activities

    - by squixy
    I have simple class Track, which stores information about route: import java.io.Serializable; import java.util.ArrayList; import java.util.Date; import android.location.Location; public class Track implements Serializable { private static final long serialVersionUID = -5317697499269650204L; private Date date; private String name; private int time; private double distance, speed; private ArrayList<Location> route; public Track(String name, int time, double distance, ArrayList<Location> route) { this.date = new Date(); this.name = name; this.time = time; this.distance = distance; this.speed = distance / (time / 3600.); this.route = route; } public String getDate() { return String.format("Date: %1$td-%1$tb-%1$tY%nTime: %1$tH:%1$tM:%1$tS", date); } public String getName() { return name; } public int getTime() { return time; } public double getDistance() { return distance; } public float getSpeed() { return (float) speed; } public ArrayList<Location> getRoute() { return route; } @Override public String toString() { return String.format("Name: %s%nDate: %2$td-%2$tb-%2$tY%nTime: %2$tH:%2$tM:%2$tS", name, date); } } And I'm passing it from one activity to another: Intent showTrackIntent = new Intent(TabSavedActivity.this, ShowTrackActivity.class); showTrackIntent.putExtra("track", adapter.getItem(position)); startActivity(showTrackIntent); Where (Track object is element on ListView). I get error during passing Track object: java.lang.RuntimeException: Parcelable encountered IOException writing serializable object (name = classes.Track) What is happening?

    Read the article

  • PHP Cookie Warning...

    - by Nano HE
    Hi,I am new to PHP, I practised PHP setcookie() just now and failed. http://localhost/test/index.php <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <title></title> </head> <body> <?php $value = 'something from somewhere'; setcookie("TestCookie", $value); ?> </body> </html> http://localhost/test/view.php <?php // I plan to view the cookie value via view.php echo $_COOKIE["TestCookie"]; ?> But I failed to run index.php, IE warning like this. Warning: Cannot modify header information - headers already sent by (output started at C:\xampp\htdocs\test\index.php:9) in C:\xampp\htdocs\test\index.php on line 12 I enabled my IE 6 cookie no doubt. Is there anything wrong on my procedure above? Thank you. WinXP OS and XAMPP 1.7.3 used.

    Read the article

  • Spring security - same page to deliver different content based on user role

    - by Ramesh
    Hello, i tried to search for any previous post related to my issue but couldnt find any. I have a scenario where in page handles 3 different scenarios and one of them not working. This page returns different content depending on if the user is authenticated or anonymous. localhost:8080/myApp/muUrl?test=authenticatedContent - used for Scenario 1 & 2 localhost:8080/myApp/muUrl?test=anonymousContent - used for Scenario 3 Scenario: 1) Authenticated user accesing the page url - the user gets displayed correct information. Works fine 2) Anonymous user accesing page URL with parameters that requires authentication - If anonymous, there is second level of check on the content they are accessing. for example, based on the GET parameters, there is custom logic to determine if the user has to be authenticated. In which case the page gets redirected to login page (WORKS fine). 3) Anonymous user accessing page URL with parameters that doesnt need authentication - in this case i get the SAvedRequest and redirect to the URL which is taking me to an infinite loop. Am i missing something very obvious or is there a way in AuthenticationProcessFilterEntryPoint to say "DON'T redirect to LOGIN page but process it" ? thanks.

    Read the article

  • getting jpeg error

    - by bhaskaragr29
    <?php function LoadPNG() { /* Attempt to open */ //require_once 'resizex.php'; $imgname="/home2/puneetbh/public_html/prideofhome/wp-content/uploads/268995481image_11.png"; //$im = @imagecreatefrompng($imgname); $img= imagecreatefromstring(file_get_contents($imgname)); //$im=imagecreatefrompng('images/frame.png'); $im= imagecreatefromjpeg('images/frame.jpeg'); //imagealphablending($img, false); //imagesavealpha($img, true); //$img=resizex("$url",60,65,1); imagecopymerge($im,$img,105,93,0, 0,275,258,100); /* See if it failed */ if(!$im) { /* Create a blank image */ $im = imagecreatetruecolor(150, 30); $bgc = imagecolorallocate($im, 255, 255, 255); $tc = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, 150, 30, $bgc); /* Output an error message */ imagestring($im, 1, 5, 5, 'Error loading ' . $imgname, $tc); } return $im; } $img = LoadPNG(); header('Content-type: image/jpeg'); imagejpeg($im); imagedestroy($im); imagedestroy($img); ?> i am getting error arning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: gd-jpeg: JPEG library reports unrecoverable error: in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: 'images/frame.jpeg' is not a valid JPEG file in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecopymerge(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 16 Warning: Cannot modify header information - headers already sent by (output started at /home2/puneetbh/public_html/prideapp/frame.php:11) in /home2/puneetbh/public_html/prideapp/frame.php on line 34 Warning: imagejpeg(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 35 Warning: imagedestroy(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 36

    Read the article

  • CakePHP adding columns to a table

    - by vette982
    I have a Profile model/controller in my cake app as well as an index.ctp view in /views/profiles. Now, when I go to add a column to my table that is already filled with data, and then add the corresponding code to the view to pick up this column's data, it just gives me an empty result. My model: <?php class Profile extends AppModel { var $name = 'Profile'; } ?> My controller: <?php class ProfilesController extends AppController { var $name = 'Profiles'; function index() { $this->set('profiles', $this->Profile->find('all')); } } ?> My views printing (stripped down): <?php foreach ($profiles as $profile): ?> <?php echo $profile['Profile']['id']; ?> <?php echo $profile['Profile']['username']; ?> <?php echo $profile['Profile']['created']; ?> <?php echo $profile['Profile']['thumbnail'];?> <?php echo $profile['Profile']['account'];?> <?php endforeach; ?> Basically, the columns id, username, column, thumbnail always have been printing fine, but when I add a column called accountit returns no information (nothing prints, but no errors). Any suggestions?

    Read the article

  • Creating a complex tree model in Qt

    - by Zeke
    I'm writing an IRC Client (yes another one). Long story short. I'm writing a Server dialogue that keeps a list of this: Identity Networks Channels Addresses I have 3 different list views that will be for the Networks, Channels and Addresses. When the user changes the Identity (combo box). The network listview will lookup all the networks for that specific Identity. After it loads up the Networks it will automatically select the first network and then load all the channels and addresses for that specific network. The problem is I want to have 3 views for 1 model, to minimise all the memory and the loading of data. So that it makes it much easier to manage and not do a bunch of work. If you'd look at QColumnView it's the same exact thing. But I don't need it to be on one exact page since the views are on entirely different tabs to make it easier to go through the Server dialogue. I'm wondering what will be the best way to go about handling this complexity. The information is stored in a SQLite database. I already have the classes written to extract and store it. Just the modelling is the painful part of this solution.

    Read the article

  • Determine target architecture of binary file in Linux (library or executable)

    - by Fernando Miguélez
    We have an issue related to a Java application running under a (rather old) FC3 on a Advantech POS board with a Via C3 processor. The java application has several compiled shared libs that are accessed via JNI. Via C3 processor is suppossed to be i686 compatible. Some time ago after installing Ubuntu 6.10 on a MiniItx board with the same processor I found out that the previous statement is not 100% true. The Ubuntu kernel hanged on startup due to the lack of some specific and optional instructions of the i686 set in the C3 processor. These instructions missing in C3 implementation of i686 set are used by default by GCC compiler when using i686 optimizations. The solution in this case was to go with a i386 compiled version of Ubuntu distribution. The base problem with the Java application is that the FC3 distribution was installed on the HD by cloning from an image of the HD of another PC, this time an Intel P4. Afterwards the distribution needed some hacking to have it running such as replacing some packages (such as the kernel one) with the i383 compiled version. The problem is that after working for a while the system completely hangs without a trace. I am afraid that some i686 code is left somewhere in the system and could be executed randomly at any time (for example after recovering from suspend mode or something like that). My question is: Is there any tool or way to find out at what specific architecture is an binary file (executable or library) aimed provided that "file" does not give so much information?

    Read the article

  • Recommendations for Continuous integration for Mercurial/Kiln + MSBuild + MSTest

    - by TDD
    We have our source code stored in Kiln/Mercurial repositories; we use MSBuild to build our product and we have Unit Tests that utilize MSTest (Visual Studio Unit Tests). What solutions exist to implement a continuous integration machine (i.e. Build machine). The requirements for this are: A build should be kicked of when necessary (i.e. code has changed in the Repositories we care about) Before the actual build, the latest version of the source code must be acquired from the repository we are building from The build must build the entire product The build must build all Unit Tests The build must execute all unit tests A summary of success/failure must be sent out after the build has finished; this must include information about the build itself but also about which Unit Tests failed and which ones succeeded. The summary must contain which changesets were in this build that were not yet in the previous successful (!) build The system must be configurable so that it can build from multiple branches(/Repositories). Ideally, this system would run on a single box (our product isn't that big) without any server components. What solutions are currently available? What are their pros/cons? From the list above, what can be done and what cannot be done? Thanks

    Read the article

  • Updating a listitem in an ASPX page in SharePoint Designer

    - by Andy
    Hey All, Right now I'm using SharePoint Designer to create a new aspx page. I am using a data view to display information from a list. One of the fields in the list is a choice field. I was wondering if there was anyway that I could display all of the other fields but allow one field in the list to be edited on the page without adding an edit link. Ideally, I would like a user to go in and be able to edit a field value (hopefully in a drop down list) within a data view without being redirected to the list or a form. I'm thinking there is a way to do this through javascript to embed inside the HTML or through a workflow of some sort. I'm new to javascript and don't know how to do this. I have tried to insert a drop down list and provide a data source for it but it will only show all of the field values in the list. Thus, I am unable to display the choice options, show the current value in the listitem and edit/update the listitem. Hopefully this makes sense. Can anyone help me out here? Thanks a lot, Andy

    Read the article

  • Why am I returning empty records when querying in mysql with php?

    - by Brian Bolton
    I created the following script to query a table and return the first 30 results. The query returns 30 results, but they do not have any text or information. Why would this be? The table stores Vietnamese characters. The database is mysql4. Here's the page: http://saomaidanang.com/recentposts.php Here's the code: <?php header( 'Content-Type: text/html; charset=utf-8' ); //CONNECTION INFO $dbms = 'mysql'; $dbhost = 'xxxxx'; $dbname = 'xxxxxxx'; $dbuser = 'xxxxxxx'; $dbpasswd = 'xxxxxxxxxxxx'; $conn = mysql_connect($dbhost, $dbuser, $dbpasswd ) or die('Error connecting to mysql'); mysql_select_db($dbname , $conn); //QUERY $result = mysql_query("SET NAMES utf8"); $cmd = 'SELECT * FROM `phpbb_posts_text` ORDER BY `phpbb_posts_text`.`post_subject` DESC LIMIT 0, 30 '; $result = mysql_query($cmd); ?> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html dir="ltr"> <head> <title>recent posts</title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> </head> <body> <p> <?php //DISPLAY while ($myrow = mysql_fetch_row($result)) { echo 'post subject:'; echo(utf8_encode($myrow ['post_subject'])); echo 'post text:'; echo(utf8_encode($myrow ['post_text'])); } ?> </p> </body>

    Read the article

  • LDAP/AD Integrated Group/Membership Management Package suitable for embedding in an application

    - by Ernest
    In several web applications, it is often necessary to define groups of users for purposes of membership as well as role management. For example, in one of our applications we would like to user a group of "Network Engineers" and another group that consists of "Managers" of such Network Engineers. The information we need is contact details of members of each group. So far, we have written our own tools to allow the administrator of the application to add/delete/move groups and their memberships and either store them in a XML file or a database. Increasingly, companies already have the groups we want defined in LDAP/AD, so it would be best to create a pointer in our application to the correspoding group in LDAP. Although there are a number of LDAP libraries and LDAP browsers available and we could code this and provide a web front end to get a list of available groups and their members, we are wondering if there is already a "component framework" available that would readily provide this LDAP browsing functionality that we could just embed this into our application. Something between a library and a full LDAP browser product ? (To clarify, the use case is for an admin of our web application to create a locally relevant group name and then map it to an exiting LDAP group. To enable this in the UI, we would like to present a way for the admin to browse available groups in the company LDAP server, view their membership, and select the LDAP group they would like to map to the locally relevant group name. In a second step, we would then synchronize the members of that LDAP group and their contact details to a store in our application ) Appreciate any pointers.

    Read the article

  • Forces to prompt download box IE

    - by Bruno Costa
    Hello, I'm having a problem with some reports in the application I'm doing manutention I've a button that does a postback to the server and do some information and then get back to the cliente and open a popup to download the report. private void grid_ItemCommand(object source, System.Web.UI.WebControls.DataGridCommandEventArgs e) { ... ClientScript.RegisterClientScriptBlock(this.GetType(), "xxx", "<script>javascript:window.location('xx.aspx?m=x','xxx','width=750,height=350,directories=no,location=no,menubar=no,scrollbars,status=no,toolbar=no,resizable=yes,left=50,top=50');</script>"); } Then in xxx.aspx I've the code: Response.ClearContent(); Response.ClearHeaders(); Response.TransmitFile(tempFileName); Response.Flush(); Response.Close(); File.Delete(tempFileName); Response.End(); This works fine if IE option Automatic prompting for file downloads is enabled. But by default this is disabled and I need to force the download box to be prompting. Can I do anything without change a lot of code? Thanks.

    Read the article

  • Modify the server side functions using jquery

    - by ant
    Hi, I am developing one website using cakephp and jquery technologies. Server-side there are some functions which handles sql queris. As per requirement I want to modify server side functions on client side using jquery AJAX call. E.g. : Below is the function on server side to modify users information. function modifyUser(username,userid) { //update query statements } Then jquery AJAX call will be like this : $.ajax({ url: 'users/modiyUser', success: function() { alert("Updation done") or any statements. } }); and I want to modify above i.e. server side function depending upon client input criteria. $.ajax({ function users/modiyUser(username,userid) { // I will write here any other statements which gives me some other output. } }); Above AJAX call syntax may not present, but i think you all understood what I am trying to do I simply wants to modify/override server side functions on client side. Please let me know is there any way to resolve above mentioned requirement. Thanks in adavance

    Read the article

  • How to .NET package JavaScript/bookmarklet as Interner Explorer 8/9 Plugin?

    - by Don
    How to .NET package JavaScript/bookmarklet as Interner Explorer 8/9 Plugin? I have recently finished writing JavaScript code for a browser addon, which basically (once the JS is included) runs on page-load, for given domains it then checks for certain elements in the DOM and adds new relevant elements(/information) to the page. Since the JavaScript only reads/affects the HTML DOM independently (and does not need any toolbar buttons or anything else) the JS purely needs adding to the browser's webpages. I have packaged the code to work with Firefox and Chrome and those are both working well, and I can run the code for IE in 'bookmarklet' form without problems, but I would like to learn how to package JavaScript as an actual .NET .MSI addon/plugin that will install for the current Internet Explorer 8/9. Does anyone know of a suitable guide or method I might refer to please? I have tried searching online for tutorials but most walkthroughs refer to writing the plugin body itself (which might involve unnecessary stages/includes) and are thus not regarding packing existing JS. I hope someone might have the solution please? Note: Someone packaged an old version for me as a MSI installer for Internet Explorer 7 a year ago, which installed into Program Files with a plugin.dll plugin.tlb and plugin.InstallState plus BandObjectLib.dll Interop.SHDocVw.dll and Microsoft.mshtml.dll if that is useful.

    Read the article

  • wxPython - ListCrtl and SQLite3

    - by Dunwitch
    I'm trying to get a SQLite3 DB to populate a wx.ListCrtl. I can get it to print to stdout/stderr without any problem. I just can't seem to figure out how to display the data in the DataWindow/DataList? I'm sure I've made some code mistakes, so any help is appreciated. Main.py import wx import wx.lib.mixins.listctrl as listmix from database import * import sys class DataWindow(wx.Frame): def __init__(self, parent = None): wx.Frame.__init__(self, parent, -1, 'DataList', size=(640,480)) self.win = DataList(self) self.Center() self.Show(True) class DataList(wx.ListCtrl, listmix.ListCtrlAutoWidthMixin, listmix.ColumnSorterMixin): def __init__(self, parent = DataWindow): wx.ListCtrl.__init__( self, parent, -1, style=wx.LC_REPORT|wx.LC_VIRTUAL|wx.LC_HRULES|wx.LC_VRULES) #building the columns self.InsertColumn(0, "Location") self.InsertColumn(1, "Address") self.InsertColumn(2, "Subnet") self.InsertColumn(3, "Gateway") self.SetColumnWidth(0, 100) self.SetColumnWidth(1, 150) self.SetColumnWidth(2, 150) self.SetColumnWidth(3, 150) class MainWindow(wx.Frame): def __init__(self, parent = None, id = -1, title = "MainWindow"): wx.Frame.__init__(self, parent, id, title, size = (800,600), style = wx.DEFAULT_FRAME_STYLE ^ (wx.RESIZE_BORDER)) # StatusBar self.CreateStatusBar() # Filemenu filemenu = wx.Menu() # Filemenu - About menuitem = filemenu.Append(-1, "&About", "Information about this application") self.Bind(wx.EVT_MENU, self.onAbout, menuitem) #Filemenu - Data menuitem = filemenu.Append(-1, "&Data", "Get data") self.Bind(wx.EVT_MENU, self.onData, menuitem) # Filemenu - Seperator filemenu.AppendSeparator() #Filemenu - Exit menuitem = filemenu.Append(-1, "&Exit", "Exit the application") self.Bind(wx.EVT_MENU, self.onExit, menuitem) # Menubar menubar = wx.MenuBar() menubar.Append(filemenu, "&File") self.SetMenuBar(menubar) # Show self.Show(True) self.Center() def onAbout(self, event): pass def onData(self, event): DataWindow(self) callDb = Database() sql = "SELECT rowid, address, subnet, gateway FROM pod1" records = callDb.select(sql) for v in records: print "How do I get the records on the DataList?" #print "%s%s%s" % (v[1],v[2],v[3]) #for v in records: #DataList.InsertStringItem("%s") % (v[0], v[1], v[2]) def onExit(self, event): self.Close() self.Destroy() def onSave(self, event): pass if __name__ == '__main__': app = wx.App() frame = MainWindow(None, -1) frame.Show() app.MainLoop() database.py import os import sqlite3 class Database(object): def __init__(self, db_file="data/data.sqlite"): database_allready_exists = os.path.exists(db_file) self.db = sqlite3.connect(db_file) if not database_allready_exists: self.setupDefaultData() def select(self,sql): cursor = self.db.cursor() cursor.execute(sql) records = cursor.fetchall() cursor.close return records def insert(self,sql): newID = 0 cursor = self.db.cursor() cursor.execute(sql) newID = cursor.lastrowid self.db.commit() cursor.close() return newID def save(self,sql): cursor = self.db.cursor() cursor.execute(sql) self.db.commit() cursor.close() def setupDefaultData(self): pass

    Read the article

  • Jquery Find an XML element based on the value of one of it's children

    - by NateD
    I'm working on a simple XML phonebook app to learn JQuery, and I can't figure out how to do something like this: When the user enters the first name of a contact in a textbox I want to find the entire record of that person. The XML looks like this: <phonebook> <person> <number> 555-5555</number> <first_name>Evelyn</first_name> <last_name>Remington</last_name> <address>Edge of the Abyss</address> <image>path/to/image</image> </person> <person> <number>+34 1 6444 333 2223230</number> <first_name>Max</first_name> <last_name>Muscle</last_name> <address>Mining Belt</address> <image>path/to/image</image> </person> </phonebook> and the best I've been able to do with the jQuery is something like this: var myXML; function searchXML(){ $.ajax({ type:"GET", url: "phonebook.xml", dataType: "xml", success: function(xml){myXML = $("xml").find("#firstNameBox").val())} }); } What I want it to do is return the entire <person> element so I can iterate through and display all that person's information. Any help would be appreciated.

    Read the article

  • OO model for nsxmlparser when delegate is not self

    - by richard
    Hi, I am struggling with the correct design for the delegates of nsxmlparser. In order to build my table of Foos, I need to make two types of webservice calls; one for the whole table and one for each row. It's essentially a master-query then detail-query, except the master-query-result-xml doesn't return enough information so i then need to query the detail for each row. I'm not dealing with enormous amounts of data. Anyway - previously I've just used NSXMLParser *parser = [[NSXMLParser alloc]init]; [parser setDelegate:self]; [parser parse]; and implemented all the appropriate delegate methods in whatever class i'm in. In attempt at cleanliness, I've now created two separate delegate classes and done something like: NSXMLParser *xp = [[NSXMLParser alloc]init]; MyMasterXMLParserDelegate *masterParserDelegate = [[MyMasterXMLParser]alloc]init]; [xp setDelegate:masterParserDelegate]; [xp parse]; In addition to being cleaner (in my opinion, at least), it also means each of the -parser:didStartElement implementations don't spend most of the time trying to figure out which xml they're parsing. So now the real crux of the problem. Before i split out the delegates, i had in the main class that was also implementing the delegate methods, a class-level NSMutableArray that I would just put my objects-created-from-xml in when -parser:didEndElement found the 'end' of each record. Now the delegates are in separate classes, I can't figure out how to have the -parser:didEndElement in the 'detail' delegate class "return" the created object to the calling class. At least, not in a clean OO way. I'm sure i could do it with all sorts of nasty class methods. Does the question make sense? Thanks.

    Read the article

  • Moving to an arbitrary position in a file in Python

    - by B Rivera
    Let's say that I routinely have to work with files with an unknown, but large, number of lines. Each line contains a set of integers (space, comma, semicolon, or some non-numeric character is the delimiter) in the closed interval [0, R], where R can be arbitrarily large. The number of integers on each line can be variable. Often times I get the same number of integers on each line, but occasionally I have lines with unequal sets of numbers. Suppose I want to go to Nth line in the file and retrieve the Kth number on that line (and assume that the inputs N and K are valid --- that is, I am not worried about bad inputs). How do I go about doing this efficiently in Python 3.1.2 for Windows? I do not want to traverse the file line by line. I tried using mmap, but while poking around here on SO, I learned that that's probably not the best solution on a 32-bit build because of the 4GB limit. And in truth, I couldn't really figure out how to simply move N lines away from my current position. If I can at least just "jump" to the Nth line then I can use .split() and grab the Kth integer that way. The nuance here is that I don't just need to grab one line from the file. I will need to grab several lines: they are not necessarily all near each other, the order in which I get them matters, and the order is not always based on some deterministic function. Any ideas? I hope this is enough information. Thanks!

    Read the article

  • calling java script function then C# function after clicking ASP.NET button

    - by Eyla
    I have this serious: I have ASP.NET page, This page contents Update panel with ASP.NET control. I have Java script function to do validation so when I click the button I will use onclientclick to call the java function to do the validation and after this one done should call then event click button function from code behind. I tried vew methods but they did not work for me. here is sample of my code that after I click the button onclientclick will call the java script function for validation and if the validation is OK should call onclick event. .................... java script function ........................ <script type="text/javascript" > function add(){ if (tag == trye) { document.getElementById('<%=btnInfor.ClientID%>').click(); alert("DataAdded") } else { alert("Requiered Field Missing.") return false; } } </script> ..................... ASP.NET button ................... <asp:Button ID="btnInfor" runat="server" Text="Add Information" Style="position: absolute; top: 1659px; left: 433px;" onclientclick="JavaScript: return myAdd()" /> .................... code behind in C# ...................... protected void btnInfor_Click(object sender, EventArgs e) { \\mycode }

    Read the article

< Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >