Search Results

Search found 2224 results on 89 pages for 'scientific computing'.

Page 85/89 | < Previous Page | 81 82 83 84 85 86 87 88 89  | Next Page >

  • Parsing "true" and "false" using Boost.Spirit.Lex and Boost.Spirit.Qi

    - by Andrew Ross
    As the first stage of a larger grammar using Boost.Spirit I'm trying to parse "true" and "false" to produce the corresponding bool values, true and false. I'm using Spirit.Lex to tokenize the input and have a working implementation for integer and floating point literals (including those expressed in a relaxed scientific notation), exposing int and float attributes. Token definitions #include <boost/spirit/include/lex_lexertl.hpp> namespace lex = boost::spirit::lex; typedef boost::mpl::vector<int, float, bool> token_value_type; template <typename Lexer> struct basic_literal_tokens : lex::lexer<Lexer> { basic_literal_tokens() { this->self.add_pattern("INT", "[-+]?[0-9]+"); int_literal = "{INT}"; // To be lexed as a float a numeric literal must have a decimal point // or include an exponent, otherwise it will be considered an integer. float_literal = "{INT}(((\\.[0-9]+)([eE]{INT})?)|([eE]{INT}))"; literal_true = "true"; literal_false = "false"; this->self = literal_true | literal_false | float_literal | int_literal; } lex::token_def<int> int_literal; lex::token_def<float> float_literal; lex::token_def<bool> literal_true, literal_false; }; Testing parsing of float literals My real implementation uses Boost.Test, but this is a self-contained example. #include <string> #include <iostream> #include <cmath> #include <cstdlib> #include <limits> bool parse_and_check_float(std::string const & input, float expected) { typedef std::string::const_iterator base_iterator_type; typedef lex::lexertl::token<base_iterator_type, token_value_type > token_type; typedef lex::lexertl::lexer<token_type> lexer_type; basic_literal_tokens<lexer_type> basic_literal_lexer; base_iterator_type input_iter(input.begin()); float actual; bool result = lex::tokenize_and_parse(input_iter, input.end(), basic_literal_lexer, basic_literal_lexer.float_literal, actual); return result && std::abs(expected - actual) < std::numeric_limits<float>::epsilon(); } int main(int argc, char *argv[]) { if (parse_and_check_float("+31.4e-1", 3.14)) { return EXIT_SUCCESS; } else { return EXIT_FAILURE; } } Parsing "true" and "false" My problem is when trying to parse "true" and "false". This is the test code I'm using (after removing the Boost.Test parts): bool parse_and_check_bool(std::string const & input, bool expected) { typedef std::string::const_iterator base_iterator_type; typedef lex::lexertl::token<base_iterator_type, token_value_type > token_type; typedef lex::lexertl::lexer<token_type> lexer_type; basic_literal_tokens<lexer_type> basic_literal_lexer; base_iterator_type input_iter(input.begin()); bool actual; lex::token_def<bool> parser = expected ? basic_literal_lexer.literal_true : basic_literal_lexer.literal_false; bool result = lex::tokenize_and_parse(input_iter, input.end(), basic_literal_lexer, parser, actual); return result && actual == expected; } but compilation fails with: boost/spirit/home/qi/detail/assign_to.hpp: In function ‘void boost::spirit::traits::assign_to(const Iterator&, const Iterator&, Attribute&) [with Iterator = __gnu_cxx::__normal_iterator<const char*, std::basic_string<char, std::char_traits<char>, std::allocator<char> > >, Attribute = bool]’: boost/spirit/home/lex/lexer/lexertl/token.hpp:434: instantiated from ‘static void boost::spirit::traits::assign_to_attribute_from_value<Attribute, boost::spirit::lex::lexertl::token<Iterator, AttributeTypes, HasState>, void>::call(const boost::spirit::lex::lexertl::token<Iterator, AttributeTypes, HasState>&, Attribute&) [with Attribute = bool, Iterator = __gnu_cxx::__normal_iterator<const char*, std::basic_string<char, std::char_traits<char>, std::allocator<char> > >, AttributeTypes = boost::mpl::vector<int, float, bool, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na, mpl_::na>, HasState = mpl_::bool_<true>]’ ... backtrace of instantiation points .... boost/spirit/home/qi/detail/assign_to.hpp:79: error: no matching function for call to ‘boost::spirit::traits::assign_to_attribute_from_iterators<bool, __gnu_cxx::__normal_iterator<const char*, std::basic_string<char, std::char_traits<char>, std::allocator<char> > >, void>::call(const __gnu_cxx::__normal_iterator<const char*, std::basic_string<char, std::char_traits<char>, std::allocator<char> > >&, const __gnu_cxx::__normal_iterator<const char*, std::basic_string<char, std::char_traits<char>, std::allocator<char> > >&, bool&)’ boost/spirit/home/qi/detail/construct.hpp:64: note: candidates are: static void boost::spirit::traits::assign_to_attribute_from_iterators<bool, Iterator, void>::call(const Iterator&, const Iterator&, char&) [with Iterator = __gnu_cxx::__normal_iterator<const char*, std::basic_string<char, std::char_traits<char>, std::allocator<char> > >] My interpretation of this is that Spirit.Qi doesn't know how to convert a string to a bool - surely that's not the case? Has anyone else done this before? If so, how?

    Read the article

  • How to set up linux watchdog daemon with Intel 6300esb

    - by ACiD GRiM
    I've been searching for this on Google for sometime now and I have yet to find proper documentation on how to connect the kernel driver for my 6300esb watchdog timer to /dev/watchdog and ensure that watchdog daemon is keeping it alive. I am using RHEL compatible Scientific Linux 6.3 in a KVM virtual machine by the way Below is everything I've tried so far: dmesg|grep 6300 i6300ESB timer: Intel 6300ESB WatchDog Timer Driver v0.04 i6300ESB timer: initialized (0xffffc900008b8000). heartbeat=30 sec (nowayout=0) | ll /dev/watchdog crw-rw----. 1 root root 10, 130 Sep 22 22:25 /dev/watchdog | /etc/watchdog.conf #ping = 172.31.14.1 #ping = 172.26.1.255 #interface = eth0 file = /var/log/messages #change = 1407 # Uncomment to enable test. Setting one of these values to '0' disables it. # These values will hopefully never reboot your machine during normal use # (if your machine is really hung, the loadavg will go much higher than 25) max-load-1 = 24 max-load-5 = 18 max-load-15 = 12 # Note that this is the number of pages! # To get the real size, check how large the pagesize is on your machine. #min-memory = 1 #repair-binary = /usr/sbin/repair #test-binary = #test-timeout = watchdog-device = /dev/watchdog # Defaults compiled into the binary #temperature-device = #max-temperature = 120 # Defaults compiled into the binary #admin = root interval = 10 #logtick = 1 # This greatly decreases the chance that watchdog won't be scheduled before # your machine is really loaded realtime = yes priority = 1 # Check if syslogd is still running by enabling the following line #pidfile = /var/run/syslogd.pid Now maybe I'm not testing it correctly, but I would expecting that stopping the watchdog service would cause the /dev/watchdog to time out after 30 seconds and I should see the host reboot, however this does not happen. Also, here is my config for the KVM vm <!-- WARNING: THIS IS AN AUTO-GENERATED FILE. CHANGES TO IT ARE LIKELY TO BE OVERWRITTEN AND LOST. Changes to this xml configuration should be made using: virsh edit sl6template or other application using the libvirt API. --> <domain type='kvm'> <name>sl6template</name> <uuid>960d0ac2-2e6a-5efa-87a3-6bb779e15b6a</uuid> <memory unit='KiB'>262144</memory> <currentMemory unit='KiB'>262144</currentMemory> <vcpu placement='static'>1</vcpu> <os> <type arch='x86_64' machine='rhel6.3.0'>hvm</type> <boot dev='hd'/> </os> <features> <acpi/> <apic/> <pae/> </features> <cpu mode='custom' match='exact'> <model fallback='allow'>Westmere</model> <vendor>Intel</vendor> <feature policy='require' name='tm2'/> <feature policy='require' name='est'/> <feature policy='require' name='vmx'/> <feature policy='require' name='ds'/> <feature policy='require' name='smx'/> <feature policy='require' name='ss'/> <feature policy='require' name='vme'/> <feature policy='require' name='dtes64'/> <feature policy='require' name='rdtscp'/> <feature policy='require' name='ht'/> <feature policy='require' name='dca'/> <feature policy='require' name='pbe'/> <feature policy='require' name='tm'/> <feature policy='require' name='pdcm'/> <feature policy='require' name='pdpe1gb'/> <feature policy='require' name='ds_cpl'/> <feature policy='require' name='pclmuldq'/> <feature policy='require' name='xtpr'/> <feature policy='require' name='acpi'/> <feature policy='require' name='monitor'/> <feature policy='require' name='aes'/> </cpu> <clock offset='utc'/> <on_poweroff>destroy</on_poweroff> <on_reboot>restart</on_reboot> <on_crash>restart</on_crash> <devices> <emulator>/usr/libexec/qemu-kvm</emulator> <disk type='file' device='disk'> <driver name='qemu' type='raw'/> <source file='/mnt/data/vms/sl6template.img'/> <target dev='vda' bus='virtio'/> <address type='pci' domain='0x0000' bus='0x00' slot='0x04' function='0x0'/> </disk> <controller type='usb' index='0'> <address type='pci' domain='0x0000' bus='0x00' slot='0x01' function='0x2'/> </controller> <interface type='bridge'> <mac address='52:54:00:44:57:f6'/> <source bridge='br0.2'/> <model type='virtio'/> <address type='pci' domain='0x0000' bus='0x00' slot='0x03' function='0x0'/> </interface> <interface type='bridge'> <mac address='52:54:00:88:0f:42'/> <source bridge='br1'/> <model type='virtio'/> <address type='pci' domain='0x0000' bus='0x00' slot='0x07' function='0x0'/> </interface> <serial type='pty'> <target port='0'/> </serial> <console type='pty'> <target type='serial' port='0'/> </console> <watchdog model='i6300esb' action='reset'> <address type='pci' domain='0x0000' bus='0x00' slot='0x06' function='0x0'/> </watchdog> <memballoon model='virtio'> <address type='pci' domain='0x0000' bus='0x00' slot='0x05' function='0x0'/> </memballoon> </devices> </domain> Any help is appreciated as the most I've found are patches to kvm and general softdog documentation or IPMI watchdog answers.

    Read the article

  • Computer science undergraduate project ideas

    - by Mehrdad Afshari
    Hopefully, I'm going to finish my undergraduate studies next semester and I'm thinking about the topic of my final project. And yes, I've read the questions with duplicate title. I'm asking this from a bit different viewpoint, so it's not an exact dupe. I've spent at least half of my life coding stuff in different languages and frameworks so I'm not looking at this project as a way to learn much about coding and preparing for real world apps or such. I've done lots of those already. But since I have to do it to complete my degree, I felt I should spend my time doing something useful instead of throwing the whole thing out. I'm planning to make it an open source project or a hosted Web app (depending on the type) if I can make a high quality thing out of it, so I decided to ask StackOverflow what could make a useful project. Situation I've plenty of freedom about the topic. They also require 30-40 pages of text describing the project. I have the following points in mind (the more satisfied, the better): Something useful for software development Something that benefits the community Having academic value is great Shouldn't take more than a month of development (I know I'm lazy). Shouldn't be related to advanced theoretical stuff (soft computing, fuzzy logic, neural networks, ...). I've been a business-oriented software developer. It should be software oriented. While I love hacking microcontrollers and other fun embedded electronic things, I'm not really good at soldering and things like that. I'm leaning toward a Web application (think StackOverflow, PasteBin, NerdDinner, things like those). Technology It's probably going to be done in .NET (C#, F#) and Windows platform. If I really like the project (cool low level hacking), I might actually slip to C/C++. But really, C# is what I'm efficient at. Ideas Programming language, parsing and compiler related stuff: Designing a domain specific programming language and compiler Templating language compiled to C# or IL Database tools and related code generation stuff Web related technologies: ASP.NET MVC View engine doing something cool (don't know what exactly...) Specific-purpose, small, fast ASP.NET-based Web framework Applications: Visual Studio plugin to integrate with Bazaar (it's too much work, I think). ASP.NET based, jQuery-powered issue tracker (and possibly, project lifecycle management as a whole - poor man's TFS) Others: Something related to GPGPU Looking forward for great ideas! Unfortunately, I can't help on a currently existing project. I need to start my own to prevent further problems (as it's an undergrad project, nevertheless).

    Read the article

  • Problem with AquaTerm on Snow Leopard

    - by cheetah
    When i try to install AquaTerm on Snow leopard from MacPorts i got this: ---> Computing dependencies for aquaterm ---> Building aquaterm Error: Target org.macports.build returned: shell command "cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm" && /usr/bin/xcodebuild -target "AquaTerm" -configuration Deployment build OBJROOT=build/ SYMROOT=build/ MACOSX_DEPLOYMENT_TARGET=10.6 ARCHS=x86_64 SDKROOT= USER_APPS_DIR=/Applications/MacPorts FRAMEWORKS_DIR=/opt/local/Library/Frameworks" returned error 1 Command output: [WARN]Warning: The Copy Bundle Resources build phase contains this target's Info.plist file 'AquaTerm.framework-Info.plist'. CopyPlistFile build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist AquaTerm.framework-Info.plist --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 === BUILD NATIVE TARGET AquaTerm OF PROJECT AquaTerm WITH CONFIGURATION Deployment === Check dependencies Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html [WARN]Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html CopyTiffFile build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff English.lproj/Cross.tiff --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 ** BUILD FAILED ** The following build commands failed: AQTFwk: CopyPlistFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist AquaTerm: CopyTiffFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff (2 failures) Error: Status 1 encountered during processing. Before reporting a bug, first run the command again with the -d flag to get complete output. How i can solve this problem?

    Read the article

  • Resizing QT's QTextEdit to Match Text Height: maximumViewportSize()

    - by Aaron
    I am trying to use a QTextEdit widget inside of a form containing several QT widgets. The form itself sits inside a QScrollArea that is the central widget for a window. My intent is that any necessary scrolling will take place in the main QScrollArea (rather than inside any widgets), and any widgets inside will automatically resize their height to hold their contents. I have tried to implement the automatic resizing of height with a QTextEdit, but have run into an odd issue. I created a sub-class of QTextEdit and reimplemented sizeHint() like this: QSize OperationEditor::sizeHint() const { QSize sizehint = QTextBrowser::sizeHint(); sizehint.setHeight(this->fitted_height); return sizehint; } this-fitted_height is kept up-to-date via this slot that is wired to the QTextEdit's "contentsChanged()" signal: void OperationEditor::fitHeightToDocument() { this->document()->setTextWidth(this->viewport()->width()); QSize document_size(this->document()->size().toSize()); this->fitted_height = document_size.height(); this->updateGeometry(); } The size policy of the QTextEdit sub-class is: this->setSizePolicy(QSizePolicy::MinimumExpanding, QSizePolicy::Preferred); I took this approach after reading this post. Here is my problem: As the QTextEdit gradually resizes to fill the window, it stops getting larger and starts scrolling within the QTextEdit, no matter what height is returned from sizeHint(). If I initially have sizeHint() return some large constant number, then the QTextEdit is very big and is contained nicely within the outer QScrollArea, as one would expect. However, if sizeHint gradually adjusts the size of the QTextEdit rather than just making it really big to start, then it tops out when it fills the current window and starts scrolling instead of growing. I have traced this problem to be that, no matter what my sizeHint() returns, it will never resize the QTextEdit larger than the value returned from maximumViewportSize(), which is inherited from QAbstractScrollArea. Note that this is not the same number as viewport()-maximumSize(). I am unable to figure out how to set that value. Looking at QT's source code, maximumViewportSize() is returning "the size of the viewport as if the scroll bars had no valid scrolling range." This value is basically computed as the current size of the widget minus (2 * frameWidth + margins) plus any scrollbar widths/heights. This does not make a lot of sense to me, and it's not clear to me why that number would be used anywhere in a way that supercede's the sub-class's sizeHint() implementation. Also, it does seem odd that the single "frameWidth" integer is used in computing both the width and the height. Can anyone please shed some light on this? I suspect that my poor understanding of QT's layout engine is to blame here.

    Read the article

  • How do I verify a DKIM signature in PHP?

    - by angrychimp
    I'll admit I'm not very adept at key verification. What I have is a script that downloads messages from a POP3 server, and I'm attempting to verify the DKIM signatures in PHP. I've already figured out the body hash (bh) validation check, but I can't figure out the header validation. http://www.dkim.org/specs/rfc4871-dkimbase.html#rfc.section.6.1.3 Below is an example of my message headers. I've been able to use the Mail::DKIM package to validate the signature in Perl, so I know it's good. I just can't seem to figure out the instructions in the RFC and translate them into PHP code. DomainKey-Signature: q=dns; a=rsa-sha1; c=nofws; s=angrychimp-1.bh; d=angrychimp.net; h=From:X-Outgoing; b=RVkenibHQ7GwO5Y3tun2CNn5wSnooBSXPHA1Kmxsw6miJDnVp4XKmA9cUELwftf9 nGiRCd3rLc6eswAcVyNhQ6mRSsF55OkGJgDNHiwte/pP5Z47Lo/fd6m7rfCnYxq3 DKIM-Signature: v=1; a=rsa-sha1; d=angrychimp.net; s=angrychimp-1.bh; c=relaxed/simple; q=dns/txt; [email protected]; t=1268436255; h=From:Subject:X-Outgoing:Date; bh=gqhC2GEWbg1t7T3IfGMUKzt1NCc=; b=ZmeavryIfp5jNDIwbpifsy1UcavMnMwRL6Fy6axocQFDOBd2KjnjXpCkHxs6yBZn Wu+UCFeAP+1xwN80JW+4yOdAiK5+6IS8fiVa7TxdkFDKa0AhmJ1DTHXIlPjGE4n5; To: [email protected] Message-ID: From: DKIM Tester Reply-To: [email protected] Subject: Automated DKIM Testing (angrychimp.net) X-Outgoing: dhaka Date: Fri, 12 Mar 2010 15:24:15 -0800 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable Content-Disposition: inline MIME-Version: 1.0 Return-Path: [email protected] X-OriginalArrivalTime: 12 Mar 2010 23:25:50.0326 (UTC) FILETIME=[5A0ED160:01CAC23B] I can extract the public key from my DNS just fine, and I believe I'm canonicalizing the headers correctly, but I just can't get the signature validated. I don't think I'm preparing my key or computing the signature validation correctly. Is this something that's possible (do I need pear extensions or something?) or is manually validating a DKIM signature in PHP just not feasible?

    Read the article

  • Resultant of a polynomial with x^n–1

    - by devin.omalley
    Resultant of a polynomial with x^n–1 (mod p) I am implementing the NTRUSign algorithm as described in http://grouper.ieee.org/groups/1363/lattPK/submissions/EESS1v2.pdf , section 2.2.7.1 which involves computing the resultant of a polynomial. I keep getting a zero vector for the resultant which is obviously incorrect. private static CompResResult compResMod(IntegerPolynomial f, int p) { int N = f.coeffs.length; IntegerPolynomial a = new IntegerPolynomial(N); a.coeffs[0] = -1; a.coeffs[N-1] = 1; IntegerPolynomial b = new IntegerPolynomial(f.coeffs); IntegerPolynomial v1 = new IntegerPolynomial(N); IntegerPolynomial v2 = new IntegerPolynomial(N); v2.coeffs[0] = 1; int da = a.degree(); int db = b.degree(); int ta = da; int c = 0; int r = 1; while (db > 0) { c = invert(b.coeffs[db], p); c = (c * a.coeffs[da]) % p; IntegerPolynomial cb = b.clone(); cb.mult(c); cb.shift(da - db); a.sub(cb, p); IntegerPolynomial v2c = v2.clone(); v2c.mult(c); v2c.shift(da - db); v1.sub(v2c, p); if (a.degree() < db) { r *= (int)Math.pow(b.coeffs[db], ta-a.degree()); r %= p; if (ta%2==1 && db%2==1) r = (-r) % p; IntegerPolynomial temp = a; a = b; b = temp; temp = v1; v1 = v2; v2 = temp; ta = db; } da = a.degree(); db = b.degree(); } r *= (int)Math.pow(b.coeffs[0], da); r %= p; c = invert(b.coeffs[0], p); v2.mult(c); v2.mult(r); v2.mod(p); return new CompResResult(v2, r); } There is pseudocode in http://www.crypto.rub.de/imperia/md/content/texte/theses/da_driessen.pdf which looks very similar. Why is my code not working? Are there any intermediate results I can check? I am not posting the IntegerPolynomial code because it isn't too interesting and I have unit tests for it that pass. CompResResult is just a simple "Java struct".

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to work?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • Which mobile operating system should I code for?

    - by samgoody
    It seems as though mobile computing has fully arrived. I would like to rewrite two of our programs for mobile devices, but am a bit lost as to which platform to target. Complicating this decision: I would need to learn the relevant languages and IDEs - my coding to date has been almost all web based (PHP, JS, Actionscript, etc. Some ASPX). Most users seem to be religious about their mobile decision, so oral conversations leave me more confused then enlightened. I do not yet own a smartphone - will have to buy one once I know which platform to be aiming for. Both of my programs are more for business users, (one is only useful for C.P.A.s). I am a single developer, and cannot develop for more than one platform at a time. Getting it right is important. Based on what I've found on the web, I would've expected RIM to be a shoo-in, and the general order to be as follows: RIM Blackberry - More of them than any other brand. Despite naysayers, they've had double the sales (or perhaps 5X the sales) of any other smartphone, and have continued to grow. And, they have business users. Android - According to Schmidt, they have outsold everyone else except RIM (though I can't find where I read that now), and they are just getting started. According to Comscore, they are already at 8% of the market and expected to hit Shcmidt's claims within six months. Nokia - The largest worldwide. If they would just make up between Maemo or Symbian, I would be far less confused. iPhone - Much more competition by other apps, fewer sales to be had, and a overlord that can delay or cancel my app at any time. Is Cocoa hard to learn? Windows Mobile - Word is that version 7 will not be backwards compatible and losing market share. Palm WebOS - Perhaps this should go first, as it is the only one that offers tools to make my life easy as a web application developer. No competition in marketplace. But not very many users either. However, a search on StackOverflow shows a hugely disproportionate number of iPhone questions versus Blackberry. Likewise, there are clearly more apps on iPhone, so it must be getting developer love. What is the one platform I should develop for? Please back up your answer with the logic.

    Read the article

  • Unable to verify body hash for DKIM

    - by Joshua
    I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

  • Sharing the same `ssh-agent` among multiple login sessions

    - by intuited
    Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

    Read the article

  • Oracle performance problem

    - by jreid42
    We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

    Read the article

  • I cut-to-move DCIM folder to ext SD when an auto android OS update popped up b4 I could choose target - Cannot recover 200+ photos

    - by ZeroG
    I was downloading my Exhibit II's DCIM camera folder (with month's of photos inside) to its external SD card, in order to transfer them into my laptop. In my overconfidence, I hurriedly chose cut-to-move (rather than copy-to-move) when KABOOM! —an automatic Android OS update popped up before I could choose the target!!! I figured everything was in cache & calmly tried to go through with the update. But that was not a typically seamless event. It showed downloading icon but hmm… since I rooted the phone it brought the command line up & recovery sequence. But neither Android nor I had yet downloaded any alternate custom ROM Files to internal SD to update from! So were they trying to make me unroot my phone by giving me some bogus update on the fly or just give me a hard time in trying to hand me down an unrooted ROM that I'd have to figure out how to root again? Yes, I know there was that blurb about overwriting a file of the same name but I was trying to shake the darn stubborn update being forced on my phone during this precarious moment. I thought I had frozen or turned off all those auto-updates previously. Anyway, phones are small & fingers are big (sigh)... I tried to reboot into safe mode but the resultant photo file was partially overwritten (200 files had names but Zero bytes in them). I thought maybe it was still hung in cache or deposited somewhere else but I have searched everywhere with file managers. Since I did not have Titanium backing up camera, photo folder or gallery, I cannot recover 200+ photos. Dumb. You can understand my dilemma as I am involved in the arts & although just a camera phone, most of these photos were historic & aesthetic or at least as to subject matter. Photo-ops don't reoccur. I have tried a couple of recovery apps from the market like Search Duplicates & Recover to no avail. I was only able to salvage stuff I'd sent out in messages. I've got several decades in computers & this is such a miserable beginner's piece of bad luck I can't believe it happened to me. They were precious photos! Yes, I turned on Titanium since & yes I even tried USB to laptop recoveries. Being on a MacBookPro I'm trying androidfiletransfer.dmg, but I'd have to upgrade to Peach Sunrise to get above Android 3.0 for that App to recognize the phone via USB & the programmer says installation zeros your data, so that pretty much toasts any secret hidden places where these photos may have been deposited. Don't want to do that & am still trying to find them. They certainly didn't make it to my external SD Card. If any of you techies out there know anything, please help & thanks. Despite decades of being in computing, unfamiliar & ever-changing hard or software can humble even the most seasoned veterans.

    Read the article

  • Varnish VCL - Regular Expression Evaluation

    - by Hugues ALARY
    I have been struggling for the past few days with this problem: Basically, I want to send to a client browser a cookie of the form foo[sha1oftheurl]=[randomvalue] if and only if the cookie has not already been set. e.g. If a client browser requests "/page.html", the HTTP response will be like: resp.http.Set-Cookie = "foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=ABCD;" then, if the same client request "/index.html", the HTTP response will contain a header: resp.http.Set-Cookie = "foo14fe4559026d4c5b5eb530ee70300c52d99e70d7=QWERTY;" In the end, the client browser will have 2 cookies: foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=ABCD foo14fe4559026d4c5b5eb530ee70300c52d99e70d7=QWERTY Now, that, is not complicated in itself. The following code does it: import digest; import random; ##This vmod does not exist, it's just for the example. sub vcl_recv() { ## We compute the sha1 of the requested URL and store it in req.http.Url-Sha1 set req.http.Url-Sha1 = digest.hash_sha1(req.url); set req.http.random-value = random.get_rand(); } sub vcl_deliver() { ## We create a cookie on the client browser by creating a "Set-Cookie" header ## In our case the cookie we create is of the form foo[sha1]=[randomvalue] ## e.g for a URL "/page.html" the cookie will be foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=[randomvalue] set resp.http.Set-Cookie = {""} + resp.http.Set-Cookie + "foo"+req.http.Url-Sha1+"="+req.http.random-value; } However, this code does not take into account the case where the Cookie already exists. I need to check that the Cookie does not exists before generating a random value. So I thought about this code: import digest; import random; sub vcl_recv() { ## We compute the sha1 of the requested URL and store it in req.http.Url-Sha1 set req.http.Url-Sha1 = digest.hash_sha1(req.url); set req.http.random-value = random.get_rand(); set req.http.regex = "abtest"+req.http.Url-Sha1; if(!req.http.Cookie ~ req.http.regex) { set req.http.random-value = random.get_rand(); } } The problem is that Varnish does not compute Regular expression at run time. Which leads to this error when I try to compile: Message from VCC-compiler: Expected CSTR got 'req.http.regex' (program line 940), at ('input' Line 42 Pos 31) if(req.http.Cookie !~ req.http.regex) { ------------------------------##############--- Running VCC-compiler failed, exit 1 VCL compilation failed One could propose to solve my problem by matching on the "abtest" part of the cookie or even "abtest[a-fA-F0-9]{40}": if(!req.http.Cookie ~ "abtest[a-fA-F0-9]{40}") { set req.http.random-value = random.get_rand(); } But this code matches any cookie starting by 'abtest' and containing an hexadecimal string of 40 characters. Which means that if a client requests "/page.html" first, then "/index.html", the condition will evaluate to true even if the cookie for the "/index.html" has not been set. I found in bug report phk or someone else stating that computing regular expressions was extremely expensive which is why they are evaluated during compilation. Considering this, I believe that there is no way of achieving what I want the way I've been trying to. Is there any way of solving this problem, other than writting a vmod? Thanks for your help! -Hugues

    Read the article

< Previous Page | 81 82 83 84 85 86 87 88 89  | Next Page >