Search Results

Search found 431 results on 18 pages for 'jeffrey vincent'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 9/18 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Pear SOAP and XAMPP on Ubuntu

    - by Vincent
    All, I have installed xampp for linux on ubuntu 9.10. The installation directory is /opt/lampp. The xampp website says PEAR comes with the installation.. I am relatively new to PEAR and want to know the answers for following: Is PEAR installed with xampp or need to be installed separately using synaptic package manager? I browse to /opt/lampp/bin directory and see "pear" there, but when i type it in the command line, it says "The program 'pear' is currently not installed. You can install it by typing: sudo apt-get install php-pear pear: command not found " I want to use PEAR:SOAP package in my PHP code. How to use that? Do I need to set any paths to the pear in my php.ini? Thanks

    Read the article

  • Launch Apple's Stocks app, with a particular stock selected

    - by Vincent Gable
    I would like to launch Apple's Stocks app to show information for a particular stock, on a non-jailbroken phone. I'm not interesting in how to get a quote or graph a stock myself, just opening Stocks.app. I was hoping that the Stocks app would have a custom URL format, so opening a URL like stocks://AAPL would do the trick. But I haven't found anything documenting such a scheme, and suspect it doesn't exist. Any other ideas, or is it impossible to integrate with the native Stocks app?

    Read the article

  • jQuery toggle div from select option

    - by Jeffrey
    I'm in need to toggle divs from a dropdown select option box. I'd like it similar to asmselect for jquery but instead of listing the option tag I'd like it to display a hidden div. Is there anything like this out there? Or anyone know how to set it up? Thanks, Jeff.

    Read the article

  • WPF MVVM: Convention over Configuration for ResourceDictionary ?

    - by Jeffrey Knight
    Update In the wiki spirit of StackOverflow, here's an update: I spiked Joe White's IValueConverter suggestion below. It works like a charm. I've written a "quickstart" example of this that automates the mapping of ViewModels-Views using some cheap string replacement. If no View is found to represent the ViewModel, it defaults to an "Under Construction" page. I'm dubbing this approach "WPF MVVM White" since it was Joe White's idea. Here are a couple screenshots. The first image is a case of "[SomeControlName]ViewModel" has a corresponding "[SomeControlName]View", based on pure naming convention. The second is a case where the ModelView doesn't have any views to represent it. No more ResourceDictionaries with long ViewModel to View mappings. It's pure naming convention now. I'm hosting a download of the project here: http://rootsilver.com/files/Mvvm.White.Quickstart.zip I'll follow up with a longer blog post walk through. Original Post I read Josh Smith's fantastic MSDN article on WPF MVVM over the weekend. It's destined to be a cult classic. It took me a while to wrap my head around the magic of asking WPF to render the ViewModel. It's like saying "Here's a class, WPF. Go figure out which UI to use to present it." For those who missed this magic, WPF can do this by looking up the View for ModelView in the ResourceDictionary mapping and pulling out the corresponding View. (Scroll down to Figure 10 Supplying a View ). The first thing that jumps out at me immediately is that there's already a strong naming convention of: classNameView ("View" suffix) classNameViewModel ("ViewModel" suffix) My question is: Since the ResourceDictionary can be manipulated programatically, I"m wondering if anyone has managed to Regex.Replace the whole thing away, so the lookup is automatic, and any new View/ViewModels get resolved by virtue of their naming convention? [Edit] What I'm imagining is a hook/interception into ResourceDictionary. ... Also considering a method at startup that uses interop to pull out *View$ and *ViewModel$ class names to build the DataTemplate dictionary in code: //build list foreach .... String.Format("<DataTemplate DataType=\"{x:Type vm:{0} }\"><v:{1} /></DataTemplate>", ...)

    Read the article

  • Is it possible to generate dynamic proxy for static class or static method in C#?

    - by Jeffrey
    I am trying to come up with a way that (either static or instance) method calls can be intercepted by dynamic proxy. I want to implement it as c# extension methods but stuck on how to generate dynamic proxy for static methods. Some usages: Repository.GetAll<T>().CacheForMinutes(10); Repository.GetAll<T>().LogWhenErrorOccurs(); //or var repo = new Repository(); repo.GetAll<T>().CacheForMinutes(10); repo.GetAll<T>().LogWhenErrorOccurs(); I am open to any library (linfu, castle.dynamic proxy 2 or etc). Thanks!

    Read the article

  • Graceful termination of NSApplication with Core Data and Grand Central Dispatch (GCD)

    - by Vincent Mac
    I have an Cocoa Application (Mac OS X SDK 10.7) that is performing some processes via Grand Central Dispatch (GCD). These processes are manipulating some Core Data NSManagedObjects (non-document-based) in a manner that I believe is thread safe (creating a new managedObjectContext for use in this thread). The problem I have is when the user tries to quit the application while the dispatch queue is still running. The NSApplication delegate is being called before actually quitting. - (NSApplicationTerminateReply)applicationShouldTerminate:(NSApplication *)sender I get an error "Could not merge changes." Which is somewhat expected since there are still operations being performed through the different managedObjectContext. I am then presented with the NSAlert from the template that is generated with a core data application. In the Threading Programming Guide there is a section called "Be Aware of Thread Behaviors at Quit Time" which alludes to using replyToApplicationShouldTerminate: method. I'm having a little trouble implementing this. What I would like is for my application to complete processing the queued items and then terminate without presenting an error message to the user. It would also be helpful to update the view or use a sheet to let the user know that the app is performing some action and will terminate when the action is complete. Where and how would I implement this behavior?

    Read the article

  • JQuery - Nested AJAX

    - by Vincent
    All, I am trying to perform a nested AJAX call using the following code. The nested call doesn't seem to work. Am I doing anything wrong? $.ajax({ type: 'GET', url: "/public/customcontroller/dosomething", cache: false, dataType: "html", success: function(html_input) { $.ajax({ type: 'GET', url: "/public/customcontroller/getjobstatus", cache: false, dataType: "html", success: function(html_input){ alert(html_input); } }); } }); Thanks

    Read the article

  • How can I create an HTML text field that has scrolling background images before it is clicked?

    - by Jeffrey
    I'm looking to add a textbox on my website that captures a single email address. Behind it, I would like a scrolling (or sliding) images to be a "hint" for what the field should be. Example: http://steamboat.com/ - the "Newsletter sign up" toward the top of the page. I can find plenty of jQuery plugins that provide a plain text "hint". Where should I start looking to add this additional affect. Note: I do not want to add any flash elements on the page.

    Read the article

  • actionscript calling javascript with Security Exception

    - by Jeffrey Chee
    I have a swf hosted at domain A, and I have a html at domain B My swf is able to be loaded from accessing the html at domain B. However, the swf gets a SecurityError: Error #2060: Security sandbox violation: ExternalInterface caller http://domainA.com/TrialApp.swf cannot access http://DomainB.com/. The as3 is just the below: ExternalInterface.call("javascript:_invite();"); I've also loaded the crossdomain policy file from Domain B during initialization. Security.loadPolicyFile( "http://DomainB/crossdomain.xml" ); How do I go about solving this? in my html, I have allowscriptaccess='always' Thanks in Advance

    Read the article

  • Pros and cons of programmatically enforcing foreign key than in database

    - by Jeffrey
    It is causing so much trouble in terms of development just by letting database enforcing foreign key. Especially during unit test I can’t drop table due to foreign key constrains, I need to create table in such an order that foreign key constrain warning won’t get triggered. In reality I don’t see too much point of letting database enforcing the foreign key constrains. If the application has been properly designed there should not be any manual database manipulation other than select queries. I just want to make sure that I am not digging myself into a hole by not having foreign key constrains in database and leaving it solely to the application’s responsibility. Am I missing anything? P.S. my real unit tests (not those that use mocking) will drop existing tables if the structure of underlying domain object has been modified.

    Read the article

  • Updating with Related Entities - Entity Framework v4

    - by Vincent BOUZON
    Hi, I use Entity Framework V4 and i want to update Customer who have Visits. My code : EntityKey key; object originalItem; key = this._modelContainer.CreateEntityKey("Customers", customer); if (this._modelContainer.TryGetObjectByKey(key, out originalItem)) { this._modelContainer.ApplyCurrentValues(key.EntitySetName, customer); } this._modelContainer.SaveChanges(); It works for Scalar Property only. The customers.Visits collection is not updated. Best Regards :)

    Read the article

  • Are these tables too big for SQL Server or Oracle

    - by Jeffrey Cameron
    Hey all, I'm not much of a database guru so I would like some advice. Background We have 4 tables that are currently stored in Sybase IQ. We don't currently have any choice over this, we're basically stuck with what someone else decided for us. Sybase IQ is a column-oriented database that is perfect for a data warehouse. Unfortunately, my project needs to do a lot of transactional updating (we're more of an operational database) so I'm looking for more mainstream alternatives. Question Given these tables' dimensions, would anyone consider SQL Server or Oracle to be a viable alternative? Table 1 : 172 columns * 32 million rows Table 2 : 453 columns * 7 million rows Table 3 : 112 columns * 13 million rows Table 4 : 147 columns * 2.5 million rows Given the size of data what are the things I should be concerned about in terms of database choice, server configuration, memory, platform, etc.?

    Read the article

  • unable to add objects to saved collection in GAE using JDO

    - by Jeffrey Chee
    I have a ClassA containing an ArrayList of another ClassB I can save a new instance of ClassA with ClassB instances also saved using JDO. However, When I retrieve the instance of Class A, I try to do like the below: ClassA instance = PMF.get().getPersistenceManager().GetObjectByID( someid ); instance.GetClassBArrayList().add( new ClassB(...) ); I get an Exception like the below: Uncaught exception from servlet com.google.appengine.api.datastore.DatastoreNeedIndexException: no matching index found.. So I was wondering, Is it possible to add a new item to the previously saved collection? Or was it something I missed out. Best Regards

    Read the article

  • Ruby use method only if condition is true

    - by Vincent
    So I have this code: class Door # ... def info attr = "" return { "width" => @width, "height" => @height, "color" => @color }[attr] if attr != "" end end mydoor = Door.new(100, 100, "red") puts mydoor.info("width") puts mydoor.info The method "info" should return the hash if no argument is provided, otherwise the value of the argument in the hash. How can I achieve that?

    Read the article

  • What to do of exceptions when implementing java.lang.Iterator

    - by Vincent Robert
    The java.lang.Iterator interface has 3 methods: hasNext, next and remove. In order to implement a read-only iterator, you have to provide an implementation for 2 of those: hasNext and next. My problem is that these methods does not declare any exceptions. So if my code inside the iteration process declares exceptions, I must enclose my iteration code inside a try/catch block. My current policy has been to rethrow the exception enclosed in a RuntimeException. But this has issues because the checked exceptions are lost and the client code no longer can catch those exceptions explicitly. How can I work around this limitation in the Iterator class? Here is a sample code for clarity: class MyIterator implements Iterator { @Override public boolean hasNext() { try { return implementation.testForNext(); } catch ( SomethingBadException e ) { throw new RuntimeException(e); } } @Override public boolean next() { try { return implementation.getNext(); } catch ( SomethingBadException e ) { throw new RuntimeException(e); } } ... }

    Read the article

  • SQL Server: Check if table exists

    - by Vincent
    I would like this to be the ultimate discussion on how to check if a table exists in SQL Server 2000/2005 using SQL Statement. When you Google for the answer, you get so many different answers. Is there an official/backward & forward compatible way of doing it? Here are two ways to start discussion: IF EXISTS (SELECT 1 FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_TYPE='BASE TABLE' AND TABLE_NAME='mytablename') SELECT 1 AS res ELSE SELECT 0 AS res; IF OBJECT_ID (N'".$table_name."', N'U') IS NOT NULL SELECT 1 AS res ELSE SELECT 0 AS res; MySQL provides a nice SHOW TABLES LIKE '%tablename%'; statement. I am looking for something similar.

    Read the article

  • Set compression level when generating a ZIP file using RubyZip

    - by Vincent Robert
    Hi, I have a Ruby program that zips a directory tree of XML files using the rubyzip gem. My problem is that the file is starting to be heavy and I would like to increase the compression level, since compression time is not an issue. I could not find in the rubyzip documentation a way to specify the compression level for the created ZIP file. Anyone know how to change this setting?

    Read the article

  • WebSphere MQ/MQSeries - Possible to send a message to multiple queues with single call?

    - by Jeffrey White
    I'm queuing messages to a WebSphere MQ queue (NB: A point-to-point queue -- not a topic) using a stored procedure in my Oracle database. Is there a way to publish each message to multiple queues with a single call? What I would like is to find a solution that would incur zero additional latency on my database compared to sending the message to a single queue. Solutions that involve changing my WebSphere MQ settings are certainly welcome! What I had in mind was somehow creating a "clone" queue that got all the same messages as the original one, but I've been unable to locate anything like this in the documentation. Thanks, Jeff

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >