Search Results

Search found 75614 results on 3025 pages for 'file location'.

Page 92/3025 | < Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >

  • My rundll32.exe file is corrupt, how do I fix it?

    - by wahle509
    The other day I got a virus on my laptop (Windows XP), but Adaware found it and removed it. Not soon enough though, because it corrupted my rundll32.exe file. Now I can't run almost any application and I have tried to install a couple programs to fix my registry, but I can't even run the install file. What other options do I have besides re-installing my OS?

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • Run a batch file before user logs into Windows 2003 R2?

    - by Sid
    I have an Amazon EC2 machine (Windows Server 2003 R2) where I want to run a script (.bat file) when the Windows Server 2003 R2 machine boots up. This need to run BEFORE any user logs in. Ideally I'd like to extend the same work-around on my Windows Server 2008 R2 instances too - but Windows Server 2003 R2 is critical for me as of now. Purely as FYI, the .bat file updates the DDNS records so the EC2 machine doesn't need to consume static IPs.

    Read the article

  • create assembly from network location

    - by mjw06d
    The error I'm receiving: CREATE ASSEMBLY failed because it could not open the physical file "\\<server>\<folder>\<assembly>.dll": 5(Access is denied.). TSQL: exec sp_configure 'clr enabled', 1 reconfigure go create assembly <assemblyname> from '\\<server>\<folder>\<assembly>.dll' with permission_set = safe How can I create an assembly from a unc path?

    Read the article

  • Where does Mac OS X store file association information?

    - by Mehrdad
    I know there is a system preferences pane to manually modify the file associations in Mac OS X Leopard. However, I'm curious where does Leopard actually store these information? UPDATE: as I said, I'm not interested in methods to change them. I want to know the configuration file or database (like registry in Windows) where those mappings are stored.

    Read the article

  • Anyone know a good web-based file upload package?

    - by Ted Wexler
    Basically, what I'm looking for is a place for either one of our end users to be able to upload a file to this package, after either receiving a code from one of our support engineers or vice-versa(our engineers upload a file and send a code/link/something to end user) I've spent a bunch of time googling this, I found this: http://turin.nss.udel.edu/programming/dropbox2/, but the code there scares me, and it also doesn't render properly using PHP 5.3(uses short tags, who knows what else.) Does anyone have any recommendations?

    Read the article

  • Blocking of certain file downloads

    - by Philip Fourie
    I have a problem where I cannot completely download a certain file from a server. The file is 1.9MB in size but only 68% is downloaded and then it hangs. I tried and these cases, which failed: Downloaded the file with HTTP Downloaded the file with FTP Moved the file to different FTP and web servers behind the ISA firewall Tried with IIS 6.0 & IIS 7.0 Multiple download clients. Which included FireFox, FileZilla (on Windows) and wget (on Linux) This worked: Downloading other files from the same location on the server. Both bigger and smaller and in size than the original. FTP and HTTP worked. Earlier version of this file (.DLL) works. It is as if the content of this file has an influence on this file being served. Network architecture: Client Machine - Internet (ISP) - ISA Server - IIS 7.0 The only constants are the ISP, Cisco router and the ISA server. Is it possible that something is rejecting the download because of the contents of the file? I am hoping ISA is the culprit... I am not a ISA expert is there somewhere I can look to establish if it is indeed ISA causing this? Update: Splitting the file into two parts with a hex editor results in one half of the file being served correctly and the other part not. Zipping the file results in the file being downloaded successfully. However this is not an option for this particular scenario. Renaming the file and its extension also doesn't work. Update 2009/10/22: It does NOT seems to be ISA that is causing this problem. We connected a laptop (running IIS) on an available public IP and still the file download to 68% before it hanged. The two remaining components are the ISP and the Cisco 800 series router. Anyone knows about an issue on the router perhaps?

    Read the article

  • Windows 7 batch files: How to write string to text file without carriage return AND trailing space?

    - by oscilatingcretin
    I am trying to have my batch file write a string of text to a text file. At first, the command I was using was writing an extra carriage return to the end of the string, but I found this command that prevented that: echo|set /p=hello>hello.txt However, now it's putting a trailing space at the end. I need only the string I specify to be written without any extra characters. Is this possible?

    Read the article

  • Slideshow from excel file listing the caption, sound file and image file?

    - by Slabo
    Hello, I have excel files with the following header: Caption Sound: Location of sound file Image: Location of image file How can I make a slideshow from this? Each slide should show image, caption, and play sound automatically according to the excel list. I don't care what software I use, if I can get the job done. Total slides ~10,000. In case interested,this is review material for English second language students. Any help appreciated, Thanks

    Read the article

  • delete multiple files on linux with spaces in file names

    - by raido
    I have a directory on my Linux box with over 10000 files that I have to delete. Running... sudo rm -rf /var/tmp/* Gives the error message... sudo: unable to execute /bin/rm: Argument list too long The solution to this is to run sudo find /var/tmp | xargs sudo rm This only works for files with no spaces in the file name. However, some of the files have names with spaces in them and they are not deleted. For example, if a file is named 'A File With Spaces in the Name.dat', Running the command gives me errors like this.... rm: cannot remove `/var/tmp/A': No such file or directory rm: cannot remove `File': No such file or directory rm: cannot remove `With': No such file or directory rm: cannot remove `Spaces': No such file or directory rm: cannot remove `in': No such file or directory rm: cannot remove `the': No such file or directory rm: cannot remove `Name.dat': No such file or directory How do I pass the complete file path to xargs sudo rm without breaking up the file name.

    Read the article

  • Chrome: Save as dialogue creates temp file in download directory, I want to change this location

    - by Gabardine
    I've set the download directory for Chrome to be my desktop, but that means that whenever I want to "Save As" it creates a temp file on my desktop until I select the final download destination and close the dialogue. This is deeply frustrating since I browse windowed and I keep seeing the damn things pop up and disappear in the corner of my eye, is there any way to change the directory in which temp files are created in this manner?

    Read the article

  • How to append to a file as sudo? [closed]

    - by obvio171
    Possible Duplicate: sudo unable to write to /etc/profile I want to do: echo "something" >> /etc/config_file But, since only the root user has write permission to this file, I can't do that. But this: sudo echo "something" >> /etc/config_file also doesn't work. Is there any way to append to a file in that situation without having to first open it with a sudo'd editor and then appending the new content by hand?

    Read the article

  • What's a good way to move large amounts of files from one place to another, using the file path?

    - by user165253
    I'm going to move my Winamp library from its current location (in various folders inside My Documents) to My Music, but I can't just drag and drop them, as there's thousands of files within My Documents that I don't want moved. I can get the path of every single music file from Winamp, but I don't know any way to move them all. I'd like some way to maintain their current folder arrangement, and not just dump all the files in a single folder, unorganised.

    Read the article

  • Creating a file upload template in Doctrine ORM

    - by balupton
    Hey all. I'm using Doctrine 1.2 as my ORM for a Zend Framework Project. I have defined the following Model for a File. File: columns: id: primary: true type: integer(4) unsigned: true code: type: string(255) unique: true notblank: true path: type: string(255) notblank: true size: type: integer(4) type: type: enum values: [file,document,image,video,audio,web,application,archive] default: unknown notnull: true mimetype: type: string(20) notnull: true width: type: integer(2) unsigned: true height: type: integer(2) unsigned: true Now here is the File Model php class (just skim through for now): <?php /** * File * * This class has been auto-generated by the Doctrine ORM Framework * * @package ##PACKAGE## * @subpackage ##SUBPACKAGE## * @author ##NAME## <##EMAIL##> * @version SVN: $Id: Builder.php 6365 2009-09-15 18:22:38Z jwage $ */ class File extends BaseFile { public function setUp ( ) { $this->hasMutator('file', 'setFile'); parent::setUp(); } public function setFile ( $file ) { global $Application; // Configuration $config = array(); $config['bal'] = $Application->getOption('bal'); // Check the file if ( !empty($file['error']) ) { $error = $file['error']; switch ( $file['error'] ) { case UPLOAD_ERR_INI_SIZE : $error = 'ini_size'; break; case UPLOAD_ERR_FORM_SIZE : $error = 'form_size'; break; case UPLOAD_ERR_PARTIAL : $error = 'partial'; break; case UPLOAD_ERR_NO_FILE : $error = 'no_file'; break; case UPLOAD_ERR_NO_TMP_DIR : $error = 'no_tmp_dir'; break; case UPLOAD_ERR_CANT_WRITE : $error = 'cant_write'; break; default : $error = 'unknown'; break; } throw new Doctrine_Exception('error-application-file-' . $error); return false; } if ( empty($file['tmp_name']) || !is_uploaded_file($file['tmp_name']) ) { throw new Doctrine_Exception('error-application-file-invalid'); return false; } // Prepare config $file_upload_path = realpath($config['bal']['files']['upload_path']) . DIRECTORY_SEPARATOR; // Prepare file $filename = $file['name']; $file_old_path = $file['tmp_name']; $file_new_path = $file_upload_path . $filename; $exist_attempt = 0; while ( file_exists($file_new_path) ) { // File already exists // Pump exist attempts ++$exist_attempt; // Add the attempt to the end of the file $file_new_path = $file_upload_path . get_filename($filename,false) . $exist_attempt . get_extension($filename); } // Move file $success = move_uploaded_file($file_old_path, $file_new_path); if ( !$success ) { throw new Doctrine_Exception('Unable to upload the file.'); return false; } // Secure $file_path = realpath($file_new_path); $file_size = filesize($file_path); $file_mimetype = get_mime_type($file_path); $file_type = get_filetype($file_path); // Apply $this->path = $file_path; $this->size = $file_size; $this->mimetype = $file_mimetype; $this->type = $file_type; // Apply: Image if ( $file_type === 'image' ) { $image_dimensions = image_dimensions($file_path); if ( !empty($image_dimensions) ) { // It is not a image we can modify $this->width = 0; $this->height = 0; } else { $this->width = $image_dimensions['width']; $this->height = $image_dimensions['height']; } } // Done return true; } /** * Download the File * @return */ public function download ( ) { global $Application; // File path $file_upload_path = realpath($config['bal']['files']['upload_path']) . DIRECTORY_SEPARATOR; $file_path = $file_upload_path . $this->file_path; // Output result and download become_file_download($file_path, null, null); die(); } public function postDelete ( $Event ) { global $Application; // Prepare $Invoker = $Event->getInvoker(); // Configuration $config = array(); $config['bal'] = $Application->getOption('bal'); // File path $file_upload_path = realpath($config['bal']['files']['upload_path']) . DIRECTORY_SEPARATOR; $file_path = $file_upload_path . $this->file_path; // Delete the file unlink($file_path); // Done return true; } } What I am hoping to accomplish is so that the above custom functionality within my model file can be turned into a validator, template, or something along the lines. So hopefully I can do something like: File: actAs: BalFile: columns: id: primary: true type: integer(4) unsigned: true code: type: string(255) unique: true notblank: true path: type: string(255) notblank: true size: type: integer(4) type: type: enum values: [file,document,image,video,audio,web,application,archive] default: unknown notnull: true mimetype: type: string(20) notnull: true width: type: integer(2) unsigned: true height: type: integer(2) unsigned: true I'm hoping for a validator so that say if I do $File->setFile($_FILE['uploaded_file']); It will provide a validation error, except in all the doctrine documentation it has little on custom validators, especially in the contect of "virtual" fields. So in summary, my question is: How earth can I go about making a template/extension to porting this functionality? I have tried before with templates but always gave up after a day :/ If you could take the time to port the above I would greatly appreciate it.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • WiX 3 Tutorial: Understanding main WXS and WXI file

    - by Mladen Prajdic
    In the previous post we’ve taken a look at the WiX solution/project structure and project properties. We’re still playing with our super SuperForm application and today we’ll take a look at the general parts of the main wxs file, SuperForm.wxs, and the wxi include file. For wxs file we’ll just go over the general description of what each part does in the code comments. The more detailed descriptions will be in future posts about features themselves. WXI include file Include files are exactly what their name implies. To include a wxi file into the wxs file you have to put the wxi at the beginning of each .wxs file you wish to include it in. If you’ve ever worked with C++ you can think of the include files as .h files. For example if you include SuperFormVariables.wxi into the SuperForm.wxs, the variables in the wxi won’t be seen in FilesFragment.wxs or RegistryFragment.wxs. You’d have to include it manually into those two wxs files too. For preprocessor variable $(var.VariableName) to be seen by every file in the project you have to include them in the WiX project properties->Build->“Define preprocessor variables” textbox. This is why I’ve chosen not to go this route because in multi developer teams not everyone has the same directory structure and having a single variable would mean each developer would have to checkout the wixproj file to edit the variable. This is pretty much unacceptable by my standards. This is why we’ve added a System Environment variable named SuperFormFilesDir as is shown in the previous Wix Tutorial post. Because the FilesFragment.wxs is autogenerated on every project build we don’t want to change it manually each time by adding the include wxi at the beginning of the file. This way we couldn’t recreate it in each pre-build event. <?xml version="1.0" encoding="utf-8"?><Include> <!-- Versioning. These have to be changed for upgrades. It's not enough to just include newer files. --> <?define MajorVersion="1" ?> <?define MinorVersion="0" ?> <?define BuildVersion="0" ?> <!-- Revision is NOT used by WiX in the upgrade procedure --> <?define Revision="0" ?> <!-- Full version number to display --> <?define VersionNumber="$(var.MajorVersion).$(var.MinorVersion).$(var.BuildVersion).$(var.Revision)" ?> <!-- Upgrade code HAS to be the same for all updates. Once you've chosen it don't change it. --> <?define UpgradeCode="YOUR-GUID-HERE" ?> <!-- Path to the resources directory. resources don't really need to be included in the project structure but I like to include them for for clarity --> <?define ResourcesDir="$(var.ProjectDir)\Resources" ?> <!-- The name of your application exe file. This will be used to kill the process when updating and creating the desktop shortcut --> <?define ExeProcessName="SuperForm.MainApp.exe" ?></Include> For now there’s no way to tell WiX in Visual Studio to have a wxi include file available to the whole project, so you have to include it in each file separately. Only variables set in “Define preprocessor variables” or System Environment variables are accessible to the whole project for now. The main WXS file: SuperForm.wxs We’ll only take a look at the general structure of the main SuperForm.wxs and not its the details. We’ll cover the details in future posts. The code comments should provide plenty info about what each part does in general. Basically there are 5 major parts. The update part, the conditions and actions part, the UI install sequence, the directory structure and the features we want to include. <?xml version="1.0" encoding="UTF-8"?><!-- Add xmlns:util namespace definition to be able to use stuff from WixUtilExtension dll--><Wix xmlns="http://schemas.microsoft.com/wix/2006/wi" xmlns:util="http://schemas.microsoft.com/wix/UtilExtension"> <!-- This is how we include wxi files --> <?include $(sys.CURRENTDIR)Includes\SuperFormVariables.wxi ?> <!-- Id="*" is to enable upgrading. * means that the product ID will be autogenerated on each build. Name is made of localized product name and version number. --> <Product Id="*" Name="!(loc.ProductName) $(var.VersionNumber)" Language="!(loc.LANG)" Version="$(var.VersionNumber)" Manufacturer="!(loc.ManufacturerName)" UpgradeCode="$(var.UpgradeCode)"> <!-- Define the minimum supported installer version (3.0) and that the install should be done for the whole machine not just the current user --> <Package InstallerVersion="300" Compressed="yes" InstallScope="perMachine"/> <Media Id="1" Cabinet="media1.cab" EmbedCab="yes" /> <!-- Upgrade settings. This will be explained in more detail in a future post --> <Upgrade Id="$(var.UpgradeCode)"> <UpgradeVersion OnlyDetect="yes" Minimum="$(var.VersionNumber)" IncludeMinimum="no" Property="NEWER_VERSION_FOUND" /> <UpgradeVersion Minimum="0.0.0.0" IncludeMinimum="yes" Maximum="$(var.VersionNumber)" IncludeMaximum="no" Property="OLDER_VERSION_FOUND" /> </Upgrade> <!-- Reference the global NETFRAMEWORK35 property to check if it exists --> <PropertyRef Id="NETFRAMEWORK35"/> <!-- Startup conditions that checks if .Net Framework 3.5 is installed or if we're running the OS higher than Windows XP SP2. If not the installation is aborted. By doing the (Installed OR ...) property means that this condition will only be evaluated if the app is being installed and not on uninstall or changing --> <Condition Message="!(loc.DotNetFrameworkNeeded)"> <![CDATA[Installed OR NETFRAMEWORK35]]> </Condition> <Condition Message="!(loc.AppNotSupported)"> <![CDATA[Installed OR ((VersionNT >= 501 AND ServicePackLevel >= 2) OR (VersionNT >= 502))]]> </Condition> <!-- This custom action in the InstallExecuteSequence is needed to stop silent install (passing /qb to msiexec) from going around it. --> <CustomAction Id="NewerVersionFound" Error="!(loc.SuperFormNewerVersionInstalled)" /> <InstallExecuteSequence> <!-- Check for newer versions with FindRelatedProducts and execute the custom action after it --> <Custom Action="NewerVersionFound" After="FindRelatedProducts"> <![CDATA[NEWER_VERSION_FOUND]]> </Custom> <!-- Remove the previous versions of the product --> <RemoveExistingProducts After="InstallInitialize"/> <!-- WixCloseApplications is a built in custom action that uses util:CloseApplication below --> <Custom Action="WixCloseApplications" Before="InstallInitialize" /> </InstallExecuteSequence> <!-- This will ask the user to close the SuperForm app if it's running while upgrading --> <util:CloseApplication Id="CloseSuperForm" CloseMessage="no" Description="!(loc.MustCloseSuperForm)" ElevatedCloseMessage="no" RebootPrompt="no" Target="$(var.ExeProcessName)" /> <!-- Use the built in WixUI_InstallDir GUI --> <UIRef Id="WixUI_InstallDir" /> <UI> <!-- These dialog references are needed for CloseApplication above to work correctly --> <DialogRef Id="FilesInUse" /> <DialogRef Id="MsiRMFilesInUse" /> <!-- Here we'll add the GUI logic for installation and updating in a future post--> </UI> <!-- Set the icon to show next to the program name in Add/Remove programs --> <Icon Id="SuperFormIcon.ico" SourceFile="$(var.ResourcesDir)\Exclam.ico" /> <Property Id="ARPPRODUCTICON" Value="SuperFormIcon.ico" /> <!-- Installer UI custom pictures. File names are made up. Add path to your pics. –> <!-- <WixVariable Id="WixUIDialogBmp" Value="MyAppLogo.jpg" /> <WixVariable Id="WixUIBannerBmp" Value="installBanner.jpg" /> --> <!-- the default directory structure --> <Directory Id="TARGETDIR" Name="SourceDir"> <Directory Id="ProgramFilesFolder"> <Directory Id="INSTALLLOCATION" Name="!(loc.ProductName)" /> </Directory> </Directory> <!-- Set the default install location to the value of INSTALLLOCATION (usually c:\Program Files\YourProductName) --> <Property Id="WIXUI_INSTALLDIR" Value="INSTALLLOCATION" /> <!-- Set the components defined in our fragment files that will be used for our feature --> <Feature Id="SuperFormFeature" Title="!(loc.ProductName)" Level="1"> <ComponentGroupRef Id="SuperFormFiles" /> <ComponentRef Id="cmpVersionInRegistry" /> <ComponentRef Id="cmpIsThisUpdateInRegistry" /> </Feature> </Product></Wix> For more info on what certain attributes mean you should look into the WiX Documentation.   WiX 3 tutorial by Mladen Prajdic navigation WiX 3 Tutorial: Solution/Project structure and Dev resources WiX 3 Tutorial: Understanding main wxs and wxi file WiX 3 Tutorial: Generating file/directory fragments with Heat.exe

    Read the article

< Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >