Search Results

Search found 3004 results on 121 pages for 'plain'.

Page 94/121 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • what makes a Tomcat5.5 cannot be "aware" of new Java Web Applications?

    - by Michael Mao
    This is for uni homework, but I reckon it is more a generic problem to the Tomcat Server(version 5.5.27) on my uni. The problem is, I first did a skeleton Java Web Application (Just a simple Servlet and a welcome-file, nothing complicated, no lib included) using NetBeans 6.8 with the bundled Tomcat 6.0.20 (localhost:8084/WSD) Then, to test and prove it is "portable" and "auto-deploy-able", I cleaned and built a WSD.war file and dropped it onto my Xampp Tomcat (localhost:8080/WSD). The war extracted everything accordingly and I can see identical output from this Tomcat. So far, so good. However, after I tried to drop to war onto uni server, funny thing happens: uni server Even though I've changed the war permission to 755, it is simply not "responding". I then copied the extracted files to uni server, the MainServlet cannot be recognized from within its Context Path "/WSD", basically nothing works, expect the static index.jsp. I tried several times to stop and restart uni Tomcat, it doesn't help? I wonder what makes this happen? Is there anything I did wrong with my approach? To be frank I paid no attention to a server not under my control, and I am unfortunately not a real active day-to-day Java Programmer now. I understand the fundamentals of MVC, Servelets, JSPs, JavaBeans, but I really feel frustrated by this, as I cannot see why... Or, should I ask, a Java Web Application, after cleaned and built by NetBeans6.8, is self-contained and self-configured so ready to be deployed to any Java Web Container? I know, I can certainly program everything in plain old JSP, but this is soooo... unacceptable to myself... Update : I am now wondering if there is any free Tomcat Hosting so that I would like to see if my war file and/or my web app can go with them without any configuration at all?

    Read the article

  • How to insert an element between the two elements dynamically?

    - by Harish
    I am using a table, in which there are buttons, on button click i want the new TR element to be inserted between the two TR or at the end of the TR... my code goes here <table> <tbody> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> </tbody> </table> i want to insert new TR element next to the element which has triggered the event... NOTE: i am not using any javascript library, just plain javascript

    Read the article

  • Unable to HTTP PUT with libcurl

    - by Jesse Beder
    I'm trying to PUT data using libcurl to mimic the command curl -u test:test -X PUT --data-binary @data.yaml "http://127.0.0.1:8000/foo/" which works correctly. My options look like: curl_easy_setopt(handle, CURLOPT_USERPWD, "test:test"); curl_easy_setopt(handle, CURLOPT_URL, "http://127.0.0.1:8000/foo/"); curl_easy_setopt(handle, CURLOPT_VERBOSE, 1); curl_easy_setopt(handle, CURLOPT_UPLOAD, 1); curl_easy_setopt(handle, CURLOPT_READFUNCTION, read_data); curl_easy_setopt(handle, CURLOPT_READDATA, &yaml); curl_easy_setopt(handle, CURLOPT_INFILESIZE, yaml.size()); curl_easy_perform(handle); I believe the read_data function works correctly, but if you ask, I'll post that code. I'm using Django with django-piston, and my update function is never called! (It is called when I use the command line version above.) libcurl's output is: * About to connect() to 127.0.0.1 port 8000 (#0) * Trying 127.0.0.1... * connected * Connected to 127.0.0.1 (127.0.0.1) port 8000 (#0) * Server auth using Basic with user 'test' > PUT /foo/ HTTP/1.1 Authorization: Basic dGVzdDp0ZXN0 Host: 127.0.0.1:8000 Accept: */* Content-Length: 244 Expect: 100-continue * Done waiting for 100-continue ** this is where my read_data handler confirms: read 244 bytes ** * HTTP 1.0, assume close after body < HTTP/1.0 400 BAD REQUEST < Date: Thu, 13 May 2010 08:22:52 GMT < Server: WSGIServer/0.1 Python/2.5.1 < Vary: Authorization < Content-Type: text/plain < Bad Request* Closing connection #0

    Read the article

  • How to install Zend Framework on Windows

    - by sombe
    "installing Zend Framework is so easy!!!!" yeah right... Ok I'm working with a beginner's book and the ONE thing that is not excessively detailed is the most important part: Installing the darn thing. After browsing the quickstart guide for hours, all it said was: "download Zend [...] add the include directory (bla bla) and YOU'RE DONE!" right, i'm done using Zend. Ok, not really, not yet anyway. I beg of you people, I wanna go to bed, please tell me how (in simple 6th grade detail) to install the framework. I've got the unzipped folder in my htdocs directory, and I placed zf.bat+zf.php in the htdocs root. What's next? thank you so much. EDIT: Thanks guys for all the answers. Unfortunately I haven't been able to work with this or find a good enough resource to explain it to me in plain english. It seems that this framework adheres more so to programmers than to beginners. I've since yesterday read a little on CakePHP and found that it was incredibly easy to install and tune. As oppose to Zend Framework, where I had to dig in my "environment variables", configure "httpd.conf" and almost tie the knot between my computer driver cables to just get it running, CakePHP has already allowed me to put together a nice newbie application. In conclusion, I very much appreciate all of your help. I hope someone else venturing on ZF will be more successful with it. Thanks!

    Read the article

  • d2: assigning ranges/iterators to array slices

    - by modchan
    Consider following code: enum size = 16; double[size] arr1 = [...]; double[size] arr2 = [...]; process = (double x) { return (x + 1); }; arr2[] = map!(process)(arr1[]); // here I have trouble converting results of map back to my plain array. Problem applies not only to map, but also to take, repeat and all those fine tools from std.algorithm and std.range that operate on ranges. On this assignment, I get Error: cannot implicitly convert expression (map(arr1[])) of type Result to double[]. How can I evaluate range to array without using uint i = 0; foreach (x; map!(process)(arr1[])) { arr2[i] = x; i++; } ? Additionally, can someone please explain, why I must call map!(process)(arr1[]) instead of map!(process)(arr1) with static arrays? Shouldn't static arrays be compatible with dynamic for means of iteration, or I don't get something? Also, it seems that straightforward enumeration syntax foreach (index, item; sequence) does not work for ranges - are there workarounds? I guess the reason is the same as why ranges cannot be assigned to array slices.

    Read the article

  • PHP weirdness extending IMagick class

    - by Jamie Carl
    This is a really weird one. I have some code that is happily working on version 2.1.1RC1 of the php5-imagick module. It's basically just a class I wrote that extends the Imagick class and manages images stored in a database. Since upgrading to version 3.0.0RC1 (thankfully only on my dev box) things have gone to hell. It seems that object members are writeable but are NOT readable. Take the following sample code: class db_image extends IMagick { private $data; function __construct( $id = null ){ parent::__construct(); $this->data = 'some plain text'; echo $this->data; } This will output absolutely NOTHING. My debugger indicates that the contents of $this-data are the correct string value, but I am unable to read the value back out of the member variable. Seriously. WTF? Does anyone know what is causing this or has seen it before? I don't even know how to replicate this behaviour in my own classes.

    Read the article

  • Read IFrame content using JavaScript

    - by Rajat
    Ok, This is my first time dealing seriously with IFrames and I cant seem to understand a few things: First the sample code I am testing with: <head> <script type="text/javascript"> function init(){ console.log("IFrame content: " + window.frames['i1'].document.getElementsByTagName('body')[0].innerHTML); } </script> </head> <body onload="init();"> <iframe name="i1" src="foo.txt"/> </body> the file "foo.txt" looks like this: sample text file Questions: 1) The iframe seems to be behaving as a HTML document and the file text is actually part of the body instead. Why ? Is it a rule for an IFrame to be a HTML document. Is it not possible for the content of an iframe to be just plain text ?? 2) The file content gets wrapped inside a pre tag for some reason. Why is this so ? Is it always the case? 3) My access method in the javascript is working but is there any other alternative? [native js solutions please] If the content is wrapped in a pre tag always then I will actually have to lookup inside the pre tag rather than lookup the innerHTML

    Read the article

  • JavaFX: File upload to REST service / servlet fails because of missing boundary

    - by spa
    I'm trying to upload a file using JavaFX using the HttpRequest. For this purpose I have written the following function. function uploadFile(inputFile : File) : Void { // check file if (inputFile == null or not(inputFile.exists()) or inputFile.isDirectory()) { return; } def httpRequest : HttpRequest = HttpRequest { location: urlConverter.encodeURL("{serverUrl}"); source: new FileInputStream(inputFile) method: HttpRequest.POST headers: [ HttpHeader { name: HttpHeader.CONTENT_TYPE value: "multipart/form-data" } ] } httpRequest.start(); } On the server side, I am trying to handle the incoming data using the Apache Commons FileUpload API using a Jersey REST service. The code used to do this is a simple copy of the FileUpload tutorial on the Apache homepage. @Path("Upload") public class UploadService { public static final String RC_OK = "OK"; public static final String RC_ERROR = "ERROR"; @POST @Produces("text/plain") public String handleFileUpload(@Context HttpServletRequest request) { if (!ServletFileUpload.isMultipartContent(request)) { return RC_ERROR; } FileItemFactory factory = new DiskFileItemFactory(); ServletFileUpload upload = new ServletFileUpload(factory); List<FileItem> items = null; try { items = upload.parseRequest(request); } catch (FileUploadException e) { e.printStackTrace(); return RC_ERROR; } ... } } However, I get a exception at items = upload.parseRequest(request);: org.apache.commons.fileupload.FileUploadException: the request was rejected because no multipart boundary was found I guess I have to add a manual boundary info to the InputStream. Is there any easy solution to do this? Or are there even other solutions?

    Read the article

  • How spoof referrer using curl

    - by golu molu
    I am using curl code below to spoof referrer , it works fine but there is error on every page - Curl error: $url = somesite.com function doMagic($url) { $curl = curl_init(); $header[0] = "Accept: text/xml,application/xml,application/xhtml+xml,"; $header[0] .= "text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; $header[] = "Cache-Control: max-age=0"; $header[] = "Connection: keep-alive"; $header[] = "Keep-Alive: 300"; $header[] = "Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7"; $header[] = "Accept-Language: en-us,en;q=0.5"; $header[] = "Pragma: "; curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_USERAGENT, "Mozilla/5.0 (Windows NT 6.1; WOW64; rv:7.0.1) Gecko/20100101 Firefox/7.0.12011-10-16 20:23:00"); curl_setopt($curl, CURLOPT_HTTPHEADER, $header); curl_setopt($curl, CURLOPT_REFERER, "http://www.facebook.com"); curl_setopt($curl, CURLOPT_ENCODING, "gzip,deflate"); curl_setopt($curl, CURLOPT_AUTOREFERER, true); curl_setopt($curl, CURLOPT_RETURNTRANSFER, 1); curl_setopt($curl, CURLOPT_TIMEOUT, 30); curl_setopt($curl, CURLOPT_FOLLOWLOCATION,true); $html = curl_exec($curl); echo 'Curl error: '. curl_error($curl); curl_close($curl); return $html; } $text = doMagic($url); print("$text"); what i'm doing wrong?

    Read the article

  • Should a developer be a coauthor to a paper presented about the application they developed?

    - by ved
    In our organization, project teams come up with a need and funding and developers are given a basic scope and are allowed to develop the solution. There is a certain degree of implementation freedom given to the developers. They drive the solution to pilot and live deployment from its inception. If the solution is presented in a conference as a technical paper/white paper what is the protocol for the list of authors: because for the most part I see the project manager's and the dev team manager's names as authors but no mention of the actual developer. Is this correct? A lot of us developers feel pretty bummed to never see our names as the coauthors. Appreciate any pointers. Answers to the FOLLOW UP questions (1) in what field of study is the paper, and what are the standards of authorship for that field? The paper is for Flood Plain Management - there is nothing on the abstract guidelines, I have called the contact person listed for comment - waiting to hear. 2) was the paper literally about the software application as your question implies, or were the software issues incidental to the topic of the paper? The paper specifically deals with a GIS Application that is used in Coastal Engineering, yes the software is not incidental, but the meat of the paper and mentioned in the Title. 2

    Read the article

  • C++: is it safe to work with std::vectors as if they were arrays?

    - by peoro
    I need to have a fixed-size array of elements and to call on them functions that require to know about how they're placed in memory, in particular: functions like glVertexPointer, that needs to know where the vertices are, how distant they are one from the other and so on. In my case vertices would be members of the elements to store. to get the index of an element within this array, I'd prefer to avoid having an index field within my elements, but would rather play with pointers arithmetic (ie: index of Element *x will be x - & array[0]) -- btw, this sounds dirty to me: is it good practice or should I do something else? Is it safe to use std::vector for this? Something makes me think that an std::array would be more appropriate but: Constructor and destructor for my structure will be rarely called: I don't mind about such overhead. I'm going to set the std::vector capacity to size I need (the size that would use for an std::array, thus won't take any overhead due to sporadic reallocation. I don't mind a little space overhead for std::vector's internal structure. I could use the ability to resize the vector (or better: to have a size chosen during setup), and I think there's no way to do this with std::array, since its size is a template parameter (that's too bad: I could do that even with an old C-like array, just dynamically allocating it on the heap). If std::vector is fine for my purpose I'd like to know into details if it will have some runtime overhead with respect to std::array (or to a plain C array): I know that it'll call the default constructor for any element once I increase its size (but I guess this won't cost anything if my data has got an empty default constructor?), same for destructor. Anything else?

    Read the article

  • Create new or update existing entity at one go with JPA

    - by Alex R
    A have a JPA entity that has timestamp field and is distinguished by a complex identifier field. What I need is to update timestamp in an entity that has already been stored, otherwise create and store new entity with the current timestamp. As it turns out the task is not as simple as it seems from the first sight. The problem is that in concurrent environment I get nasty "Unique index or primary key violation" exception. Here's my code: // Load existing entity, if any. Entity e = entityManager.find(Entity.class, id); if (e == null) { // Could not find entity with the specified id in the database, so create new one. e = entityManager.merge(new Entity(id)); } // Set current time... e.setTimestamp(new Date()); // ...and finally save entity. entityManager.flush(); Please note that in this example entity identifier is not generated on insert, it is known in advance. When two or more of threads run this block of code in parallel, they may simultaneously get null from entityManager.find(Entity.class, id) method call, so they will attempt to save two or more entities at the same time, with the same identifier resulting in error. I think that there are few solutions to the problem. Sure I could synchronize this code block with a global lock to prevent concurrent access to the database, but would it be the most efficient way? Some databases support very handy MERGE statement that updates existing or creates new row if none exists. But I doubt that OpenJPA (JPA implementation of my choice) supports it. Event if JPA does not support SQL MERGE, I can always fall back to plain old JDBC and do whatever I want with the database. But I don't want to leave comfortable API and mess with hairy JDBC+SQL combination. There is a magic trick to fix it using standard JPA API only, but I don't know it yet. Please help.

    Read the article

  • wsgi django not working

    - by MaKo
    im installing django, the test for wsgi is ok, but when i point my default file to the django test, it doesnt work, this is the test that works fine: default: /etc/apache2/sites-available/default <VirtualHost *:80> ServerName www.example.com ServerAlias example.com ServerAdmin [email protected] DocumentRoot /var/www <Directory /var/www/documents> Order allow,deny Allow from all </Directory> WSGIScriptAlias / /home/ubuntu/djangoProj/micopiloto/application.wsgi <Directory /home/ubuntu/djangoProj/mysitio/wsgi_handler.py> Order allow,deny Allow from all </Directory> </VirtualHost> application.wsgi:: ~/djangoProj/micopiloto import os import sys sys.path.append('/srv/www/cucus/application') os.environ['PYTHON_EGG_CACHE'] = '/srv/www/cucus/.python-egg' def application(environ, start_response): status = '200 OK' output = 'Hello World!MK SS9 tkt kkk' response_headers = [('Content-type', 'text/plain'), ('Content-Length', str(len(output)))] start_response(status, response_headers) return [output] but if I change the default to point to application_sa.wsgi the django test, it doesnt work :( application_sa.wsgi import os, sys sys.path.append('/home/ubuntu/djangoProj/micopiloto') os.environ['DJANGO_SETTINGS_MODULE'] = 'micopiloto.settings' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() I restart the apache server every time i change the wsgi to test, so what im i missing? thanks a lot!

    Read the article

  • Error when loading YAML config files in Rails

    - by ZelluX
    I am configuring Rails with MongoDB, and find a strange problem when paring config/mongo.yml file. config/mongo.yml is generated by executing script/rails generate mongo_mapper:config, and it looks like following: defaults: &defaults host: 127.0.0.1 port: 27017 development: <<: *defaults database: tc_web_development test: <<: *defaults database: tc_web_test From the config file we can see the objects development and test should both have a database field. But when it is parsed and loaded in config/initializers/mongo.db, config = YAML::load(File.read(Rails.root.join('config/mongo.yml'))) puts config.inspect MongoMapper.setup(config, Rails.env) the strange thing comes: the output of puts config.inspect is {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017}, "test"=>{"host"=>"127.0.0.1", "port"=>27017}} which does not contain database attribute. But when I execute the same statements in a plain ruby console, instead of using rails console, mongo.yml is parsed in a right way. {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_development"}, "test"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_test"}} I am wondering what may be the cause of this problem. Any ideas? Thanks.

    Read the article

  • Javascript + PHP $_POST array empty

    - by Peterim
    While trying to send a POST request via xmlhttp.open("POST", "url", true) (javascript) to the server I get an empty $_POST array. Firebug shows that the data is being sent. Here is the data string from Firebug: a=1&q=151a45a150.... But $_POST['q'] returns nothing. The interesting thing is that file_get_contents('php://input') does have my data (the string above), but PHP somehow doesn't recognize it. Tried both $_POST and $_REQUEST, nothing works. Headers being sent: POST /test.php HTTP/1.1 Host: website.com User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3 Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Accept-Language: en-us;q=0.7,en;q=0.3 Accept-Encoding: gzip,deflate Accept-Charset: utf-8;q=0.7,*;q=0.7 Keep-Alive: 115 Connection: keep-alive Referer: http://website.com/ Content-Length: 156 Content-Type: text/plain; charset=UTF-8 Pragma: no-cache Cache-Control: no-cache Thank you for any suggestions.

    Read the article

  • Endianness and C API's: Specifically OpenSSL.

    - by Hassan Syed
    I have an algorithm that uses the following OpenSSL calls: HMAC_update() / HMAC_final() // ripe160 EVP_CipherUpdate() / EVP_CipherFinal() // cbc_blowfish These algorithm take a unsigned char * into the "plain text". My input data is comes from a C++ std::string::c_str() which originate from a protocol buffer object as a encoded UTF-8 string. UTF-8 strings are meant to be endian neutrial. However I'm a bit paranoid about how OpenSSL may perform operations on the data. My understanding is that encryption algorithms work on 8-bit blocks of data, and if a unsigned char * is used for pointer arithmetic when the operations are performed the algorithms should be endian neutral and I do not need to worry about anything. My uncertainty is compounded by the fact that I am working on a little-endian machine and have never done any real cross-architecture programming. My beliefs/reasoning are/is based on the following two properties std::string (not wstring) internally uses a 8-bit ptr and a the resulting c_str() ptr will itterate the same way regardless of the CPU architecture. Encryption algorithms are either by design, or by implementation, endian neutral. I know the best way to get a definitive answer is to use QEMU and do some cross-platform unit tests (which I plan to do). My question is a request for comments on my reasoning, and perhaps will assist other programmers when faced with similar problems.

    Read the article

  • Java: how do I get a class literal from a generic type?

    - by Tom
    Typically, I've seen people use the class literal like this: Class<Foo> cls = Foo.class; But what if the type is generic, e.g. List? This works fine, but has a warning since List should be parameterized: Class<List> cls = List.class So why not add a <?>? Well, this causes a type mismatch error: Class<List<?>> cls = List.class I figured something like this would work, but this is just a plain ol' a syntax error: Class<List<Foo>> cls = List<Foo>.class How can I get a Class<List<Foo>> statically, e.g. using the class literal? I could use @SuppressWarnings("unchecked") to get rid of the warnings caused by the non-parameterized use of List in the first example, Class<List> cls = List.class, but I'd rather not. Any suggestions? Thanks!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Binding value for NSTableView, but tooltip gets set as well

    - by Mark
    I've set up an NSTableView in Interface Builder to be populated from an NSArray. Each value of the array represents one row in the table. The value is bound correctly, but as a side effect, the table cell's tooltip is set to the string representation of the bound object. In my case, the NSArray contains NSDictiorany objects and the tooltip looks like it could be the [... description] output of that dictionary. Very ugly... I don't want the tooltip to be set at all. I have other tables that have plain NSString values bound to them and they don't have a tooltip set automatically. Is there some Interface Builder magic going on? I tried to start with a blank project - same problem. I should add that the table cell is a custom implementation of NSTextFieldCell that uses an NSButtonCell instance to draw an image and a label into the table. The values are retrieved from the dictionary bound as value. Why is the tooltip set when I only bind the "value" attribute? Thanks in advance!

    Read the article

  • Fastest XML parser for small, simple documents in Java

    - by Varkhan
    I have to objectify very simple and small XML documents (less than 1k, and it's almost SGML: no namespaces, plain UTF-8, you name it...), read from a stream, in Java. I am using JAXP to process the data from my stream into a Document object. I have tried Xerces, it's way too big and slow... I am using Dom4j, but I am still spending way too much time in org.dom4j.io.SAXReader. Does anybody out there have any suggestion on a faster, more efficient implementation, keeping in mind I have very tough CPU and memory constraints? [Edit 1] Keep in mind that my documents are very small, so the overhead of staring the parser can be important. For instance I am spending as much time in org.xml.sax.helpers.XMLReaderFactory.createXMLReader as in org.dom4j.io.SAXReader.read [Edit 2] The result has to be in Dom format, as I pass the document to decision tools that do arbitrary processing on it, like switching code based on the value of arbitrary XPaths, but also extracting lists of values packed as children of a predefined node. [Edit 3] In any case I eventually need to load/parse the complete document, since all the information it contains is going to be used at some point. (This question is related to, but different from, http://stackoverflow.com/questions/373833/best-xml-parser-for-java )

    Read the article

  • php automatically commented with apache

    - by clement
    We have installed apache 2.2, and activeperl to run bugzilla, all that on a Windows Server 2003. Here We want to install PHP on the server to install a wiki. I followed those steps: tutorial to install PHP and enable it from Apache. After all those steps, I restart couples of times, and When I try a simple phpinfo() on PHP, the whole PHP code is commented: < ! - - ?php phpinfo(); ? - - Now, the httpd.conf was already edited for the PERL and it can be those edits that make the mistake. Here is the whole httpd.conf file: ServerRoot "C:/Program Files/Apache Software Foundation/Apache2.2" Listen 6969 LoadModule actions_module modules/mod_actions.so LoadModule alias_module modules/mod_alias.so LoadModule asis_module modules/mod_asis.so LoadModule auth_basic_module modules/mod_auth_basic.so LoadModule php5_module "c:/php/php5apache2_2.dll" LoadModule authn_default_module modules/mod_authn_default.so LoadModule authn_file_module modules/mod_authn_file.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_host_module modules/mod_authz_host.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule autoindex_module modules/mod_autoindex.so LoadModule cgi_module modules/mod_cgi.so LoadModule dir_module modules/mod_dir.so LoadModule env_module modules/mod_env.so LoadModule include_module modules/mod_include.so LoadModule isapi_module modules/mod_isapi.so LoadModule log_config_module modules/mod_log_config.so LoadModule mime_module modules/mod_mime.so LoadModule negotiation_module modules/mod_negotiation.so LoadModule setenvif_module modules/mod_setenvif.so User daemon Group daemon ServerAdmin [email protected] DocumentRoot C:/bugzilla-4.4.2/ Options FollowSymLinks AllowOverride None Order deny,allow Deny from all Options Indexes FollowSymLinks ExecCGI AllowOverride All Order allow,deny Allow from all ScriptInterpreterSource Registry-Strict DirectoryIndex index.html index.html.var index.cgi index.php Order allow,deny Deny from all Satisfy All ErrorLog "logs/error.log" LogLevel warn LogFormat "%h %l %u %t \"%r\" %s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %s %b" common <IfModule logio_module> LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> ScriptAlias /cgi-bin/ "C:/Program Files/Apache Software Foundation/Apache2.2/cgi-bin/" AllowOverride None Options None Order allow,deny Allow from all DefaultType text/plain AddType application/x-compress .Z AddType application/x-gzip .gz .tgz AddHandler cgi-script .cgi AddType application/x-httpd-php .php SSLRandomSeed startup builtin SSLRandomSeed connect builtin PHPIniDir "c:/php"

    Read the article

  • Using DotNetOpenAuth AccessToken for uploading docx file to google

    - by PrashantC
    Hi , I am using DotNetOpenAuth Package, I am trying to upload a package to google docs, Using client credentials i am able to do it successfully using following code, DocumentEntry objDocumentEntry = new DocumentEntry(); objDocumentsService.setUserCredentials(strUserName,strPassWord); string strAuthenticationToken = objDocumentsService.QueryAuthenticationToken(); objDocumentEntry = objDocumentsService.UploadDocument(Server.MapPath("test.docx"), "New Name"); I want achieve save with plain oAuth, I am having following code written for it, if (this.TokenManager != null) { if (!IsPostBack) { var google = new WebConsumer(GoogleConsumer.ServiceDescription, this.TokenManager); // Is Google calling back with authorization? var accessTokenResponse = google.ProcessUserAuthorization(); if (accessTokenResponse != null) { this.AccessToken = accessTokenResponse.AccessToken; } else if (this.AccessToken == null) { // If we don't yet have access, immediately request it. GoogleConsumer.RequestAuthorization(google, GoogleConsumer.Applications.DocumentsList); } } } I successfully get "AccessToken", But i am not sure how to use it.. Do we need to exchange this token? what excatly to do with this token? Is it a sessionToken? Please provide some inputs, I am badly stuck with this problem from last 3 days, Prashant C

    Read the article

  • How to avoid hard-coded credentials in Sharepoint webpart?

    - by Bryan
    I am building a Sharepoint web part that will be used by all users, but can only be modified by admins. The web part connects to a web service which needs credentials. I hard coded credentials in the web part's code. query.Credentials = new System.Net.NetworkCredential("username", "password", "domain"); query is an instance of the web service class This may not be a good approach. In regard with security, the source code of the web apart is available to people who are not allowed to see the credentials. In normal ASP.net applications, credentials can be written into web.config and encrypted. A web part doesn't have a .config file associated. There is a application-level .config file for the whole sharepoint site, but I don't want to modify it for a single webpart. I wonder if there is a webpart-specific way to solve the credential problem? Say we provide a WebBrowsable property of that web part so that privileged users can modify credentials. If this is desirable, how should I make the property displayed in a password ("*") rather than in plain text? Thanks.

    Read the article

  • Progressively stream the output of an ASP.NET page - or render a page outside of an HTTP request

    - by Evgeny
    I have an ASP.NET 2.0 page with many repeating blocks, including a third-party server-side control (so it's not just plain HTML). Each is quite expensive to generate, in terms of both CPU and RAM. I'm currently using a standard Repeater control for this. There are two problems with this simple approach: The entire page must be rendered before any of it is returned to the client, so the user must wait a long time before they see any data. (I write progress messages using Response.Write, so there is feedback, but no actual results.) The ASP.NET worker process must hold everything in memory at the same time. There is no inherent needs for this: once one block is processed it won't be changed, so it could be returned to the client and the memory could be freed. I would like to somehow return these blocks to the client one at a time, as each is generated. I'm thinking of extracting the stuff inside the Repeater into a separate page and getting it repeatedly using AJAX, but there are some complications involved in that and I wonder if there is some simper approach. Ideally I'd like to keep it as one page (from the client's point of view), but return it incrementally. Another way would be to do something similar, but on the server: still create a separate page, but have the server access it and then Response.Write() the HTML it gets to the response stream for the real client request. Is there a way to avoid an HTTP request here, though? Is there some ASP.NET method that would render a UserControl or a Page outside of an HTTP request and simply return the HTML to me as a string? I'm open to other ideas on how to do this as well.

    Read the article

  • Out of memory while iterating through rowset

    - by Phliplip
    Hi All, I have a "small" table of 60400 rows with zipcode data. I wan't to iterate through them all, update a column value, and then save it. The following is part of my Zipcodes model which extends My_Db_Table that a totalRows function that - you guessed it.. returns the total number of rows in the table (60400 rows) public function normalizeTable() { $this->getAdapter()->setProfiler(false); $totalRows = $this->totalRows(); $rowsPerQuery = 5; for($i = 0; $i < $totalRows; $i = $i + $rowsPerQuery) { $select = $this->select()->limit($i, $rowsPerQuery); $rowset = $this->fetchAll($select); foreach ($rowset as $row) { $row->{self::$normalCityColumn} = $row->normalize($row->{self::$cityColumn}); $row->save(); } unset($rowset); } } My rowClass contains a normalize function (basicly a metaphone wrapper doing some extra magic). At first i tried a plain old $this-fetchAll(), but got a out of memory (128MB) right away. Then i tried splitting the rowset into chunks, only difference is that some rows actually gets updated. Any ideas on how i can acomplish this, or should i fallback to ye'olde mysql_query()

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >