Search Results

Search found 3004 results on 121 pages for 'plain'.

Page 94/121 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • Function pointers in Objective-C

    - by Stefan Klumpp
    I have the following scenario: Class_A - method_U - method_V - method_X - method_Y Class_B - method_M - method_N HttpClass - startRequest - didReceiveResponse // is a callback Now I want to realize these three flows (actually there are many more, but these are enough to demonstrate my question): Class_A :: method_X -> HttpClass :: startRequest:params -> ... wait, wait, wait ... -> HttpClass :: didReceiveResponse -> Class_A :: method_Y:result and: Class_A :: method_U -> HttpClass :: startRequest:params -> ... wait, wait, wait ... -> HttpClass :: didReceiveResponse -> Class_A :: method_V:result and the last one: Class_B :: method_M -> HttpClass :: startRequest:params -> ... wait, wait, wait ... -> HttpClass :: didReceiveResponse -> Class_B :: method_N:result Please note, that the methods in Class_A and Class_B have different names and functionality, they just make us of the same HttpClass. My solution now would be to pass a C function pointer to startRequest, store it in the HttpClass and when didReceiveResponse gets called I invoke the function pointer and pass the result (which will always be a JSON Dictionary). Now I'm wondering if there can be any problems using plain C or if there are better solutions doing it in a more Objective-C way. Any ideas?

    Read the article

  • PHP weirdness extending IMagick class

    - by Jamie Carl
    This is a really weird one. I have some code that is happily working on version 2.1.1RC1 of the php5-imagick module. It's basically just a class I wrote that extends the Imagick class and manages images stored in a database. Since upgrading to version 3.0.0RC1 (thankfully only on my dev box) things have gone to hell. It seems that object members are writeable but are NOT readable. Take the following sample code: class db_image extends IMagick { private $data; function __construct( $id = null ){ parent::__construct(); $this->data = 'some plain text'; echo $this->data; } This will output absolutely NOTHING. My debugger indicates that the contents of $this-data are the correct string value, but I am unable to read the value back out of the member variable. Seriously. WTF? Does anyone know what is causing this or has seen it before? I don't even know how to replicate this behaviour in my own classes.

    Read the article

  • php automatically commented with apache

    - by clement
    We have installed apache 2.2, and activeperl to run bugzilla, all that on a Windows Server 2003. Here We want to install PHP on the server to install a wiki. I followed those steps: tutorial to install PHP and enable it from Apache. After all those steps, I restart couples of times, and When I try a simple phpinfo() on PHP, the whole PHP code is commented: < ! - - ?php phpinfo(); ? - - Now, the httpd.conf was already edited for the PERL and it can be those edits that make the mistake. Here is the whole httpd.conf file: ServerRoot "C:/Program Files/Apache Software Foundation/Apache2.2" Listen 6969 LoadModule actions_module modules/mod_actions.so LoadModule alias_module modules/mod_alias.so LoadModule asis_module modules/mod_asis.so LoadModule auth_basic_module modules/mod_auth_basic.so LoadModule php5_module "c:/php/php5apache2_2.dll" LoadModule authn_default_module modules/mod_authn_default.so LoadModule authn_file_module modules/mod_authn_file.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_host_module modules/mod_authz_host.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule autoindex_module modules/mod_autoindex.so LoadModule cgi_module modules/mod_cgi.so LoadModule dir_module modules/mod_dir.so LoadModule env_module modules/mod_env.so LoadModule include_module modules/mod_include.so LoadModule isapi_module modules/mod_isapi.so LoadModule log_config_module modules/mod_log_config.so LoadModule mime_module modules/mod_mime.so LoadModule negotiation_module modules/mod_negotiation.so LoadModule setenvif_module modules/mod_setenvif.so User daemon Group daemon ServerAdmin [email protected] DocumentRoot C:/bugzilla-4.4.2/ Options FollowSymLinks AllowOverride None Order deny,allow Deny from all Options Indexes FollowSymLinks ExecCGI AllowOverride All Order allow,deny Allow from all ScriptInterpreterSource Registry-Strict DirectoryIndex index.html index.html.var index.cgi index.php Order allow,deny Deny from all Satisfy All ErrorLog "logs/error.log" LogLevel warn LogFormat "%h %l %u %t \"%r\" %s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %s %b" common <IfModule logio_module> LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> ScriptAlias /cgi-bin/ "C:/Program Files/Apache Software Foundation/Apache2.2/cgi-bin/" AllowOverride None Options None Order allow,deny Allow from all DefaultType text/plain AddType application/x-compress .Z AddType application/x-gzip .gz .tgz AddHandler cgi-script .cgi AddType application/x-httpd-php .php SSLRandomSeed startup builtin SSLRandomSeed connect builtin PHPIniDir "c:/php"

    Read the article

  • Font advance calculation problem on Blackberry OS 5.0

    - by John
    I am currently working on my own implementation of a tab bar for a BlackBerry app, where each tab bar has a title that is right aligned (i.e. the last character in each should be the same distance from the right hand side of the screen). To work out where to draw the text I am using the following calculation: screen width - advance of title - indent. The font I am using is 'BBAlpha Sans' (height 28). Using BlackBerry OS 4.6 everything seems to be calculated properly and the text is aligned when I move between tabs, however I am finding that when I use OS 5.0 it doesn't calculate the advance properly and as a result the alignment is off by maybe 5 pixels or so. With the default font (also BBAlpha Sans, but height 24 - for OS 5.0 at least) it works fine in both versions.. but I don't necessarily always want to use the default font/size, so any ideas what could be going wrong? Is this a bug in the 5.0 API? Thanks. Code: public class TitleBarBackground extends Background { .. public void draw(Graphics graphics, XYRect rect) { graphics.pushRegion(rect); .. Font titleBarFont = FontFamily.forName("BBAlpha Sans").getFont(Font.PLAIN, 28); ... int textWidth = titleBarFont.getAdvance(title); graphics.drawText(title, rect.width - textWidth - TITLE_OFFSET, textYOffset); graphics.popContext(); } .. }

    Read the article

  • wmd editor, why does it keep showing html instead of just going straight to markup

    - by Ke
    hi, im wondering how wmd is supposed to work, when i type in the textarea the text doesnt have html, but once the text is stored in db it turns to html. wmd also shows all this html when reloading the content? is it supposed to work like this? Do I have to sanitize the text before its put into the db? if so how? I thought wmd doesnt deal with html? except in code blocks. Also there are p tags being added Using the beneath html it gets added directly. I guess this could cause xss attacks? - (1) <a onmouseover="alert(1)" href="#">read this!</a> - (2) <p <script>alert(1)</script>hello - (3) </td <script>alert(1)</script>hello I wonder how is wmd supposed to work? I thought it was supposed to enter everything in its own mark up, store its on mark up and retrieve it etc. instead of storing plain html Chees Ke

    Read the article

  • wsgi django not working

    - by MaKo
    im installing django, the test for wsgi is ok, but when i point my default file to the django test, it doesnt work, this is the test that works fine: default: /etc/apache2/sites-available/default <VirtualHost *:80> ServerName www.example.com ServerAlias example.com ServerAdmin [email protected] DocumentRoot /var/www <Directory /var/www/documents> Order allow,deny Allow from all </Directory> WSGIScriptAlias / /home/ubuntu/djangoProj/micopiloto/application.wsgi <Directory /home/ubuntu/djangoProj/mysitio/wsgi_handler.py> Order allow,deny Allow from all </Directory> </VirtualHost> application.wsgi:: ~/djangoProj/micopiloto import os import sys sys.path.append('/srv/www/cucus/application') os.environ['PYTHON_EGG_CACHE'] = '/srv/www/cucus/.python-egg' def application(environ, start_response): status = '200 OK' output = 'Hello World!MK SS9 tkt kkk' response_headers = [('Content-type', 'text/plain'), ('Content-Length', str(len(output)))] start_response(status, response_headers) return [output] but if I change the default to point to application_sa.wsgi the django test, it doesnt work :( application_sa.wsgi import os, sys sys.path.append('/home/ubuntu/djangoProj/micopiloto') os.environ['DJANGO_SETTINGS_MODULE'] = 'micopiloto.settings' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() I restart the apache server every time i change the wsgi to test, so what im i missing? thanks a lot!

    Read the article

  • How to insert an element between the two elements dynamically?

    - by Harish
    I am using a table, in which there are buttons, on button click i want the new TR element to be inserted between the two TR or at the end of the TR... my code goes here <table> <tbody> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> </tbody> </table> i want to insert new TR element next to the element which has triggered the event... NOTE: i am not using any javascript library, just plain javascript

    Read the article

  • Unable to HTTP PUT with libcurl

    - by Jesse Beder
    I'm trying to PUT data using libcurl to mimic the command curl -u test:test -X PUT --data-binary @data.yaml "http://127.0.0.1:8000/foo/" which works correctly. My options look like: curl_easy_setopt(handle, CURLOPT_USERPWD, "test:test"); curl_easy_setopt(handle, CURLOPT_URL, "http://127.0.0.1:8000/foo/"); curl_easy_setopt(handle, CURLOPT_VERBOSE, 1); curl_easy_setopt(handle, CURLOPT_UPLOAD, 1); curl_easy_setopt(handle, CURLOPT_READFUNCTION, read_data); curl_easy_setopt(handle, CURLOPT_READDATA, &yaml); curl_easy_setopt(handle, CURLOPT_INFILESIZE, yaml.size()); curl_easy_perform(handle); I believe the read_data function works correctly, but if you ask, I'll post that code. I'm using Django with django-piston, and my update function is never called! (It is called when I use the command line version above.) libcurl's output is: * About to connect() to 127.0.0.1 port 8000 (#0) * Trying 127.0.0.1... * connected * Connected to 127.0.0.1 (127.0.0.1) port 8000 (#0) * Server auth using Basic with user 'test' > PUT /foo/ HTTP/1.1 Authorization: Basic dGVzdDp0ZXN0 Host: 127.0.0.1:8000 Accept: */* Content-Length: 244 Expect: 100-continue * Done waiting for 100-continue ** this is where my read_data handler confirms: read 244 bytes ** * HTTP 1.0, assume close after body < HTTP/1.0 400 BAD REQUEST < Date: Thu, 13 May 2010 08:22:52 GMT < Server: WSGIServer/0.1 Python/2.5.1 < Vary: Authorization < Content-Type: text/plain < Bad Request* Closing connection #0

    Read the article

  • How can you push a new view with a grouped table?

    - by Tanner
    Hi All, Ive been trying to push a new view when a cell is tapped but absolutely nothing happens. I figured grouped style pushed the same as plain. Here is my code: -(void)viewDidLoad { [super viewDidLoad]; contactArray = [[NSArray alloc] initWithObjects:@"iPhone",@"iPod",@"MacBook",@"MacBook Pro",nil]; shareArray = [[NSArray alloc] initWithObjects:@"Flex",@"AIR",@"PhotoShop",@"Flash",nil]; } -(NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 2; } // Customize the number of rows in the table view. -(NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { if(section == 0) return [contactArray count]; else return [shareArray count]; } -(NSString *)tableView:(UITableView *)tableView titleForHeaderInSection:(NSInteger)section{ if(section == 0){ return @"Contact"; }else{ return @"Share"; } } -(NSString *)tableView:(UITableView *)tableView titleForFooterInSection:(NSInteger)section{ if(section == 0){ return @"Footer for Apple Products"; }else{ return @"Footer for Adobe Softwares"; } } // Customize the appearance of table view cells. -(UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; } // Set up the cell... if(indexPath.section == 0){ cell.text = [contactArray objectAtIndex:indexPath.row]; }else{ cell.text = [shareArray objectAtIndex:indexPath.row]; } return cell; } -(void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { //NextViewController *nextController = [[NextViewController alloc] initWithNibName:@"NextView" bundle:nil]; //[self.navigationController pushViewController:nextController animated:YES]; if([contactArray objectAtIndex:indexPath.row] == @"iPhone"){ LandscapeHydrogen *abo = [[LandscapeHydrogen alloc] initWithNibName:@"LandscapeHydrogen" bundle:nil]; [self.navigationController pushViewController:abo animated:NO]; [abo release]; } } Any help is appreciated.

    Read the article

  • JavaFX: File upload to REST service / servlet fails because of missing boundary

    - by spa
    I'm trying to upload a file using JavaFX using the HttpRequest. For this purpose I have written the following function. function uploadFile(inputFile : File) : Void { // check file if (inputFile == null or not(inputFile.exists()) or inputFile.isDirectory()) { return; } def httpRequest : HttpRequest = HttpRequest { location: urlConverter.encodeURL("{serverUrl}"); source: new FileInputStream(inputFile) method: HttpRequest.POST headers: [ HttpHeader { name: HttpHeader.CONTENT_TYPE value: "multipart/form-data" } ] } httpRequest.start(); } On the server side, I am trying to handle the incoming data using the Apache Commons FileUpload API using a Jersey REST service. The code used to do this is a simple copy of the FileUpload tutorial on the Apache homepage. @Path("Upload") public class UploadService { public static final String RC_OK = "OK"; public static final String RC_ERROR = "ERROR"; @POST @Produces("text/plain") public String handleFileUpload(@Context HttpServletRequest request) { if (!ServletFileUpload.isMultipartContent(request)) { return RC_ERROR; } FileItemFactory factory = new DiskFileItemFactory(); ServletFileUpload upload = new ServletFileUpload(factory); List<FileItem> items = null; try { items = upload.parseRequest(request); } catch (FileUploadException e) { e.printStackTrace(); return RC_ERROR; } ... } } However, I get a exception at items = upload.parseRequest(request);: org.apache.commons.fileupload.FileUploadException: the request was rejected because no multipart boundary was found I guess I have to add a manual boundary info to the InputStream. Is there any easy solution to do this? Or are there even other solutions?

    Read the article

  • How to install Zend Framework on Windows

    - by sombe
    "installing Zend Framework is so easy!!!!" yeah right... Ok I'm working with a beginner's book and the ONE thing that is not excessively detailed is the most important part: Installing the darn thing. After browsing the quickstart guide for hours, all it said was: "download Zend [...] add the include directory (bla bla) and YOU'RE DONE!" right, i'm done using Zend. Ok, not really, not yet anyway. I beg of you people, I wanna go to bed, please tell me how (in simple 6th grade detail) to install the framework. I've got the unzipped folder in my htdocs directory, and I placed zf.bat+zf.php in the htdocs root. What's next? thank you so much. EDIT: Thanks guys for all the answers. Unfortunately I haven't been able to work with this or find a good enough resource to explain it to me in plain english. It seems that this framework adheres more so to programmers than to beginners. I've since yesterday read a little on CakePHP and found that it was incredibly easy to install and tune. As oppose to Zend Framework, where I had to dig in my "environment variables", configure "httpd.conf" and almost tie the knot between my computer driver cables to just get it running, CakePHP has already allowed me to put together a nice newbie application. In conclusion, I very much appreciate all of your help. I hope someone else venturing on ZF will be more successful with it. Thanks!

    Read the article

  • rabbitmq-erlang-client, using rebar friendly pkg, works on dev env fails on rebar release

    - by lfurrea
    I am successfully using the rebar-friendly package of rabbitmq-erlang-client for a simple Hello World rebarized and OTP "compliant" app and things work fine on the dev environment. I am able to fire up an erl console and do my application:start(helloworld). and connect to the broker, open up a channel and communicate to queues. However, then I proceed to do rebar generate and it builds up the release just fine, but when I try to fire up from the self contained release package then things suddenly explode. I know rebar releases are known to be an obscure art, but I would like to know what are my options as far as deployment for an app using the rabbitmq-erlang-client. Below you will find the output of the console on the crash: =INFO REPORT==== 18-Dec-2012::16:41:35 === application: session_record exited: {{{badmatch, {error, {'EXIT', {undef, [{amqp_connection_sup,start_link, [{amqp_params_network,<<"guest">>,<<"guest">>,<<"/">>, "127.0.0.1",5672,0,0,0,infinity,none, [#Fun<amqp_auth_mechanisms.plain.3>, #Fun<amqp_auth_mechanisms.amqplain.3>], [],[]}], []}, {supervisor2,do_start_child_i,3, [{file,"src/supervisor2.erl"},{line,391}]}, {supervisor2,handle_call,3, [{file,"src/supervisor2.erl"},{line,413}]}, {gen_server,handle_msg,5, [{file,"gen_server.erl"},{line,588}]}, {proc_lib,init_p_do_apply,3, [{file,"proc_lib.erl"},{line,227}]}]}}}}, [{amqp_connection,start,1, [{file,"src/amqp_connection.erl"},{line,164}]}, {hello_qp,start_link,0,[{file,"src/hello_qp.erl"},{line,10}]}, {session_record_sup,init,1, [{file,"src/session_record_sup.erl"},{line,55}]}, {supervisor_bridge,init,1, [{file,"supervisor_bridge.erl"},{line,79}]}, {gen_server,init_it,6,[{file,"gen_server.erl"},{line,304}]}, {proc_lib,init_p_do_apply,3, [{file,"proc_lib.erl"},{line,227}]}]}, {session_record_app,start,[normal,[]]}} type: permanent

    Read the article

  • Error when loading YAML config files in Rails

    - by ZelluX
    I am configuring Rails with MongoDB, and find a strange problem when paring config/mongo.yml file. config/mongo.yml is generated by executing script/rails generate mongo_mapper:config, and it looks like following: defaults: &defaults host: 127.0.0.1 port: 27017 development: <<: *defaults database: tc_web_development test: <<: *defaults database: tc_web_test From the config file we can see the objects development and test should both have a database field. But when it is parsed and loaded in config/initializers/mongo.db, config = YAML::load(File.read(Rails.root.join('config/mongo.yml'))) puts config.inspect MongoMapper.setup(config, Rails.env) the strange thing comes: the output of puts config.inspect is {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017}, "test"=>{"host"=>"127.0.0.1", "port"=>27017}} which does not contain database attribute. But when I execute the same statements in a plain ruby console, instead of using rails console, mongo.yml is parsed in a right way. {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_development"}, "test"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_test"}} I am wondering what may be the cause of this problem. Any ideas? Thanks.

    Read the article

  • Is learning C++ a good idea?

    - by chang
    The more I hear and read about C++ (e.g. this: http://lwn.net/Articles/249460/), I get the impression, that I'd waste my time learning C++. I some wrote network routing algorithm in C++ for a simulator, and it was a pain (as expected, especially coming from a perl/python/Java background ...). I'm never happy about giving up on some technology, but I would be happy, if I could limit my knowledge of C-family languages to just C, C# and Objective-C (even OS Xs Cocoa, which is huge and takes a lot of time to learn looks like joy compared to C++ ...). Do I need to consider myself dumb or unwilling, just because I'm not partial to the pain involved learning this stuff? Technologies advance and there will be options other than C++, when deciding on implementation languages, or not? And for speed: If speed were that critical, I'd go for a plain C implementation instead, or write C extensions for much more productive languages like ruby or python ... The one-line version of the above: Will C++ stay such a relevant language that every committed programmer should be familiar with it? [ edit / thank you very much for your interesting and useful answers so far .. ] [ edit / .. i am accepting the top-rated answer; thanks again for all answers! ]

    Read the article

  • Parsing the Youtube API with DOM

    - by Kirk
    I'm using the Youtube API and I can retrieve the date information without a problem, but don't know how to retrieve the description information. My Code: <?php $v = "dQw4w9WgXcQ"; $url = "http://gdata.youtube.com/feeds/api/videos/". $v; $doc = new DOMDocument; $doc->load($url); $pub = $doc->getElementsByTagName("published")->item(0)->nodeValue; $desc = $doc->getElementsByTagName("media:description")->item(0)->nodeValue; echo "<b>Video Uploaded:</b> "; echo date( "F jS, Y", strtotime( $pub ) ); echo '<br>'; if (isset ($desc)) { echo "<b>Description:</b> "; echo $desc; echo '<br>'; } ?> Here's a link to the feed: http://gdata.youtube.com/feeds/api/videos/dQw4w9WgXcQ?prettyprint=true And the excerpt of code I don't know how to retrieve data from: <media:group> <media:description type='plain'>Music video by Rick Astley performing Never Gonna Give You Up. (C) 1987 PWL</media:description> </media:group> Thanks in advance.

    Read the article

  • C++ & proper TDD

    - by Kotti
    Hi! I recently tried developing a small-sized project in C# and during the whole project our team used the Test-Driven-Development (TDD) technique (xunit, moq). I really think this was awesome, because (when paired with C#) this approach allowed to relax when coding, relax when projecting and relax when refactoring. I suspect that all this TDD-stuff actually simplifies the coding process and, well, it allowed (eventually, for me) to get the same result with fewer brain cells working. Right after that I tried using TDD paired with C++ (I used Google Test and Google Mock libraries), and, I don't know why but I actually think that TDD here was a step back in terms of rapid application development. I had some moments when I had to spend huge amounts of time thinking of my tests, building proper mocks, rebuilding them and swearing at my monitor. And, well, I obviously can't ask something like "what I did wrong?" or "what was wrong in my approach?", because I don't know what to describe. But if there are any people who are used to TDD in C++ (and, probably C#) too, could you please advise me how to do this properly. Framework recommendations, architecture approaches, plain coding advices - if you are experienced in TDD & C++, please respond.

    Read the article

  • Endianness and C API's: Specifically OpenSSL.

    - by Hassan Syed
    I have an algorithm that uses the following OpenSSL calls: HMAC_update() / HMAC_final() // ripe160 EVP_CipherUpdate() / EVP_CipherFinal() // cbc_blowfish These algorithm take a unsigned char * into the "plain text". My input data is comes from a C++ std::string::c_str() which originate from a protocol buffer object as a encoded UTF-8 string. UTF-8 strings are meant to be endian neutrial. However I'm a bit paranoid about how OpenSSL may perform operations on the data. My understanding is that encryption algorithms work on 8-bit blocks of data, and if a unsigned char * is used for pointer arithmetic when the operations are performed the algorithms should be endian neutral and I do not need to worry about anything. My uncertainty is compounded by the fact that I am working on a little-endian machine and have never done any real cross-architecture programming. My beliefs/reasoning are/is based on the following two properties std::string (not wstring) internally uses a 8-bit ptr and a the resulting c_str() ptr will itterate the same way regardless of the CPU architecture. Encryption algorithms are either by design, or by implementation, endian neutral. I know the best way to get a definitive answer is to use QEMU and do some cross-platform unit tests (which I plan to do). My question is a request for comments on my reasoning, and perhaps will assist other programmers when faced with similar problems.

    Read the article

  • How do I create a hyperlink in java?

    - by Justin984
    I'm going through the google app engine tutorials at https://developers.google.com/appengine/docs/java/gettingstarted/usingusers I'm very new to google app engine, java and web programming in general. So my question is, at the bottom of the page it says to add a link to allow the user to log out. So far I've got this: public void doGet(HttpServletRequest req, HttpServletResponse resp) throws IOException { UserService userService = UserServiceFactory.getUserService(); User user = userService.getCurrentUser(); if(user != null){ resp.setContentType("text/plain"); resp.getWriter().println("Hello, " + user.getNickname()); String logoutLink = String.format("<a href=\"%s\">Click here to log out.</a>", userService.createLogoutURL(req.getRequestURI())); resp.getWriter().println(logoutLink); }else { resp.sendRedirect(userService.createLoginURL(req.getRequestURI())); } } However instead of a link, the full string is printed to the screen including the tags. When I look at the page source, I have no tags or any of the other stuff that goes with a webpage. I guess that makes sense considering I've done nothing to output any of that. Do I just do a bunch of resp.GetWriter().println() statements to output the rest of the webpage, or is there something else I don't know about? Thanks!

    Read the article

  • Using DotNetOpenAuth AccessToken for uploading docx file to google

    - by PrashantC
    Hi , I am using DotNetOpenAuth Package, I am trying to upload a package to google docs, Using client credentials i am able to do it successfully using following code, DocumentEntry objDocumentEntry = new DocumentEntry(); objDocumentsService.setUserCredentials(strUserName,strPassWord); string strAuthenticationToken = objDocumentsService.QueryAuthenticationToken(); objDocumentEntry = objDocumentsService.UploadDocument(Server.MapPath("test.docx"), "New Name"); I want achieve save with plain oAuth, I am having following code written for it, if (this.TokenManager != null) { if (!IsPostBack) { var google = new WebConsumer(GoogleConsumer.ServiceDescription, this.TokenManager); // Is Google calling back with authorization? var accessTokenResponse = google.ProcessUserAuthorization(); if (accessTokenResponse != null) { this.AccessToken = accessTokenResponse.AccessToken; } else if (this.AccessToken == null) { // If we don't yet have access, immediately request it. GoogleConsumer.RequestAuthorization(google, GoogleConsumer.Applications.DocumentsList); } } } I successfully get "AccessToken", But i am not sure how to use it.. Do we need to exchange this token? what excatly to do with this token? Is it a sessionToken? Please provide some inputs, I am badly stuck with this problem from last 3 days, Prashant C

    Read the article

  • How to send XML and other post parameters via cURL in PHP

    - by tomaszs
    Hello. I've used code below to send XML to my REST API. $xml_string_data contains proper XML, and it is passed well to mypi.php: //set POST variables $url = 'http://www.server.cu/mypi.php'; $fields = array( 'data'=>urlencode($xml_string_data) ); //url-ify the data for the POST $fields_string = ""; foreach($fields as $key=>$value) { $fields_string .= $key.'='.$value.'&'; } rtrim($fields_string,'&'); echo $fields_string; //open connection $ch = curl_init(); curl_setopt($ch,CURLOPT_URL,$url); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch,CURLOPT_POST,count($fields)); curl_setopt($ch,CURLOPT_POSTFIELDS,$fields_string); curl_setopt($ch,CURLOPT_HTTPHEADER,array ( "Expect: " )); //execute post $result = @curl_exec($ch); But when I've added other field: $fields = array( 'method' => "methodGoPay", 'data'=>urlencode($xml_string_data) ); It stopped to work. On the mypi.php I don't recieve any more POST parameters at all! Could you you please tell me what to do to send XML and other post parameters in one cURL request? Please don't suggest using any libraries, I wan't to acomplish it in plain PHP.

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Javascript + PHP $_POST array empty

    - by Peterim
    While trying to send a POST request via xmlhttp.open("POST", "url", true) (javascript) to the server I get an empty $_POST array. Firebug shows that the data is being sent. Here is the data string from Firebug: a=1&q=151a45a150.... But $_POST['q'] returns nothing. The interesting thing is that file_get_contents('php://input') does have my data (the string above), but PHP somehow doesn't recognize it. Tried both $_POST and $_REQUEST, nothing works. Headers being sent: POST /test.php HTTP/1.1 Host: website.com User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3 Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Accept-Language: en-us;q=0.7,en;q=0.3 Accept-Encoding: gzip,deflate Accept-Charset: utf-8;q=0.7,*;q=0.7 Keep-Alive: 115 Connection: keep-alive Referer: http://website.com/ Content-Length: 156 Content-Type: text/plain; charset=UTF-8 Pragma: no-cache Cache-Control: no-cache Thank you for any suggestions.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Create new or update existing entity at one go with JPA

    - by Alex R
    A have a JPA entity that has timestamp field and is distinguished by a complex identifier field. What I need is to update timestamp in an entity that has already been stored, otherwise create and store new entity with the current timestamp. As it turns out the task is not as simple as it seems from the first sight. The problem is that in concurrent environment I get nasty "Unique index or primary key violation" exception. Here's my code: // Load existing entity, if any. Entity e = entityManager.find(Entity.class, id); if (e == null) { // Could not find entity with the specified id in the database, so create new one. e = entityManager.merge(new Entity(id)); } // Set current time... e.setTimestamp(new Date()); // ...and finally save entity. entityManager.flush(); Please note that in this example entity identifier is not generated on insert, it is known in advance. When two or more of threads run this block of code in parallel, they may simultaneously get null from entityManager.find(Entity.class, id) method call, so they will attempt to save two or more entities at the same time, with the same identifier resulting in error. I think that there are few solutions to the problem. Sure I could synchronize this code block with a global lock to prevent concurrent access to the database, but would it be the most efficient way? Some databases support very handy MERGE statement that updates existing or creates new row if none exists. But I doubt that OpenJPA (JPA implementation of my choice) supports it. Event if JPA does not support SQL MERGE, I can always fall back to plain old JDBC and do whatever I want with the database. But I don't want to leave comfortable API and mess with hairy JDBC+SQL combination. There is a magic trick to fix it using standard JPA API only, but I don't know it yet. Please help.

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >