Search Results

Search found 3004 results on 121 pages for 'plain'.

Page 94/121 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • Read IFrame content using JavaScript

    - by Rajat
    Ok, This is my first time dealing seriously with IFrames and I cant seem to understand a few things: First the sample code I am testing with: <head> <script type="text/javascript"> function init(){ console.log("IFrame content: " + window.frames['i1'].document.getElementsByTagName('body')[0].innerHTML); } </script> </head> <body onload="init();"> <iframe name="i1" src="foo.txt"/> </body> the file "foo.txt" looks like this: sample text file Questions: 1) The iframe seems to be behaving as a HTML document and the file text is actually part of the body instead. Why ? Is it a rule for an IFrame to be a HTML document. Is it not possible for the content of an iframe to be just plain text ?? 2) The file content gets wrapped inside a pre tag for some reason. Why is this so ? Is it always the case? 3) My access method in the javascript is working but is there any other alternative? [native js solutions please] If the content is wrapped in a pre tag always then I will actually have to lookup inside the pre tag rather than lookup the innerHTML

    Read the article

  • How can you push a new view with a grouped table?

    - by Tanner
    Hi All, Ive been trying to push a new view when a cell is tapped but absolutely nothing happens. I figured grouped style pushed the same as plain. Here is my code: -(void)viewDidLoad { [super viewDidLoad]; contactArray = [[NSArray alloc] initWithObjects:@"iPhone",@"iPod",@"MacBook",@"MacBook Pro",nil]; shareArray = [[NSArray alloc] initWithObjects:@"Flex",@"AIR",@"PhotoShop",@"Flash",nil]; } -(NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 2; } // Customize the number of rows in the table view. -(NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { if(section == 0) return [contactArray count]; else return [shareArray count]; } -(NSString *)tableView:(UITableView *)tableView titleForHeaderInSection:(NSInteger)section{ if(section == 0){ return @"Contact"; }else{ return @"Share"; } } -(NSString *)tableView:(UITableView *)tableView titleForFooterInSection:(NSInteger)section{ if(section == 0){ return @"Footer for Apple Products"; }else{ return @"Footer for Adobe Softwares"; } } // Customize the appearance of table view cells. -(UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; } // Set up the cell... if(indexPath.section == 0){ cell.text = [contactArray objectAtIndex:indexPath.row]; }else{ cell.text = [shareArray objectAtIndex:indexPath.row]; } return cell; } -(void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { //NextViewController *nextController = [[NextViewController alloc] initWithNibName:@"NextView" bundle:nil]; //[self.navigationController pushViewController:nextController animated:YES]; if([contactArray objectAtIndex:indexPath.row] == @"iPhone"){ LandscapeHydrogen *abo = [[LandscapeHydrogen alloc] initWithNibName:@"LandscapeHydrogen" bundle:nil]; [self.navigationController pushViewController:abo animated:NO]; [abo release]; } } Any help is appreciated.

    Read the article

  • wmd editor, why does it keep showing html instead of just going straight to markup

    - by Ke
    hi, im wondering how wmd is supposed to work, when i type in the textarea the text doesnt have html, but once the text is stored in db it turns to html. wmd also shows all this html when reloading the content? is it supposed to work like this? Do I have to sanitize the text before its put into the db? if so how? I thought wmd doesnt deal with html? except in code blocks. Also there are p tags being added Using the beneath html it gets added directly. I guess this could cause xss attacks? - (1) <a onmouseover="alert(1)" href="#">read this!</a> - (2) <p <script>alert(1)</script>hello - (3) </td <script>alert(1)</script>hello I wonder how is wmd supposed to work? I thought it was supposed to enter everything in its own mark up, store its on mark up and retrieve it etc. instead of storing plain html Chees Ke

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • How to insert an element between the two elements dynamically?

    - by Harish
    I am using a table, in which there are buttons, on button click i want the new TR element to be inserted between the two TR or at the end of the TR... my code goes here <table> <tbody> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> </tbody> </table> i want to insert new TR element next to the element which has triggered the event... NOTE: i am not using any javascript library, just plain javascript

    Read the article

  • How to install Zend Framework on Windows

    - by sombe
    "installing Zend Framework is so easy!!!!" yeah right... Ok I'm working with a beginner's book and the ONE thing that is not excessively detailed is the most important part: Installing the darn thing. After browsing the quickstart guide for hours, all it said was: "download Zend [...] add the include directory (bla bla) and YOU'RE DONE!" right, i'm done using Zend. Ok, not really, not yet anyway. I beg of you people, I wanna go to bed, please tell me how (in simple 6th grade detail) to install the framework. I've got the unzipped folder in my htdocs directory, and I placed zf.bat+zf.php in the htdocs root. What's next? thank you so much. EDIT: Thanks guys for all the answers. Unfortunately I haven't been able to work with this or find a good enough resource to explain it to me in plain english. It seems that this framework adheres more so to programmers than to beginners. I've since yesterday read a little on CakePHP and found that it was incredibly easy to install and tune. As oppose to Zend Framework, where I had to dig in my "environment variables", configure "httpd.conf" and almost tie the knot between my computer driver cables to just get it running, CakePHP has already allowed me to put together a nice newbie application. In conclusion, I very much appreciate all of your help. I hope someone else venturing on ZF will be more successful with it. Thanks!

    Read the article

  • PHP weirdness extending IMagick class

    - by Jamie Carl
    This is a really weird one. I have some code that is happily working on version 2.1.1RC1 of the php5-imagick module. It's basically just a class I wrote that extends the Imagick class and manages images stored in a database. Since upgrading to version 3.0.0RC1 (thankfully only on my dev box) things have gone to hell. It seems that object members are writeable but are NOT readable. Take the following sample code: class db_image extends IMagick { private $data; function __construct( $id = null ){ parent::__construct(); $this->data = 'some plain text'; echo $this->data; } This will output absolutely NOTHING. My debugger indicates that the contents of $this-data are the correct string value, but I am unable to read the value back out of the member variable. Seriously. WTF? Does anyone know what is causing this or has seen it before? I don't even know how to replicate this behaviour in my own classes.

    Read the article

  • C++: is it safe to work with std::vectors as if they were arrays?

    - by peoro
    I need to have a fixed-size array of elements and to call on them functions that require to know about how they're placed in memory, in particular: functions like glVertexPointer, that needs to know where the vertices are, how distant they are one from the other and so on. In my case vertices would be members of the elements to store. to get the index of an element within this array, I'd prefer to avoid having an index field within my elements, but would rather play with pointers arithmetic (ie: index of Element *x will be x - & array[0]) -- btw, this sounds dirty to me: is it good practice or should I do something else? Is it safe to use std::vector for this? Something makes me think that an std::array would be more appropriate but: Constructor and destructor for my structure will be rarely called: I don't mind about such overhead. I'm going to set the std::vector capacity to size I need (the size that would use for an std::array, thus won't take any overhead due to sporadic reallocation. I don't mind a little space overhead for std::vector's internal structure. I could use the ability to resize the vector (or better: to have a size chosen during setup), and I think there's no way to do this with std::array, since its size is a template parameter (that's too bad: I could do that even with an old C-like array, just dynamically allocating it on the heap). If std::vector is fine for my purpose I'd like to know into details if it will have some runtime overhead with respect to std::array (or to a plain C array): I know that it'll call the default constructor for any element once I increase its size (but I guess this won't cost anything if my data has got an empty default constructor?), same for destructor. Anything else?

    Read the article

  • Create new or update existing entity at one go with JPA

    - by Alex R
    A have a JPA entity that has timestamp field and is distinguished by a complex identifier field. What I need is to update timestamp in an entity that has already been stored, otherwise create and store new entity with the current timestamp. As it turns out the task is not as simple as it seems from the first sight. The problem is that in concurrent environment I get nasty "Unique index or primary key violation" exception. Here's my code: // Load existing entity, if any. Entity e = entityManager.find(Entity.class, id); if (e == null) { // Could not find entity with the specified id in the database, so create new one. e = entityManager.merge(new Entity(id)); } // Set current time... e.setTimestamp(new Date()); // ...and finally save entity. entityManager.flush(); Please note that in this example entity identifier is not generated on insert, it is known in advance. When two or more of threads run this block of code in parallel, they may simultaneously get null from entityManager.find(Entity.class, id) method call, so they will attempt to save two or more entities at the same time, with the same identifier resulting in error. I think that there are few solutions to the problem. Sure I could synchronize this code block with a global lock to prevent concurrent access to the database, but would it be the most efficient way? Some databases support very handy MERGE statement that updates existing or creates new row if none exists. But I doubt that OpenJPA (JPA implementation of my choice) supports it. Event if JPA does not support SQL MERGE, I can always fall back to plain old JDBC and do whatever I want with the database. But I don't want to leave comfortable API and mess with hairy JDBC+SQL combination. There is a magic trick to fix it using standard JPA API only, but I don't know it yet. Please help.

    Read the article

  • Error when loading YAML config files in Rails

    - by ZelluX
    I am configuring Rails with MongoDB, and find a strange problem when paring config/mongo.yml file. config/mongo.yml is generated by executing script/rails generate mongo_mapper:config, and it looks like following: defaults: &defaults host: 127.0.0.1 port: 27017 development: <<: *defaults database: tc_web_development test: <<: *defaults database: tc_web_test From the config file we can see the objects development and test should both have a database field. But when it is parsed and loaded in config/initializers/mongo.db, config = YAML::load(File.read(Rails.root.join('config/mongo.yml'))) puts config.inspect MongoMapper.setup(config, Rails.env) the strange thing comes: the output of puts config.inspect is {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017}, "test"=>{"host"=>"127.0.0.1", "port"=>27017}} which does not contain database attribute. But when I execute the same statements in a plain ruby console, instead of using rails console, mongo.yml is parsed in a right way. {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_development"}, "test"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_test"}} I am wondering what may be the cause of this problem. Any ideas? Thanks.

    Read the article

  • wsgi django not working

    - by MaKo
    im installing django, the test for wsgi is ok, but when i point my default file to the django test, it doesnt work, this is the test that works fine: default: /etc/apache2/sites-available/default <VirtualHost *:80> ServerName www.example.com ServerAlias example.com ServerAdmin [email protected] DocumentRoot /var/www <Directory /var/www/documents> Order allow,deny Allow from all </Directory> WSGIScriptAlias / /home/ubuntu/djangoProj/micopiloto/application.wsgi <Directory /home/ubuntu/djangoProj/mysitio/wsgi_handler.py> Order allow,deny Allow from all </Directory> </VirtualHost> application.wsgi:: ~/djangoProj/micopiloto import os import sys sys.path.append('/srv/www/cucus/application') os.environ['PYTHON_EGG_CACHE'] = '/srv/www/cucus/.python-egg' def application(environ, start_response): status = '200 OK' output = 'Hello World!MK SS9 tkt kkk' response_headers = [('Content-type', 'text/plain'), ('Content-Length', str(len(output)))] start_response(status, response_headers) return [output] but if I change the default to point to application_sa.wsgi the django test, it doesnt work :( application_sa.wsgi import os, sys sys.path.append('/home/ubuntu/djangoProj/micopiloto') os.environ['DJANGO_SETTINGS_MODULE'] = 'micopiloto.settings' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() I restart the apache server every time i change the wsgi to test, so what im i missing? thanks a lot!

    Read the article

  • C++ & proper TDD

    - by Kotti
    Hi! I recently tried developing a small-sized project in C# and during the whole project our team used the Test-Driven-Development (TDD) technique (xunit, moq). I really think this was awesome, because (when paired with C#) this approach allowed to relax when coding, relax when projecting and relax when refactoring. I suspect that all this TDD-stuff actually simplifies the coding process and, well, it allowed (eventually, for me) to get the same result with fewer brain cells working. Right after that I tried using TDD paired with C++ (I used Google Test and Google Mock libraries), and, I don't know why but I actually think that TDD here was a step back in terms of rapid application development. I had some moments when I had to spend huge amounts of time thinking of my tests, building proper mocks, rebuilding them and swearing at my monitor. And, well, I obviously can't ask something like "what I did wrong?" or "what was wrong in my approach?", because I don't know what to describe. But if there are any people who are used to TDD in C++ (and, probably C#) too, could you please advise me how to do this properly. Framework recommendations, architecture approaches, plain coding advices - if you are experienced in TDD & C++, please respond.

    Read the article

  • Javascript + PHP $_POST array empty

    - by Peterim
    While trying to send a POST request via xmlhttp.open("POST", "url", true) (javascript) to the server I get an empty $_POST array. Firebug shows that the data is being sent. Here is the data string from Firebug: a=1&q=151a45a150.... But $_POST['q'] returns nothing. The interesting thing is that file_get_contents('php://input') does have my data (the string above), but PHP somehow doesn't recognize it. Tried both $_POST and $_REQUEST, nothing works. Headers being sent: POST /test.php HTTP/1.1 Host: website.com User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3 Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Accept-Language: en-us;q=0.7,en;q=0.3 Accept-Encoding: gzip,deflate Accept-Charset: utf-8;q=0.7,*;q=0.7 Keep-Alive: 115 Connection: keep-alive Referer: http://website.com/ Content-Length: 156 Content-Type: text/plain; charset=UTF-8 Pragma: no-cache Cache-Control: no-cache Thank you for any suggestions.

    Read the article

  • Endianness and C API's: Specifically OpenSSL.

    - by Hassan Syed
    I have an algorithm that uses the following OpenSSL calls: HMAC_update() / HMAC_final() // ripe160 EVP_CipherUpdate() / EVP_CipherFinal() // cbc_blowfish These algorithm take a unsigned char * into the "plain text". My input data is comes from a C++ std::string::c_str() which originate from a protocol buffer object as a encoded UTF-8 string. UTF-8 strings are meant to be endian neutrial. However I'm a bit paranoid about how OpenSSL may perform operations on the data. My understanding is that encryption algorithms work on 8-bit blocks of data, and if a unsigned char * is used for pointer arithmetic when the operations are performed the algorithms should be endian neutral and I do not need to worry about anything. My uncertainty is compounded by the fact that I am working on a little-endian machine and have never done any real cross-architecture programming. My beliefs/reasoning are/is based on the following two properties std::string (not wstring) internally uses a 8-bit ptr and a the resulting c_str() ptr will itterate the same way regardless of the CPU architecture. Encryption algorithms are either by design, or by implementation, endian neutral. I know the best way to get a definitive answer is to use QEMU and do some cross-platform unit tests (which I plan to do). My question is a request for comments on my reasoning, and perhaps will assist other programmers when faced with similar problems.

    Read the article

  • JavaScript automatically converts some special characters

    - by noplacetoh1de
    I need to extract a HTML-Substring with JS which is position dependent. I store special characters HTML-encoded. For example: HTML <div id="test"><p>l&ouml;sen &amp; gr&uuml;&szlig;en</p></div>? Text lösen & grüßen My problem lies in the JS-part, for example when I try to extract the fragment lö, which has the HTML-dependent starting position of 3 and the end position of 9 inside the <div> block. JS seems to convert some special characters internally so that the count from 3 to 9 is wrongly interpreted as "lösen " and not "l&ouml;". Other special characters like the &amp; are not affected by this. So my question is, if someone knows why JS is behaving in that way? Characters like &auml; or &ouml; are being converted while characters like &amp; or &nbsp; are plain. Is there any possibility to avoid this conversion? I've set up a fiddle to demonstrate this: JSFiddle Thanks for any help! EDIT: Maybe I've explained it a bit confusing, sorry for that. What I want is the HTML: <p>l&ouml;sen &amp; gr&uuml;&szlig;en</p> . Every special character should be unconverted, except the HTML-Tags. Like in the HTML above. But JS converts the &ouml; or &uuml; into ö or ü automatically, what I need to avoid.

    Read the article

  • Using DotNetOpenAuth AccessToken for uploading docx file to google

    - by PrashantC
    Hi , I am using DotNetOpenAuth Package, I am trying to upload a package to google docs, Using client credentials i am able to do it successfully using following code, DocumentEntry objDocumentEntry = new DocumentEntry(); objDocumentsService.setUserCredentials(strUserName,strPassWord); string strAuthenticationToken = objDocumentsService.QueryAuthenticationToken(); objDocumentEntry = objDocumentsService.UploadDocument(Server.MapPath("test.docx"), "New Name"); I want achieve save with plain oAuth, I am having following code written for it, if (this.TokenManager != null) { if (!IsPostBack) { var google = new WebConsumer(GoogleConsumer.ServiceDescription, this.TokenManager); // Is Google calling back with authorization? var accessTokenResponse = google.ProcessUserAuthorization(); if (accessTokenResponse != null) { this.AccessToken = accessTokenResponse.AccessToken; } else if (this.AccessToken == null) { // If we don't yet have access, immediately request it. GoogleConsumer.RequestAuthorization(google, GoogleConsumer.Applications.DocumentsList); } } } I successfully get "AccessToken", But i am not sure how to use it.. Do we need to exchange this token? what excatly to do with this token? Is it a sessionToken? Please provide some inputs, I am badly stuck with this problem from last 3 days, Prashant C

    Read the article

  • php automatically commented with apache

    - by clement
    We have installed apache 2.2, and activeperl to run bugzilla, all that on a Windows Server 2003. Here We want to install PHP on the server to install a wiki. I followed those steps: tutorial to install PHP and enable it from Apache. After all those steps, I restart couples of times, and When I try a simple phpinfo() on PHP, the whole PHP code is commented: < ! - - ?php phpinfo(); ? - - Now, the httpd.conf was already edited for the PERL and it can be those edits that make the mistake. Here is the whole httpd.conf file: ServerRoot "C:/Program Files/Apache Software Foundation/Apache2.2" Listen 6969 LoadModule actions_module modules/mod_actions.so LoadModule alias_module modules/mod_alias.so LoadModule asis_module modules/mod_asis.so LoadModule auth_basic_module modules/mod_auth_basic.so LoadModule php5_module "c:/php/php5apache2_2.dll" LoadModule authn_default_module modules/mod_authn_default.so LoadModule authn_file_module modules/mod_authn_file.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_host_module modules/mod_authz_host.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule autoindex_module modules/mod_autoindex.so LoadModule cgi_module modules/mod_cgi.so LoadModule dir_module modules/mod_dir.so LoadModule env_module modules/mod_env.so LoadModule include_module modules/mod_include.so LoadModule isapi_module modules/mod_isapi.so LoadModule log_config_module modules/mod_log_config.so LoadModule mime_module modules/mod_mime.so LoadModule negotiation_module modules/mod_negotiation.so LoadModule setenvif_module modules/mod_setenvif.so User daemon Group daemon ServerAdmin [email protected] DocumentRoot C:/bugzilla-4.4.2/ Options FollowSymLinks AllowOverride None Order deny,allow Deny from all Options Indexes FollowSymLinks ExecCGI AllowOverride All Order allow,deny Allow from all ScriptInterpreterSource Registry-Strict DirectoryIndex index.html index.html.var index.cgi index.php Order allow,deny Deny from all Satisfy All ErrorLog "logs/error.log" LogLevel warn LogFormat "%h %l %u %t \"%r\" %s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %s %b" common <IfModule logio_module> LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> ScriptAlias /cgi-bin/ "C:/Program Files/Apache Software Foundation/Apache2.2/cgi-bin/" AllowOverride None Options None Order allow,deny Allow from all DefaultType text/plain AddType application/x-compress .Z AddType application/x-gzip .gz .tgz AddHandler cgi-script .cgi AddType application/x-httpd-php .php SSLRandomSeed startup builtin SSLRandomSeed connect builtin PHPIniDir "c:/php"

    Read the article

  • Should a developer be a coauthor to a paper presented about the application they developed?

    - by ved
    In our organization, project teams come up with a need and funding and developers are given a basic scope and are allowed to develop the solution. There is a certain degree of implementation freedom given to the developers. They drive the solution to pilot and live deployment from its inception. If the solution is presented in a conference as a technical paper/white paper what is the protocol for the list of authors: because for the most part I see the project manager's and the dev team manager's names as authors but no mention of the actual developer. Is this correct? A lot of us developers feel pretty bummed to never see our names as the coauthors. Appreciate any pointers. Answers to the FOLLOW UP questions (1) in what field of study is the paper, and what are the standards of authorship for that field? The paper is for Flood Plain Management - there is nothing on the abstract guidelines, I have called the contact person listed for comment - waiting to hear. 2) was the paper literally about the software application as your question implies, or were the software issues incidental to the topic of the paper? The paper specifically deals with a GIS Application that is used in Coastal Engineering, yes the software is not incidental, but the meat of the paper and mentioned in the Title. 2

    Read the article

  • Is learning C++ a good idea?

    - by chang
    The more I hear and read about C++ (e.g. this: http://lwn.net/Articles/249460/), I get the impression, that I'd waste my time learning C++. I some wrote network routing algorithm in C++ for a simulator, and it was a pain (as expected, especially coming from a perl/python/Java background ...). I'm never happy about giving up on some technology, but I would be happy, if I could limit my knowledge of C-family languages to just C, C# and Objective-C (even OS Xs Cocoa, which is huge and takes a lot of time to learn looks like joy compared to C++ ...). Do I need to consider myself dumb or unwilling, just because I'm not partial to the pain involved learning this stuff? Technologies advance and there will be options other than C++, when deciding on implementation languages, or not? And for speed: If speed were that critical, I'd go for a plain C implementation instead, or write C extensions for much more productive languages like ruby or python ... The one-line version of the above: Will C++ stay such a relevant language that every committed programmer should be familiar with it? [ edit / thank you very much for your interesting and useful answers so far .. ] [ edit / .. i am accepting the top-rated answer; thanks again for all answers! ]

    Read the article

  • How to (kindly) ask your users to upgrade from IE6?

    - by nickf
    It's no secret at all that IE6 has been a major roadblock to the advancement of the web over the last few years. I couldn't count the number of hours I've spent bashing my head against a wall trying to fix or debug IE6 issues. The way I see it, there are two types of IE6 user. a) the poor corporate schmoe whose IT department doesn't want to upgrade in case something breaks, and b) the mums and dads of the world who think the internet is the blue E on their desktop (and I don't mean that in a nasty way). There's probably a couple of people who know about all the other browsers, but still choose to run IE6. They get what they deserve, IMO. Anyway, getting to the point, I'd say that 90% of my IE6-using visitors are in the the mums and dads category - they're not stupid, they just don't know WHY they should upgrade to IE7 or Firefox or whatever. How do I educate these people without pissing them off? Is there a nice and friendly website I can direct these people to, which explains the reasons for upgrading in plain language? Any mention of "security" or "web standards" I think would just come across as scary. I've just seen http://www.whatbrowser.org which seems to fit the bill nicely. It explains in very basic terms: what a web browser is why you'd want to upgrade it how old your current browser is (subtle hint to those with a 9 year old browser) ..aaaand it's in 22 languages. It's from Google but displays no bias (it links to Firefox, Chrome, Opera, Safari, Internet Explorer displayed in a random order).

    Read the article

  • PHP/Javascript limiting amount of checkboxes

    - by Carl294
    Hi everyone Im trying to limit the amount of checkboxes that can be checked, in this case only 3 can be checked. When using plain HTML this works fine. The code can be seen below. HTML example <td ><input type=checkbox name=ckb value=2 onclick='chkcontrol()';></td><td>Perl</td> Javascript Function <script type="text/javascript"> function chkcontrol(j) { var total=0; for(var i=0; i < document.form1.ckb.length; i++){ if(document.form1.ckb[i].checked){ total =total +1;} if(total > 3){ alert("Please Select only three") document.form1.ckb[j].checked = false; return false; } } } </script> The problem appears when replacing the fixed HTML values with values from a MYSQL database. All the information appears correctly, and can be posted to another page via a submit button. However, it seems like the 'value' assigned to each record from the database is not making its way too the javascript function. <td><input name="checkbox[]" type="checkbox" value="<?php echo $rows['TCA_QID'];?>" onclick="chkcontrol();"></td> I have tried changed the name in the javascript function to match the 'checkbox' name.Any advice would be greatly appreciated Thanks

    Read the article

  • Java: how do I get a class literal from a generic type?

    - by Tom
    Typically, I've seen people use the class literal like this: Class<Foo> cls = Foo.class; But what if the type is generic, e.g. List? This works fine, but has a warning since List should be parameterized: Class<List> cls = List.class So why not add a <?>? Well, this causes a type mismatch error: Class<List<?>> cls = List.class I figured something like this would work, but this is just a plain ol' a syntax error: Class<List<Foo>> cls = List<Foo>.class How can I get a Class<List<Foo>> statically, e.g. using the class literal? I could use @SuppressWarnings("unchecked") to get rid of the warnings caused by the non-parameterized use of List in the first example, Class<List> cls = List.class, but I'd rather not. Any suggestions? Thanks!

    Read the article

  • Fastest XML parser for small, simple documents in Java

    - by Varkhan
    I have to objectify very simple and small XML documents (less than 1k, and it's almost SGML: no namespaces, plain UTF-8, you name it...), read from a stream, in Java. I am using JAXP to process the data from my stream into a Document object. I have tried Xerces, it's way too big and slow... I am using Dom4j, but I am still spending way too much time in org.dom4j.io.SAXReader. Does anybody out there have any suggestion on a faster, more efficient implementation, keeping in mind I have very tough CPU and memory constraints? [Edit 1] Keep in mind that my documents are very small, so the overhead of staring the parser can be important. For instance I am spending as much time in org.xml.sax.helpers.XMLReaderFactory.createXMLReader as in org.dom4j.io.SAXReader.read [Edit 2] The result has to be in Dom format, as I pass the document to decision tools that do arbitrary processing on it, like switching code based on the value of arbitrary XPaths, but also extracting lists of values packed as children of a predefined node. [Edit 3] In any case I eventually need to load/parse the complete document, since all the information it contains is going to be used at some point. (This question is related to, but different from, http://stackoverflow.com/questions/373833/best-xml-parser-for-java )

    Read the article

  • On C++ global operator new: why it can be replaced

    - by Jimmy
    I wrote a small program in VS2005 to test whether C++ global operator new can be overloaded. It can. #include "stdafx.h" #include "iostream" #include "iomanip" #include "string" #include "new" using namespace std; class C { public: C() { cout<<"CTOR"<<endl; } }; void * operator new(size_t size) { cout<<"my overload of global plain old new"<<endl; // try to allocate size bytes void *p = malloc(size); return (p); } int main() { C* pc1 = new C; cin.get(); return 0; } In the above, my definition of operator new is called. If I remove that function from the code, then operator new in C:\Program Files (x86)\Microsoft Visual Studio 8\VC\crt\src\new.cpp gets called. All is good. However, in my opinion, my implementations of operator new does NOT overload the new in new.cpp, it CONFLICTS with it and violates the one-definition rule. Why doesn't the compiler complain about it? Or does the standard say since operator new is so special, one-definition rule does not apply here? Thanks.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >