Search Results

Search found 10383 results on 416 pages for 'exact match'.

Page 98/416 | < Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >

  • C# comparing two files regex problem.

    - by Mike
    Hi everyone, what I'm trying to do is open a huge list of files (about 40k records, and match them on a line in a file that contains 2 millions records. And if my line from file A matches a line in file B write out that line. File A contains a bunch of files without extensions and file B contains full file paths including extensions. i'm using this but i cant get it to go... string alphaFilePath = (@"C:\Documents and Settings\g\Desktop\Arrp\Find\natst_ready.txt"); List<string> alphaFileContent = new List<string>(); using (FileStream fs = new FileStream(alphaFilePath, FileMode.Open)) using (StreamReader rdr = new StreamReader(fs)) { while (!rdr.EndOfStream) { alphaFileContent.Add(rdr.ReadLine()); } } string betaFilePath = @"C:\Documents and Settings\g\Desktop\Arryup\Find\eble.txt"; StringBuilder sb = new StringBuilder(); using (FileStream fs = new FileStream(betaFilePath, FileMode.Open)) using (StreamReader rdr = new StreamReader(fs)) { while (!rdr.EndOfStream) { string betaFileLine = rdr.ReadLine(); string matchup = Regex.Match(alphaFileContent, @"(\\)(\\)(\\)(\\)(\\)(\\)(\\)(\\)(.*)(\.)").Groups[9].Value; if (alphaFileContent.Equals(matchup)) { File.AppendAllText(@"C:\array_tech.txt", betaFileLine); } } } This doesnt work because the alphafilecontent is a single line only and i'm having a hard time figuring out how to get my regex to work on the file that contains all the file paths (Betafilepath) here is a sample of the beta file path. C:\arres_i\Grn\Ora\SEC\DBZ_EX1\Nes\001\DZO-EX00001.txt Here is the line i'm trying to compare from my alpha DZO-EX00001

    Read the article

  • Uncommitted reads in SSIS

    - by OldBoy
    I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Basic question in XSL regarding preceding text

    - by Rachel
    I am new to XSL and i have a basic question on the context of using preceding text. My template match is on the text node. I am iterating over an xml file and within my for loop i am trying to take the preceding text of the text node. Unfortunately preceding::text() is not working if i use it within a for loop. I want to use it within the for loop but how can do it? <xsl:template match="text()"> <xsl:variable name="this" as="text()" select="."/> <xsl:for-each select="$input[@id = generate-id(current())]"> <xsl:variable name="preText" as="xsd:integer" select="sum(preceding::text()[. >> //*[@id=@name]]/string-length(.))"/> ... ... </xsl:for-each> </xsl:template>

    Read the article

  • Why this C# Regular Expression crashes my program?

    - by robert_d
    using System; using System.IO; using System.Net; using System.Text.RegularExpressions; namespace Working { class Program4 { static string errorurl = "http://www.realtor.ca/propertyDetails.aspx?propertyId=8692663"; static void Main(string[] args) { string s; s = getWebpageContent(errorurl); s = removeNewLineCharacters(s); getFields(s); Console.WriteLine("End"); } public static void getFields(string html) { Match m; string fsRE = @"ismeasurement.*?>.*?(\d+).*?sqft"; m = Regex.Match(html, fsRE, RegexOptions.IgnoreCase); } private static string removeNewLineCharacters(string str) { string[] charsToRemove = new string[] { "\n", "\r" }; foreach (string c in charsToRemove) { str = str.Replace(c, ""); } return str; } static string getWebpageContent(string url) { WebClient client = new WebClient(); client.Headers.Add("user-agent", "Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.2; .NET CLR 1.0.3705;)"); Stream data = client.OpenRead(url); StreamReader reader = new StreamReader(data); string s = reader.ReadToEnd(); data.Close(); reader.Close(); return s; } } } This program hangs. It runs correctly when I remove RegexOptions.IgnoreCase option or when I remove call to removeNewLineCharacters() function. Could someone tell me what is going on, please?

    Read the article

  • Recoverable error while running XSL

    - by Kate
    XSL: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ve="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:r="http://schemas.openxmlformats.org/officeDocument/2006/relationships" xmlns:m="http://schemas.openxmlformats.org/officeDocument/2006/math" xmlns:v="urn:schemas-microsoft-com:vml" xmlns:wp="http://schemas.openxmlformats.org/drawingml/2006/wordprocessingDrawing" xmlns:w10="urn:schemas-microsoft-com:office:word" xmlns:w="http://schemas.openxmlformats.org/wordprocessingml/2006/main" xmlns:wne="http://schemas.microsoft.com/office/word/2006/wordml" exclude-result-prefixes="wp wne w10 w ve o r m v" version="2.0"> <xsl:output method="text"/> <xsl:param name="styleName"/> <xsl:template match="w:p"> <xsl:apply-templates/><xsl:text>&#10;</xsl:text> </xsl:template> <xsl:template match="w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]"> <xsl:value-of select="replace(., '.', '&#xFF00;')"/> </xsl:template> </xsl:stylesheet> While processing the above XSL, I am getting the below error, Recoverable Error: Recoverable error on line 11 FORG0006: An error occurred matching pattern {w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]}: Effective boolean value is not defined for a sequence of two or more items starting with a boolean Please Help. I am not able to figure out this.

    Read the article

  • WPF app startup problems

    - by Dave
    My brain is all over the map trying to fully understand Unity right now. So I decided to just dive in and start adding it in a branch to see where it takes me. Surprisingly enough (or maybe not), I am stuck just getting my darn Application to load properly. It seems like the right way to do this is to override OnStartup in App.cs. I've removed my StartupUri from App.xaml so it doesn't create my GUI XAML. My App.cs now looks something like this: public partial class App : Application { private IUnityContainer container { get; set; } protected override void OnStartup(StartupEventArgs e) { container = new UnityContainer(); GUI gui = new GUI(); gui.Show(); } protected override void OnExit(ExitEventArgs e) { container.Dispose(); base.OnExit(e); } } The problem is that nothing happens when I start the app! I put a breakpoint at the container assignment, and it never gets hit. What am I missing? App.xaml is currently set to ApplicationDefinition, but I'd expect this to work because some sample Unity + WPF code I'm looking at (from Codeplex) does the exact same thing, except that it works! I've also started the app by single-stepping, and it eventually hits the first line in App.xaml. When I step into this line, that's when the app just starts "running", but I don't see anything (and my breakpoint isn't hit). If I do the exact same thing in the sample application, stepping into App.xaml puts me right into OnStartup, which is what I'd expect to happen. Argh! Is it a Bad Thing to just put the Unity construction in my GUI's Window_Loaded event handler? Does it really need to be at the App level?

    Read the article

  • Is there a better way to change user password in cakephp using Auth?

    - by sipiatti
    Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Dynamic Select boxes page load

    - by Chris
    Hello, I have a dynamic chained select box that I am attempting to show the value of on a page load. In my chained select box, it will default to the first option within the select box on page load, could anyone provide assitance? I stumbled upon this thread, but I can't seem to translate what they are doing with that answer to my language of CF. Dynamic chained drop downs on page refresh Here is the JS script I am using. function dynamicSelect(id1, id2) { // Feature test to see if there is enough W3C DOM support if (document.getElementById && document.getElementsByTagName) { // Obtain references to both select boxes var sel1 = document.getElementById(id1); var sel2 = document.getElementById(id2); // Clone the dynamic select box var clone = sel2.cloneNode(true); // Obtain references to all cloned options var clonedOptions = clone.getElementsByTagName("option"); // Onload init: call a generic function to display the related options in the dynamic select box refreshDynamicSelectOptions(sel1, sel2, clonedOptions); // Onchange of the main select box: call a generic function to display the related options in the dynamic select box sel1.onchange = function() { refreshDynamicSelectOptions(sel1, sel2, clonedOptions); } } } function refreshDynamicSelectOptions(sel1, sel2, clonedOptions) { // Delete all options of the dynamic select box while (sel2.options.length) { sel2.remove(0); } // Create regular expression objects for "select" and the value of the selected option of the main select box as class names var pattern1 = /( |^)(select)( |$)/; var pattern2 = new RegExp("( |^)(" + sel1.options[sel1.selectedIndex].value + ")( |$)"); // Iterate through all cloned options for (var i = 0; i < clonedOptions.length; i++) { // If the classname of a cloned option either equals "select" or equals the value of the selected option of the main select box if (clonedOptions[i].className.match(pattern1) || clonedOptions[i].className.match(pattern2)) { // Clone the option from the hidden option pool and append it to the dynamic select box sel2.appendChild(clonedOptions[i].cloneNode(true)); } } } Thanks so much for any assistance

    Read the article

  • Is there a design pattern to cut down on code duplication when subclassing Activities in Android?

    - by Daniel Lew
    I've got a common task that I do with some Activities - downloading data then displaying it. I've got the downloading part down pat; it is, of course, a little tricky due to the possibility of the user changing the orientation or cancelling the Activity before the download is complete, but the code is there. There is enough code handling these cases such that I don't want to have to copy/paste it to each Activity I have, so I thought to create an abstract subclass Activity itself such that it handles a single background download which then launches a method which fills the page with data. This all works. The issue is that, due to single inheritance, I am forced to recreate the exact same class for any other type of Activity - for example, I use Activity, ListActivity and MapActivity. To use the same technique for all three requires three duplicate classes, except each extends a different Activity. Is there a design pattern that can cut down on the code duplication? As it stands, I have saved much duplication already, but it pains me to see the exact same code in three classes just so that they each subclass a different type of Activity.

    Read the article

  • Cross-Application User Authentication

    - by Chris Lieb
    We have a webapp written in .NET that uses NTLM for SSO. We are writing a new webapp in Java that will tightly integrate with the original application. Unfortunately, Java has no support for performing the server portion of NTLM authentication and the only library that I can find requires too much setup to be allowed by IT. To work around this, I came up with a remote authentication scheme to work across applications and would like your opinions on it. It does not need to be extremely secure, but at the same time not easily be broken. User is authenticated into .NET application using NTLM User clicks link that leaves .NET application .NET application generates random number and stores it in the user table along with the user's full username (domain\username) Insecure token is formed as random number:username Insecure token is run through secure cipher (likely AES-256) using pre-shared key stored within the application to produce a secure token The secure token is passed as part of the query string to the Java application The Java application decrypts the secure key using the same pre-shared key stored within its own code to get the insecure token The random number and username are split apart The username is used to retrieve the user's information from the user table and the stored random number is checked against the one pulled from the insecure token If the numbers match, the username is put into the session for the user and they are now authenticated If the numbers do not match, the user is redirected to the .NET application's home page The random number is removed from the database

    Read the article

  • Update table using SSIS

    - by thursdaysgeek
    I am trying to update a field in a table with data from another table, based on a common key. If it were in straight SQL, it would be something like: Update EHSIT set e.IDMSObjID = s.IDMSObjID from EHSIT e, EHSIDMS s where e.SITENUM = s.SITE_CODE However, the two tables are not in the same database, so I'm trying to use SSIS to do the update. Oh, and the sitenum/site_code are varchar in one and nvarchar in the other, so I'll have to do a data conversion so they'll match. How do I do it? I have a data flow object, with the source as EHSIDMS and the destination as EHSIT. I have a data conversion to convert the unicode to non-unicode. But how do I update based on the match? I've tried with the destination, using a SQL Command as the Data Access mode, but it doesn't appear to have the source table. If I just map the field to be updated, how does it limit it based on fields matching? I'm about to export my source table to Excel or something, and then try inputting from there, although it seems that all that would get me would be to remove the data conversion step. Shouldn't there be an update data task or something? Is it one of those Data Flow transformation tasks, and I'm just not figuring out which it is?

    Read the article

  • Help with a loop to return UIImage from possible matches

    - by Canada Dev
    I am parsing a list of locations and would like to return a UIImage with a flag based on these locations. I have a string with the location. This can be many different locations and I would like to search this string for possible matches in an NSArray, and when there's a match, it should find the appropriate filename in an NSDictionary. Here's an example of the NSDictionary and NSArray: NSDictionary *dict = [NSDictionary dictionaryWithObjectsAndKeys: @"franceFlag", @"france", @"greeceFlag", @"greece", @"spainFlag", @"spain", @"norwayFlag", @"norway", nil]; NSArray *array = [NSArray arrayWithObjects: @"france" @"greece" @"spain" @"portugal" @"ireland" @"norway", nil]; Obviously I'll have a lot more countries and flags in both. Here's what I have got to so far: -(UIImage *)flagFromOrigin:(NSString *)locationString { NSRange range; for (NSString *arrayString in countryArray) { range = [locationString rangeOfString:arrayString]; if (range.location != NSNotFound) { return [UIImage imageWithContentsOfFile:[[NSBundle mainBundle] pathForResource:[dictionary objectForKey: arrayString] ofType:@"png"]]; } } return nil; } Now, the above doesn't actually work. I am missing something (and perhaps not even doing it right in the first place) The issue is, the locationString could have several locations in the same country, described something like this "Barcelona, Spain", "Madrid, Spain", "North Spain", etc., but I just want to retrieve "Spain" in this case. (Also, notice caps for each country). Basically, I want to search the locationString I pass into the method for a possible match with one of the countries listed in the NSArray. If/When one is found, it should continue into the NSDictionary and grab the appropriate flag based on the correct matched string from the array. I believe the best way would then to take the string from the array, as this would be a stripped-out version of the location. Any help to point me in the right direction for the last bit is greatly appreciated.

    Read the article

  • Visual SourceSafe (VSS): "Access to file (filename) denied" error

    - by tk-421
    Hi, can anybody help with the above SourceSafe error? I've spent hours trying to find a fix. I've also Googled the heck out of it but couldn't find a scenario matching mine, because in my case only a few files (not all) are affected. Here's what I found: only a few files in my project generate this error other files in the same directory (for example, App_Code has one of the problem files) work fine I've tried checking out from both the VSS client and Visual Studio another developer can check out the main problem file without any problems This sounds like a permission issue for my user, right? However: I found the location of one of the problem files in VSS's data directory (using VSS's naming format, as in 'fddaaaaa.a') and checked its permissions; everything looks fine and its permissions match those of other files I can check out successfully I can see no differences in the file properties between working and non-working files What else can I check? Has anyone encountered this problem before and found a solution? Thanks. P.S.: SourceGear, svn or git are not options, unfortunately. P.P.S.: Tried unsuccessfully to add tag "sourcesafe." EDIT: Hey Paddy, I tried to click 'add comment' to respond to your comment, but I'm getting a javascript error when loading this page in IE8 ("jquery undefined," etc.) so this isn't working. This is when checking out files, and yes, I've obliterated my local copy more times than I can remember. ;) EDIT 2: Thanks for the responses, guys (again I can't 'add comment' due to jQuery not loading, maybe blocked as discussed in Meta). If the problem was caused by antivirus or a bad disk, would other users still be able to check out the file(s)? That's the case here, which makes me think it's a permission issue specific to my account. However I've looked at the permissions and they match both other users' settings and settings on other files which I can check out.

    Read the article

  • php clean up regex

    - by David
    hey can i clean up a preg_match in php from this: preg_match_all("/(".$this->reg['wat'].")?(".$this->reg['wat'].")?(".$this->reg['wat'].")?(".$this->reg['wat'].")?(".$this->reg['wat'].")?(".$this->reg['wat'].")?(".$this->reg['wat'].")?/",$value,$match); to look like this: preg_match_all("/ (".$this->reg['wat'].")? (".$this->reg['wat'].")? (".$this->reg['wat'].")? (".$this->reg['wat'].")? (".$this->reg['wat'].")? (".$this->reg['wat'].")? (".$this->reg['wat'].")? /",$value,$match); right now each space, it counts as a ling break so it wont return any finds when searching. but it just looks cleaner and easier to read is why i ask you know. i was looking for one of those letters to add after the closing "/" in the regex. thanks

    Read the article

  • java + increasing performance and scalability

    - by varun
    Hi, below is the a code snippet, which returns the object of a class. now the object is basially comparing to some parameter in loop. my concern is what if there are thousands of objects in loop, in that case performance and scalability can be an issue. please suggest how to improve this code for performance part public Widget get(String name,int major,int minor,boolean exact) { Widget widgetToReturn = null; if(exact) { Widget w = new Widget(name, major, minor); // for loop using JDK 1.5 version for(Widget wid : set) { if((w.getName().equals(wid.getName())) && (wid.getVersion()).equals(w.getVersion())) { widgetToReturn = w; break; } } } else { Widget w = new Widget(name, major, minor); WidgetVersion widgetVersion = new WidgetVersion(major, minor); // for loop using JDK 1.5 version for(Widget wid : set) { WidgetVersion wv = wid.getVersion(); if((w.getName().equals(wid.getName())) && major == wv.getMajor() && WidgetVersion.isCompatibleAndNewer(wv, widgetVersion)) { widgetToReturn = wid; } else if((w.getName().equals(wid.getName())) && wv.equals(widgetVersion.getMajor(), widgetVersion.getMinor())) { widgetToReturn = w; } } } return widgetToReturn; }

    Read the article

  • How would I make this faster? Parsing Word/sorting by heading [on hold]

    - by Doof12
    Currently it takes about 3 minutes to run through a single 53 page word document. Hopefully you all have some advice about speeding up the process. Code: import win32com.client as win32 from glob import glob import io import re from collections import namedtuple from collections import defaultdict import pprint raw_files = glob('*.docx') word = win32.gencache.EnsureDispatch('Word.Application') word.Visible = False oFile = io.open("rawsort.txt", "w+", encoding = "utf-8")#text dump doccat= list() for f in raw_files: word.Documents.Open(f) doc = word.ActiveDocument #whichever document is active at the time doc.ConvertNumbersToText() print doc.Paragraphs.Count for x in xrange(1, doc.Paragraphs.Count+1):#for loop to print through paragraphs oText = doc.Paragraphs(x) if not oText.Range.Tables.Count >0 : results = re.match('(?P<number>(([1-3]*[A-D]*[0-9]*)(.[1-3]*[0-9])+))', oText.Range.Text) stylematch = re.match('Heading \d', oText.Style.NameLocal) if results!= None and oText.Style != None and stylematch != None: doccat.append((oText.Style.NameLocal, oText.Range.Text[:len(results.group('number'))],oText.Range.Text[len(results.group('number')):])) style = oText.Style.NameLocal else: if oText.Range.Font.Bold == True : doccat.append(style, oText) oFile.write(unicode(doccat)) oFile.close() The for Paragraph loop obviously takes the most amount of time. Is there some way of identifying and appending it without going through every Paragraph?

    Read the article

  • compact XSLT code to drop N number of tags if all are null.

    - by infant programmer
    This is my input xml: <root> <node1/> <node2/> <node3/> <node4/> <othertags/> </root> The output must be: <root> <othertags/> </root> if any of the 4 nodes isn't null then none of the tags must be dropped. example: <root> <node1/> <node2/> <node3/> <node4>sample_text</node4> <othertags/> </root> Then the output must be same as input xml. <root> <node1/> <node2/> <node3/> <node4>sample_text</node4> <othertags/> </root> This is the XSL code I have designed :: <xsl:template match="@*|node()"> <xsl:copy> <xsl:apply-templates select="@*|node()"/> </xsl:copy> </xsl:template> <xsl:template match="/root/node1[.='' and ../node2/.='' and ../node3/.='' and ../node4/.=''] |/root/node2[.='' and ../node1/.='' and ../node3/.='' and ../node4/.=''] |/root/node3[.='' and ../node1/.='' and ../node2/.='' and ../node4/.=''] |/root/node4[.='' and ../node1/.='' and ../node2/.='' and ../node3/.='']"/> As you can see the code requires more effort and becomes more bulky as the number of nodes increase. Is there any alternative way to overcome this bottleneck?

    Read the article

  • Why does this sql statement keep saying it is a boolean and not a paramter? (php/Mysql)

    - by ggfan
    In this statement, I am trying to see if there if the latest posting in the database that has the exact same title, price, city, state, detail. If there is, then it would say to the user that the exact post has been already made; if not then insert the posting into the dbc. (This is one type of check so that users can't accidentally post twice. This may not be the best check, but this statement error is annoying me, so I want it to work :)) Why won't this sql work? I think it's not letting the title=$title and not getting the value in the $title... ERROR: mysqli_num_rows() expects parameter 1 to be mysqli_result, boolean given in postad.php on line 365 //there is a form that users fill out that has title, price, city, etc <form> blah blah </form> //if users click submit, then does all the checks and if all okay, insert to dbc if (isset($_POST['submit'])) { // Grab the pposting data from the POST and gets rid of any funny stuff $title = mysqli_real_escape_string($dbc, trim($_POST['title'])); $price = mysqli_real_escape_string($dbc, trim($_POST['price'])); $city = mysqli_real_escape_string($dbc, trim($_POST['city'])); $state = mysqli_real_escape_string($dbc, trim($_POST['state'])); $detail = mysqli_real_escape_string($dbc, trim($_POST['detail'])); if (!is_numeric($price) && !empty($price)) { echo "<p class='error'>The price can only be numbers. No special characters, etc</p>"; } //Error problem...won't let me set title=$title, detail=$detail, etc. //this statement after all the checks so that none of the variables are empty $query="Select * FROM posting WHERE user_id={$_SESSION['user_id']} AND title=$title AND price=$price AND city=$city AND state=$state AND detail=$detail"; $data = mysqli_query($dbc, $query); if(mysqli_num_rows($data)==1) { echo "You already posted this ad. Most likely caused by refreshing too many times."; } }

    Read the article

  • Using placeholders/variables in a sed command

    - by jesse_galley
    I want to store a specific part of a matched result as a variable to be used for replacement later. I would like to keep this in a one liner instead of finding the variable I need before hand. when configuring apache, and use mod_rewrite, you can specificy specific parts of patterns to be used as variables,like this: RewriteRule ^www.example.com/page/(.*)$ http://www.example.com/page.php?page=$1 [R=301,L] the part of the pattern match that's contained inside the parenthesis is stored as $1 for use later. So if the url was www.example.com/page/home, it would be replaced with www.example.com/page.php?page=home. So the "home" part of the match was saved in $1 because it was the part of the pattern inside the parenthesis. I want something like this functionality with a sed command, I need to automatically replace many strings in a SQL dump file, to add drop table if exist commands before each create table, but I need to know the table name to do this, so if the dump file contains something like: ... CREATE TABLE `orders` ... I need to run something like: cat dump.sql | sed "s/CREATE TABLE `(.*)`/DROP TABLE IF EXISTS $1\N CREATE TABLE `$1`/g" to get the result of: ... DROP TABLE IF EXISTS `orders` CREATE TABLE `orders` ... I'm using the mod_rewrite syntax in the sed command as a logical example of what I'm trying to do. Any suggestions?

    Read the article

  • Reusing named_scope to define another named_scope

    - by Sergei Kozlov
    The problem essence as I see it One day, if I'm not mistaken, I have seen an example of reusing a named_scope to define another named_scope. Something like this (can't remember the exact syntax, but that's exactly my question): named_scope :billable, :conditions => ... named_scope :billable_by_tom, :conditions => { :billable => true, :user => User.find_by_name('Tom') } The question is: what is the exact syntax, if it's possible at all? I can't find it back, and Google was of no help either. Some explanations Why I actually want it, is that I'm using Searchlogic to define a complex search, which can result in an expression like this: Card.user_group_managers_salary_greater_than(100) But it's too long to be put everywhere. Because, as far as I know, Searchlogic simply defines named_scopes on the fly, I would like to set a named_scope on the Card class like this: named_scope from_big_guys, { user_group_managers_salary_greater_than(100) } - this is where I would use that long Searchlogic method inside my named_scope. But, again, what would be the syntax? Can't figure it out. Resume So, is named_scope nesting (and I do not mean chaining) actually possible?

    Read the article

  • Named captured substring in pcre++

    - by VDVLeon
    Hello, I want to capture named substring with the pcre++ library. I know the pcre library has the functionality for this, but pcre++ has not implemented this. This is was I have now (just a simple example): pcrepp::Pcre regex("test (?P<groupName>bla)"); if (regex.search("test bla")) { // Get matched group by name int pos = pcre_get_stringnumber( regex.get_pcre(), "groupName" ); if (pos == PCRE_ERROR_NOSUBSTRING) return; // Get match std::string temp = regex[pos - 1]; std::cout << "temp: " << temp << "\n"; } If I debug, pos return 1, and that is right, (?Pbla) is the 1th submatch (0 is the whole match). It should be ok. But... regex.matches() return 0. Why is that :S ? Btw. I do regex[pos - 1] because pcre++ reindexes the result with 0 pointing to the first submatch, so 1. So 1 becomes 0, 2 becomes 1, 3 becomes 2, etc. Does anybody know how to fix this?

    Read the article

  • Basic user authentication with records in AngularFire

    - by ajkochanowicz
    Having spent literally days trying the different, various recommended ways to do this, I've landed on what I think is the most simple and promising. Also thanks to the kind gents from this SO question: Get the index ID of an item in Firebase AngularFire Curent setup Users can log in with email and social networks, so when they create a record, it saves the userId as a sort of foreign key. Good so far. But I want to create a rule so twitter2934392 cannot read facebook63203497's records. Off to the security panel Match the IDs on the backend Unfortunately, the docs are inconsistent with the method from is firebase user id unique per provider (facebook, twitter, password) which suggest appending the social network to the ID. The docs expect you to create a different rule for each of the login method's ids. Why anyone using 1 login method would want to do that is beyond me. (From: https://www.firebase.com/docs/security/rule-expressions/auth.html) So I'll try to match the concatenated auth.provider with auth.id to the record in userId for the respective registry item. According to the API, this should be as easy as In my case using $registry instead of $user of course. { "rules": { ".read": true, ".write": true, "registry": { "$registry": { ".read": "$registry == auth.id" } } } } But that won't work, because (see the first image above), AngularFire sets each record under an index value. In the image above, it's 0. Here's where things get complicated. Also, I can't test anything in the simulator, as I cannot edit {some: 'json'} To even authenticate. The input box rejects any input. My best guess is the following. { "rules": { ".write": true, "registry": { "$registry": { ".read": "data.child('userId').val() == (auth.provider + auth.id)" } } } } Which both throws authentication errors and simultaneously grants full read access to all users. I'm losing my mind. What am I supposed to do here?

    Read the article

  • Panel in Windows Forms Application not clearing

    - by SwiftStriker00
    I'm working on my project: [Beer Pong Management System][1], a Windows Forms application. I am currently trying to add a whole tournament mode to it. In a nutshell, I've created a TabControl, with the first tab page with the settings and setup and the second page the brackets. There is a feature for each of the match-ups, that once there is a winner is decided, a yellow cancel button will appear in order to revert the tournament. However my issue is when i click the button the next match-up does not get removed in the series is going. See below: Image Here(not high enough rep to insert image) I have tried to set the MatchUp to null, I've tried dispose(), close(). even Parent.Controls.Remove(). Even after I switch tabs which is supposed to clear all, they still sit there when i come back. I have a feeling I might be loosing a reference or something because I can't even push new teams into them, they just sit there with their buttons. Does anyone have any tips or know of any known issues that might be causing this? Thanks. [1] _http://www.cs.rit.edu/~rmb1201/pages/code.shtml

    Read the article

< Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >