Search Results

Search found 3804 results on 153 pages for 'regex'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 115/153 | < Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >

  • extract word with regular expression

    - by farka
    I have a string 1/temperatoA,2/CelcieusB!23/33/44,55/66/77 and I would like to extract the words temperatoA and CelcieusB. I have this regular expression (\d+/(\w+),?)*! but I only get the match 1/temperatoA,2/CelcieusB! Why?

    Read the article

  • How can I handle validation of non-latin script input in PHP?

    - by Matt
    I am trying to adapt a php application to handle non-latin scripts (specifically: Japanese, simplified Chinese and Arabic). The app's data validation routines make frequent use of regular expressions to check input, but I am not sure how to adapt the \w character type to other languages without installing additional locales on the system (which I cannot rely on). Previous developers to have worked on the app have simply added needed characters to the regexes as the number of languages we supported grew (you frequently see "[\wÀÁÂÃÄÅÆÇÈÉ... etc" in the code), but I can't really do this for all the alphabets I need to support now. Does anybody out there have some advice on how to tackle this?

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • How to match a variable list of items separated by commas

    - by user261915
    I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • Censoring selected words (replacing them with ****) using a single replaceAll?

    - by aioobe
    I'd like to censor some words in a string by replacing each character in the word with a "*". Basically I would want to do String s = "lorem ipsum dolor sit"; s = s.replaceAll("ipsum|sit", $0.length() number of *)); so that the resulting s equals "lorem ***** dolor ***". I know how to do this with repeated replaceAll invokations, but I'm wondering, is this possible to do with a single replaceAll?

    Read the article

  • How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

    - by Steve
    I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

    Read the article

  • Match Phrases (in array) in text string

    - by Tim Hanssen
    I'm using the Twitter API streaming to collect thousand of tweets every minute. They need to be matched to a list of keywords (can contain spaces). This is my current method: $text = preg_replace( '/[^a-z0-9]+/i', ' ', strtolower( $data['text'] ) ); $breakout = explode( " ", $text ); $result = array_intersect( $this->_currentTracks, $breakout ); I chop the tweet into words, and the matches them against my current keywords. This works well for all the keywords without a space ofc. If I wanted to find for example "Den Haag", It won't show up, because the string is exploded into words (based on the spaces). Any ideas about how I can do this in a quick way? Kind regards, Tim

    Read the article

  • Regular expression to match text that doesn't start with substring?

    - by Steven
    I have text with file names scattered throughout. The filenames appear in the text like this: |test.txt| |usr01.txt| |usr02.txt| |foo.txt| I want to match the filenames that don't start with usr. I came up with (?<=\|).*\.txt(?=\|) to match the filenames, but it doesn't exclude the ones starting with usr. Is this possible with regular expressions?

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • JavaScript: add or subtract from number in string

    - by yoavf
    I have a string that looks like "(3) New stuff" where 3 can be any number. I would like to add or subtract to this number. I figured out the following way: var thenumber = string.match((/\d+/)); thenumber++; string = string.replace(/\(\d+\)/ ,'('+ thenumber +')'); Is there a more elegant way to do it?

    Read the article

  • what is the regular expression for this

    - by bn
    I want to parse this (adv) much (thanks) I want to eliminate the words and the bracket (adv) but not (thanks) the condition is: inside bracket, and word length inside bracket is 1-5 characters I am using preg_match in PHP Thank You

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • java - check if string ends with certain pattern

    - by The Learner
    I have string like: This.is.a.great.place.too.work. (or) This/is/a/great/place/too/work/ than my java program should give me that the sentence is valid and it has "work". if i Have : This.is.a.great.place.too.work.hahahha (or) This/is/a/great/place/too/work/hahahah Should not give me that there is a work in the sentance. so I am looking at java strings to find a word at the end of the sentance having . (or),(or)/ before it. How can I achieve that

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >