Search Results

Search found 3804 results on 153 pages for 'regex'.

Page 115/153 | < Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >

  • Sed: regular expression match lines without <!--

    - by sixtyfootersdude
    I have a sed command to comment out xml commands sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml Takes: <a> <!-- Comment --> <b> bla </b> </a> Produces: <!-- Security: <a> --> <!-- Security: <!-- Comment --> --> // NOTE: there are two end comments. <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> Ideally I would like to not use my sed script to comment things that are already commented. Ie: <!-- Security: <a> --> <!-- Comment --> <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> I could do something like this: sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml sed 's/^[ \t]*<!-- Security: \(<!--.*-->\) -->/\1/' web.xml but I think a one liner is cleaner (?) This is pretty similar: http://stackoverflow.com/questions/436850/matching-a-line-that-doesnt-contain-specific-text-with-regular-expressions

    Read the article

  • How to match a variable list of items separated by commas

    - by user261915
    I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

    Read the article

  • Regular Expressions, avoiding HTML tags in PHP

    - by Jason Axelrod
    I have actually seen this question quite a bit here, but none of them are exactly what I want... Lets say I have the following phrase: Line 1 - This is a TEST phrase. Line 2 - This is a <img src="TEST" /> image. Line 3 - This is a <a href="somelink/TEST">TEST</a> link. Okay, simple right? I am trying the following code: $linkPin = '#(\b)TEST(\b)(?![^<]*>)#i'; $linkRpl = '$1<a href="newurl">TEST</a>$2'; $html = preg_replace($linkPin, $linkRpl, $html); As you can see, it takes the word TEST, and replaces it with a link to test. The regular expression I am using right now works good to avoid replacing the TEST in line 2, it also avoids replacing the TEST in the href of line 3. However, it still replaces the text encapsulated within the tag on line 3 and I end up with: Line 1 - This is a <a href="newurl">TEST</a> phrase. Line 2 - This is a <img src="TEST" /> image. Line 3 - This is a <a href="somelink/TEST"><a href="newurl">TEST</a></a> link. This I do not want as it creates bad code in line 3. I want to not only ignore matches inside of a tag, but also encapsulated by them. (remember to keep note of the / in line 2)

    Read the article

  • Regular expression - starting and ending with a letter, accepting only letters, numbers and _

    - by jreid9001
    I'm trying to write a regular expression which specifies that text should start with a letter, every character should be a letter, number or underscore, there should not be 2 underscores in a row and it should end with a letter or number. At the moment, the only thing I have is ^[a-zA-Z]\w[a-zA-Z1-9_] but this doesn't seem to work properly since it only ever matches 3 characters, and allows repeated underscores. I also don't know how to specify requirements for the last character.

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • Regular expression to match text that doesn't start with substring?

    - by Steven
    I have text with file names scattered throughout. The filenames appear in the text like this: |test.txt| |usr01.txt| |usr02.txt| |foo.txt| I want to match the filenames that don't start with usr. I came up with (?<=\|).*\.txt(?=\|) to match the filenames, but it doesn't exclude the ones starting with usr. Is this possible with regular expressions?

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Need to add specific characters to regular expression

    - by lordryan
    i'm using the following regular expression to form a basic email validation. var emailRegEx = /^([a-zA-Z0-9])(([a-zA-Z0-9])*([\._\+-])*([a-zA-Z0-9]))*@(([a-zA-Z0-9\-])+(\.))+([a-zA-Z]{2,4})+$/; this works pretty well for what i need but i also need to exclude these specific characters for reasons i won't go into. !,#,$,%,^,&,*,(,),-,+,|,{,},[,],:,>,<,?,/,\,= - (the characters between the "," if that isn't clear) could someone help me with adding the second group to the first? I know the pro's and cons of using javascript to validate email addresses - i have to do it this way. thanks.

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • extracting multiple fields from a text file using php

    - by Dave
    Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

< Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >