Search Results

Search found 9254 results on 371 pages for 'approach'.

Page 129/371 | < Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >

  • How to use another type of EditingControl in a single C# 3.5 DataGridView column ?

    - by too
    Is this possible to have two (or more) different kinds of cells to be displayed interchangeably in single column of C# .Net 3.5 DataGridView? I know one column has specified single EditingControl type, yet I think grid is flexible enough to do some tricks, I may think of only: Adding as many invisible columns to grid as required types of cells and on CellBeginEdit somehow exchange current cell with other column's cell Create custom column and custom cell with possibility of changing EditingControl for single cell Which approach is better, are there any examples ?

    Read the article

  • MySQL & PHP: auto connect to DB or to properly way to pass host/db to MySQL methods

    - by SODA
    Hi, does anyone know of a known method in PHP to auto connect to MySQL db/table in case an app is using multiple databases on multiple hosts? Question 1: are there scripts around that allow to auto connect to necessary host/DB based on query? Question 2: if above is not possible, is there a known approach to properly passing host/DB info to make sure app is properly connected before executing the query?

    Read the article

  • JAVA SDK Modifying Table Column

    - by tathamr
    I have the ReportBlock from the type VTable that I am modifying. I am able to get the horizonatal block axis to modify the cells but, I cannot seem to modify the column header (different object). I started to look into trying to get back a smalltable but, I am not confident in this approach. Any idea?

    Read the article

  • Linq to SQL - Returning two values with one query

    - by Sir Psycho
    Hi, Is it possible to return a single value and an enumerable collection using LINQ to SQL? The problem is, I'm trying to do paging across a large recordset. I only want to return 10 rows at a time so I'm using .Skip(20).Take(10) approach. However I need to know the total number of records so I can show an appropriate page x of y. Trying to avoid two separate queries. Thanks

    Read the article

  • OpenGL: Implementing transformation matrix stack

    - by Jakub M.
    In a newer OpenGL there is no matrix stack. I am working on a simple display engine, and I am going to implement the transformation stack. What is a common strategy here? Should I build a push/pop stack, and use it with a tree representing my model? I suppose this is the "old" approach, that was deprecated in the newer OpenGL versions. Maybe then it is not the best solution (it was removed for some reason)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Archiving sharepoint site instade of deleting

    - by Sachin
    Hi All, I have a sharepoint site. This site large nubmer of site and sub site sollection in it. There are few that are created and are not in use. Now my questuion is how can I findout these old sites and before going deleting I have to first archive it. Can any one tell me what is the best possible approach to do it?

    Read the article

  • Creating content input form with custom theme (Drupal)

    - by AndrewSmith
    I'm creating a site which I want to place content input form in custom themed template. I opted to do this because I wanted the whole site to be looked uniform. That said, I'm not sure as to what is the best approach to do this. Is it proper to invoke hook_insert/delete/update and hook_perm/hook_access by myself or is there anyway I can still use my custom theme and write a code in a way that drupal would take care of invoking appropriate hooks accordingly? Thanks in advance PS : I'm on drupal 6.x

    Read the article

  • How to get width of button in DateTimePicker-Control/Controls in general?

    - by Inno
    Hello everybody, I implemented a custom DateTimePicker. On the DateTimePicker there is a button. In the examples I've found it's width is set to 16. This is working but I would like to have a dynamic approach. So, is there a way to get the size of this button or is there a general way to get information about .Net-Control sub elements like size etc.? Trying DateTimePicker.Controls didn't help me (it's empty).

    Read the article

  • Custom search engine in asp.net mvc and entity framework

    - by Rahat
    Hi, does anyone have any idea how I can get started building a search engine for my asp.net mvc site using entity framework. I plan to build something like: http://www.carsguide.com.au/search/?N=4294962119++492&type=cars there on the left there is a refine search option panel. What's the best approach to design a model for the UI and optimized query with entity framework.

    Read the article

  • IBOutlet on properties and exposition of the class

    - by Espuz
    Apple, for memory management issues, recommend defining outlets on properties, not in the attribute declaration. But, as far as I know, declaring properties exposes the class to external classes, so this could be dangerous. On UIViewController we have the main view definition and the logic, so MVC is slightly cheated in this cases. What is the beteer approach, Apples's recommendation for memory-management or armored classes?

    Read the article

  • How to improve variable overriding/overwriting in XSL?

    - by ChrisBenyamin
    I want to do the following: Declare a variable Go into a if-statement Overwrite the variable XSL says I can't declare a variable twice, so what can I do to improve this step? Another approach was to check if a variable is set at all. I did this, because i skipped the first step and declared the variable in the if-statement. In another if-statement I wanted to check if the variable exists at all.

    Read the article

  • Can I assigin value dynamically like this?

    - by kumar
    <input type="text" id="Date-<%=Model.ID%>" value= " + <%=Html.DisplayFor(model=>model.Date)%> + " /> is this right? i am trying to display value in input box dynamically? can anyone advice me is this corect approach? but still I am getting here only + + in input box? thanks

    Read the article

  • How to create a horizontal scrollable list?

    - by Thomas Joos
    hi all, I am wondering what the best approach is for creating a horizontal list with custom buttons. I read there is no native control for that: I am considering a UIView with a scroll view inside. On this scrollview I visualize my array of button objects. Any thoughts?

    Read the article

  • Entity Framework 4 POCO with Dictionary

    - by Eric J.
    I have a POCO (Plain Old CLR Object) public Foo { public virtual int Id { get; set; } public virtual Dictionary<string, string> Stuff { get; set; } public virtual string More { get; set; } } Using the model first approach (i.e. I don't have a data model yet), how would I handle persisting Stuff (Dictionary)?

    Read the article

  • play background music continuously

    - by Ashish Rajan
    I am playing a background on my webpage by using miniswfloopplayer, now I want the music to play continuously throughout the website, currently the music starts all over again when a page loads which is quite obvious. I am looking for a approach where I can avoid the above situation. I know similar questions have been posted here, but they are inactive from a long time.

    Read the article

  • Asp.net deployment with remote desktop

    - by Efe Kaptan
    Hi, i have a production server that does not have ftp access. Possible way to deploy files is connecting with remote desktop client and send files. As you know this approach is highly hard and time inefficient. Could you please provide me best practices to deploy in a more fast way? Thanks

    Read the article

  • Minimalist array creation in c#

    - by sipwiz
    I've always wanted to be able to use the line below but the C# compiler won't let me. To me it seems obvious and unambiguos as to what I want. myString.Trim({'[', ']'}); I can acheive my goal using: myString.Trim(new char[]{'[', ']'}); So I don't die wondering is there any other way to do it that is closer to the first approach?

    Read the article

  • if else within CTE ?

    - by stackoverflowuser
    I want to execute select statement within CTE based on a codition. something like below ;with CTE_AorB ( if(condition) select * from table_A else select * from table_B ), CTE_C as ( select * from CTE_AorB // processing is removed ) But i get error on this. Is it possible to have if else within CTEs? If not is there a work around Or a better approach. Thanks.

    Read the article

< Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >