Search Results

Search found 411 results on 17 pages for '960 gs'.

Page 13/17 | < Previous Page | 9 10 11 12 13 14 15 16 17  | Next Page >

  • Toorcon14

    - by danx
    Toorcon 2012 Information Security Conference San Diego, CA, http://www.toorcon.org/ Dan Anderson, October 2012 It's almost Halloween, and we all know what that means—yes, of course, it's time for another Toorcon Conference! Toorcon is an annual conference for people interested in computer security. This includes the whole range of hackers, computer hobbyists, professionals, security consultants, press, law enforcement, prosecutors, FBI, etc. We're at Toorcon 14—see earlier blogs for some of the previous Toorcon's I've attended (back to 2003). This year's "con" was held at the Westin on Broadway in downtown San Diego, California. The following are not necessarily my views—I'm just the messenger—although I could have misquoted or misparaphrased the speakers. Also, I only reviewed some of the talks, below, which I attended and interested me. MalAndroid—the Crux of Android Infections, Aditya K. Sood Programming Weird Machines with ELF Metadata, Rebecca "bx" Shapiro Privacy at the Handset: New FCC Rules?, Valkyrie Hacking Measured Boot and UEFI, Dan Griffin You Can't Buy Security: Building the Open Source InfoSec Program, Boris Sverdlik What Journalists Want: The Investigative Reporters' Perspective on Hacking, Dave Maas & Jason Leopold Accessibility and Security, Anna Shubina Stop Patching, for Stronger PCI Compliance, Adam Brand McAfee Secure & Trustmarks — a Hacker's Best Friend, Jay James & Shane MacDougall MalAndroid—the Crux of Android Infections Aditya K. Sood, IOActive, Michigan State PhD candidate Aditya talked about Android smartphone malware. There's a lot of old Android software out there—over 50% Gingerbread (2.3.x)—and most have unpatched vulnerabilities. Of 9 Android vulnerabilities, 8 have known exploits (such as the old Gingerbread Global Object Table exploit). Android protection includes sandboxing, security scanner, app permissions, and screened Android app market. The Android permission checker has fine-grain resource control, policy enforcement. Android static analysis also includes a static analysis app checker (bouncer), and a vulnerablity checker. What security problems does Android have? User-centric security, which depends on the user to grant permission and make smart decisions. But users don't care or think about malware (the're not aware, not paranoid). All they want is functionality, extensibility, mobility Android had no "proper" encryption before Android 3.0 No built-in protection against social engineering and web tricks Alternative Android app markets are unsafe. Simply visiting some markets can infect Android Aditya classified Android Malware types as: Type A—Apps. These interact with the Android app framework. For example, a fake Netflix app. Or Android Gold Dream (game), which uploads user files stealthy manner to a remote location. Type K—Kernel. Exploits underlying Linux libraries or kernel Type H—Hybrid. These use multiple layers (app framework, libraries, kernel). These are most commonly used by Android botnets, which are popular with Chinese botnet authors What are the threats from Android malware? These incude leak info (contacts), banking fraud, corporate network attacks, malware advertising, malware "Hackivism" (the promotion of social causes. For example, promiting specific leaders of the Tunisian or Iranian revolutions. Android malware is frequently "masquerated". That is, repackaged inside a legit app with malware. To avoid detection, the hidden malware is not unwrapped until runtime. The malware payload can be hidden in, for example, PNG files. Less common are Android bootkits—there's not many around. What they do is hijack the Android init framework—alteering system programs and daemons, then deletes itself. For example, the DKF Bootkit (China). Android App Problems: no code signing! all self-signed native code execution permission sandbox — all or none alternate market places no robust Android malware detection at network level delayed patch process Programming Weird Machines with ELF Metadata Rebecca "bx" Shapiro, Dartmouth College, NH https://github.com/bx/elf-bf-tools @bxsays on twitter Definitions. "ELF" is an executable file format used in linking and loading executables (on UNIX/Linux-class machines). "Weird machine" uses undocumented computation sources (I think of them as unintended virtual machines). Some examples of "weird machines" are those that: return to weird location, does SQL injection, corrupts the heap. Bx then talked about using ELF metadata as (an uintended) "weird machine". Some ELF background: A compiler takes source code and generates a ELF object file (hello.o). A static linker makes an ELF executable from the object file. A runtime linker and loader takes ELF executable and loads and relocates it in memory. The ELF file has symbols to relocate functions and variables. ELF has two relocation tables—one at link time and another one at loading time: .rela.dyn (link time) and .dynsym (dynamic table). GOT: Global Offset Table of addresses for dynamically-linked functions. PLT: Procedure Linkage Tables—works with GOT. The memory layout of a process (not the ELF file) is, in order: program (+ heap), dynamic libraries, libc, ld.so, stack (which includes the dynamic table loaded into memory) For ELF, the "weird machine" is found and exploited in the loader. ELF can be crafted for executing viruses, by tricking runtime into executing interpreted "code" in the ELF symbol table. One can inject parasitic "code" without modifying the actual ELF code portions. Think of the ELF symbol table as an "assembly language" interpreter. It has these elements: instructions: Add, move, jump if not 0 (jnz) Think of symbol table entries as "registers" symbol table value is "contents" immediate values are constants direct values are addresses (e.g., 0xdeadbeef) move instruction: is a relocation table entry add instruction: relocation table "addend" entry jnz instruction: takes multiple relocation table entries The ELF weird machine exploits the loader by relocating relocation table entries. The loader will go on forever until told to stop. It stores state on stack at "end" and uses IFUNC table entries (containing function pointer address). The ELF weird machine, called "Brainfu*k" (BF) has: 8 instructions: pointer inc, dec, inc indirect, dec indirect, jump forward, jump backward, print. Three registers - 3 registers Bx showed example BF source code that implemented a Turing machine printing "hello, world". More interesting was the next demo, where bx modified ping. Ping runs suid as root, but quickly drops privilege. BF modified the loader to disable the library function call dropping privilege, so it remained as root. Then BF modified the ping -t argument to execute the -t filename as root. It's best to show what this modified ping does with an example: $ whoami bx $ ping localhost -t backdoor.sh # executes backdoor $ whoami root $ The modified code increased from 285948 bytes to 290209 bytes. A BF tool compiles "executable" by modifying the symbol table in an existing ELF executable. The tool modifies .dynsym and .rela.dyn table, but not code or data. Privacy at the Handset: New FCC Rules? "Valkyrie" (Christie Dudley, Santa Clara Law JD candidate) Valkyrie talked about mobile handset privacy. Some background: Senator Franken (also a comedian) became alarmed about CarrierIQ, where the carriers track their customers. Franken asked the FCC to find out what obligations carriers think they have to protect privacy. The carriers' response was that they are doing just fine with self-regulation—no worries! Carriers need to collect data, such as missed calls, to maintain network quality. But carriers also sell data for marketing. Verizon sells customer data and enables this with a narrow privacy policy (only 1 month to opt out, with difficulties). The data sold is not individually identifiable and is aggregated. But Verizon recommends, as an aggregation workaround to "recollate" data to other databases to identify customers indirectly. The FCC has regulated telephone privacy since 1934 and mobile network privacy since 2007. Also, the carriers say mobile phone privacy is a FTC responsibility (not FCC). FTC is trying to improve mobile app privacy, but FTC has no authority over carrier / customer relationships. As a side note, Apple iPhones are unique as carriers have extra control over iPhones they don't have with other smartphones. As a result iPhones may be more regulated. Who are the consumer advocates? Everyone knows EFF, but EPIC (Electrnic Privacy Info Center), although more obsecure, is more relevant. What to do? Carriers must be accountable. Opt-in and opt-out at any time. Carriers need incentive to grant users control for those who want it, by holding them liable and responsible for breeches on their clock. Location information should be added current CPNI privacy protection, and require "Pen/trap" judicial order to obtain (and would still be a lower standard than 4th Amendment). Politics are on a pro-privacy swing now, with many senators and the Whitehouse. There will probably be new regulation soon, and enforcement will be a problem, but consumers will still have some benefit. Hacking Measured Boot and UEFI Dan Griffin, JWSecure, Inc., Seattle, @JWSdan Dan talked about hacking measured UEFI boot. First some terms: UEFI is a boot technology that is replacing BIOS (has whitelisting and blacklisting). UEFI protects devices against rootkits. TPM - hardware security device to store hashs and hardware-protected keys "secure boot" can control at firmware level what boot images can boot "measured boot" OS feature that tracks hashes (from BIOS, boot loader, krnel, early drivers). "remote attestation" allows remote validation and control based on policy on a remote attestation server. Microsoft pushing TPM (Windows 8 required), but Google is not. Intel TianoCore is the only open source for UEFI. Dan has Measured Boot Tool at http://mbt.codeplex.com/ with a demo where you can also view TPM data. TPM support already on enterprise-class machines. UEFI Weaknesses. UEFI toolkits are evolving rapidly, but UEFI has weaknesses: assume user is an ally trust TPM implicitly, and attached to computer hibernate file is unprotected (disk encryption protects against this) protection migrating from hardware to firmware delays in patching and whitelist updates will UEFI really be adopted by the mainstream (smartphone hardware support, bank support, apathetic consumer support) You Can't Buy Security: Building the Open Source InfoSec Program Boris Sverdlik, ISDPodcast.com co-host Boris talked about problems typical with current security audits. "IT Security" is an oxymoron—IT exists to enable buiness, uptime, utilization, reporting, but don't care about security—IT has conflict of interest. There's no Magic Bullet ("blinky box"), no one-size-fits-all solution (e.g., Intrusion Detection Systems (IDSs)). Regulations don't make you secure. The cloud is not secure (because of shared data and admin access). Defense and pen testing is not sexy. Auditors are not solution (security not a checklist)—what's needed is experience and adaptability—need soft skills. Step 1: First thing is to Google and learn the company end-to-end before you start. Get to know the management team (not IT team), meet as many people as you can. Don't use arbitrary values such as CISSP scores. Quantitive risk assessment is a myth (e.g. AV*EF-SLE). Learn different Business Units, legal/regulatory obligations, learn the business and where the money is made, verify company is protected from script kiddies (easy), learn sensitive information (IP, internal use only), and start with low-hanging fruit (customer service reps and social engineering). Step 2: Policies. Keep policies short and relevant. Generic SANS "security" boilerplate policies don't make sense and are not followed. Focus on acceptable use, data usage, communications, physical security. Step 3: Implementation: keep it simple stupid. Open source, although useful, is not free (implementation cost). Access controls with authentication & authorization for local and remote access. MS Windows has it, otherwise use OpenLDAP, OpenIAM, etc. Application security Everyone tries to reinvent the wheel—use existing static analysis tools. Review high-risk apps and major revisions. Don't run different risk level apps on same system. Assume host/client compromised and use app-level security control. Network security VLAN != segregated because there's too many workarounds. Use explicit firwall rules, active and passive network monitoring (snort is free), disallow end user access to production environment, have a proxy instead of direct Internet access. Also, SSL certificates are not good two-factor auth and SSL does not mean "safe." Operational Controls Have change, patch, asset, & vulnerability management (OSSI is free). For change management, always review code before pushing to production For logging, have centralized security logging for business-critical systems, separate security logging from administrative/IT logging, and lock down log (as it has everything). Monitor with OSSIM (open source). Use intrusion detection, but not just to fulfill a checkbox: build rules from a whitelist perspective (snort). OSSEC has 95% of what you need. Vulnerability management is a QA function when done right: OpenVas and Seccubus are free. Security awareness The reality is users will always click everything. Build real awareness, not compliance driven checkbox, and have it integrated into the culture. Pen test by crowd sourcing—test with logging COSSP http://www.cossp.org/ - Comprehensive Open Source Security Project What Journalists Want: The Investigative Reporters' Perspective on Hacking Dave Maas, San Diego CityBeat Jason Leopold, Truthout.org The difference between hackers and investigative journalists: For hackers, the motivation varies, but method is same, technological specialties. For investigative journalists, it's about one thing—The Story, and they need broad info-gathering skills. J-School in 60 Seconds: Generic formula: Person or issue of pubic interest, new info, or angle. Generic criteria: proximity, prominence, timeliness, human interest, oddity, or consequence. Media awareness of hackers and trends: journalists becoming extremely aware of hackers with congressional debates (privacy, data breaches), demand for data-mining Journalists, use of coding and web development for Journalists, and Journalists busted for hacking (Murdock). Info gathering by investigative journalists include Public records laws. Federal Freedom of Information Act (FOIA) is good, but slow. California Public Records Act is a lot stronger. FOIA takes forever because of foot-dragging—it helps to be specific. Often need to sue (especially FBI). CPRA is faster, and requests can be vague. Dumps and leaks (a la Wikileaks) Journalists want: leads, protecting ourselves, our sources, and adapting tools for news gathering (Google hacking). Anonomity is important to whistleblowers. They want no digital footprint left behind (e.g., email, web log). They don't trust encryption, want to feel safe and secure. Whistleblower laws are very weak—there's no upside for whistleblowers—they have to be very passionate to do it. Accessibility and Security or: How I Learned to Stop Worrying and Love the Halting Problem Anna Shubina, Dartmouth College Anna talked about how accessibility and security are related. Accessibility of digital content (not real world accessibility). mostly refers to blind users and screenreaders, for our purpose. Accessibility is about parsing documents, as are many security issues. "Rich" executable content causes accessibility to fail, and often causes security to fail. For example MS Word has executable format—it's not a document exchange format—more dangerous than PDF or HTML. Accessibility is often the first and maybe only sanity check with parsing. They have no choice because someone may want to read what you write. Google, for example, is very particular about web browser you use and are bad at supporting other browsers. Uses JavaScript instead of links, often requiring mouseover to display content. PDF is a security nightmare. Executible format, embedded flash, JavaScript, etc. 15 million lines of code. Google Chrome doesn't handle PDF correctly, causing several security bugs. PDF has an accessibility checker and PDF tagging, to help with accessibility. But no PDF checker checks for incorrect tags, untagged content, or validates lists or tables. None check executable content at all. The "Halting Problem" is: can one decide whether a program will ever stop? The answer, in general, is no (Rice's theorem). The same holds true for accessibility checkers. Language-theoretic Security says complicated data formats are hard to parse and cannot be solved due to the Halting Problem. W3C Web Accessibility Guidelines: "Perceivable, Operable, Understandable, Robust" Not much help though, except for "Robust", but here's some gems: * all information should be parsable (paraphrasing) * if not parsable, cannot be converted to alternate formats * maximize compatibility in new document formats Executible webpages are bad for security and accessibility. They say it's for a better web experience. But is it necessary to stuff web pages with JavaScript for a better experience? A good example is The Drudge Report—it has hand-written HTML with no JavaScript, yet drives a lot of web traffic due to good content. A bad example is Google News—hidden scrollbars, guessing user input. Solutions: Accessibility and security problems come from same source Expose "better user experience" myth Keep your corner of Internet parsable Remember "Halting Problem"—recognize false solutions (checking and verifying tools) Stop Patching, for Stronger PCI Compliance Adam Brand, protiviti @adamrbrand, http://www.picfun.com/ Adam talked about PCI compliance for retail sales. Take an example: for PCI compliance, 50% of Brian's time (a IT guy), 960 hours/year was spent patching POSs in 850 restaurants. Often applying some patches make no sense (like fixing a browser vulnerability on a server). "Scanner worship" is overuse of vulnerability scanners—it gives a warm and fuzzy and it's simple (red or green results—fix reds). Scanners give a false sense of security. In reality, breeches from missing patches are uncommon—more common problems are: default passwords, cleartext authentication, misconfiguration (firewall ports open). Patching Myths: Myth 1: install within 30 days of patch release (but PCI §6.1 allows a "risk-based approach" instead). Myth 2: vendor decides what's critical (also PCI §6.1). But §6.2 requires user ranking of vulnerabilities instead. Myth 3: scan and rescan until it passes. But PCI §11.2.1b says this applies only to high-risk vulnerabilities. Adam says good recommendations come from NIST 800-40. Instead use sane patching and focus on what's really important. From NIST 800-40: Proactive: Use a proactive vulnerability management process: use change control, configuration management, monitor file integrity. Monitor: start with NVD and other vulnerability alerts, not scanner results. Evaluate: public-facing system? workstation? internal server? (risk rank) Decide:on action and timeline Test: pre-test patches (stability, functionality, rollback) for change control Install: notify, change control, tickets McAfee Secure & Trustmarks — a Hacker's Best Friend Jay James, Shane MacDougall, Tactical Intelligence Inc., Canada "McAfee Secure Trustmark" is a website seal marketed by McAfee. A website gets this badge if they pass their remote scanning. The problem is a removal of trustmarks act as flags that you're vulnerable. Easy to view status change by viewing McAfee list on website or on Google. "Secure TrustGuard" is similar to McAfee. Jay and Shane wrote Perl scripts to gather sites from McAfee and search engines. If their certification image changes to a 1x1 pixel image, then they are longer certified. Their scripts take deltas of scans to see what changed daily. The bottom line is change in TrustGuard status is a flag for hackers to attack your site. Entire idea of seals is silly—you're raising a flag saying if you're vulnerable.

    Read the article

  • Ubuntu 14.04 Failed to load module udlfb

    - by jar276705
    DisplayLink doesn't load and run. The adapter is recognized and /dev/FB1 is created. USB bus info: Bus 001 Device 006: ID 17e9:0198 DisplayLink Xorg.0.log: X.Org X Server 1.15.1 Release Date: 2014-04-13 [ 44708.386] X Protocol Version 11, Revision 0 [ 44708.389] Build Operating System: Linux 3.2.0-37-generic i686 Ubuntu [ 44708.392] Current Operating System: Linux rrl 3.13.0-24-generic #46-Ubuntu SMP Thu Apr 10 19:08:14 UTC 2014 i686 [ 44708.392] Kernel command line: BOOT_IMAGE=/boot/vmlinuz-3.13.0-24-generic root=UUID=6b719a77-29e0-4668-8f16-57d0d3a73a3f ro quiet splash vt.handoff=7 [ 44708.399] Build Date: 16 April 2014 01:40:08PM [ 44708.402] xorg-server 2:1.15.1-0ubuntu2 (For technical support please see http://www.ubuntu.com/support) [ 44708.405] Current version of pixman: 0.30.2 [ 44708.412] Before reporting problems, check http://wiki.x.org to make sure that you have the latest version. [ 44708.412] Markers: (--) probed, (**) from config file, (==) default setting, (++) from command line, (!!) notice, (II) informational, (WW) warning, (EE) error, (NI) not implemented, (??) unknown. [ 44708.427] (==) Log file: "/var/log/Xorg.0.log", Time: Thu May 1 09:38:27 2014 [ 44708.431] (==) Using config file: "/etc/X11/xorg.conf" [ 44708.434] (==) Using system config directory "/usr/share/X11/xorg.conf.d" [ 44708.435] (==) ServerLayout "X.org Configured" [ 44708.435] (**) |-->Screen "DisplayLinkScreen" (0) [ 44708.435] (**) | |-->Monitor "DisplayLinkMonitor" [ 44708.435] (**) | |-->Device "DisplayLinkDevice" [ 44708.435] (**) |-->Screen "Screen0" (1) [ 44708.435] (**) | |-->Monitor "Monitor0" [ 44708.435] (**) | |-->Device "Card0" [ 44708.435] (**) |-->Input Device "Mouse0" [ 44708.435] (**) |-->Input Device "Keyboard0" [ 44708.435] (==) Automatically adding devices [ 44708.435] (==) Automatically enabling devices [ 44708.435] (==) Automatically adding GPU devices [ 44708.435] (WW) The directory "/usr/share/fonts/X11/cyrillic" does not exist. [ 44708.435] Entry deleted from font path. [ 44708.435] (WW) The directory "/usr/share/fonts/X11/75dpi/" does not exist. [ 44708.435] Entry deleted from font path. [ 44708.435] (WW) The directory "/usr/share/fonts/X11/75dpi" does not exist. [ 44708.435] Entry deleted from font path. [ 44708.435] (WW) The directory "/usr/share/fonts/X11/cyrillic" does not exist. [ 44708.435] Entry deleted from font path. [ 44708.435] (WW) The directory "/usr/share/fonts/X11/75dpi/" does not exist. [ 44708.435] Entry deleted from font path. [ 44708.435] (WW) The directory "/usr/share/fonts/X11/75dpi" does not exist. [ 44708.435] Entry deleted from font path. [ 44708.435] (**) FontPath set to: /usr/share/fonts/X11/misc, /usr/share/fonts/X11/100dpi/:unscaled, /usr/share/fonts/X11/Type1, /usr/share/fonts/X11/100dpi, built-ins, /usr/share/fonts/X11/misc, /usr/share/fonts/X11/100dpi/:unscaled, /usr/share/fonts/X11/Type1, /usr/share/fonts/X11/100dpi, built-ins [ 44708.435] (**) ModulePath set to "/usr/lib/xorg/modules" [ 44708.435] (WW) Hotplugging is on, devices using drivers 'kbd', 'mouse' or 'vmmouse' will be disabled. [ 44708.435] (WW) Disabling Mouse0 [ 44708.435] (WW) Disabling Keyboard0 [ 44708.435] (II) Loader magic: 0xb77106c0 [ 44708.435] (II) Module ABI versions: [ 44708.435] X.Org ANSI C Emulation: 0.4 [ 44708.435] X.Org Video Driver: 15.0 [ 44708.435] X.Org XInput driver : 20.0 [ 44708.435] X.Org Server Extension : 8.0 [ 44708.436] (II) xfree86: Adding drm device (/dev/dri/card0) [ 44708.436] (II) xfree86: Adding drm device (/dev/dri/card1) [ 44708.437] (--) PCI:*(0:1:5:0) 1002:9616:105b:0e26 rev 0, Mem @ 0xf0000000/134217728, 0xfeae0000/65536, 0xfe900000/1048576, I/O @ 0x0000b000/256 [ 44708.441] Initializing built-in extension Generic Event Extension [ 44708.444] Initializing built-in extension SHAPE [ 44708.448] Initializing built-in extension MIT-SHM [ 44708.452] Initializing built-in extension XInputExtension [ 44708.456] Initializing built-in extension XTEST [ 44708.460] Initializing built-in extension BIG-REQUESTS [ 44708.464] Initializing built-in extension SYNC [ 44708.468] Initializing built-in extension XKEYBOARD [ 44708.471] Initializing built-in extension XC-MISC [ 44708.475] Initializing built-in extension SECURITY [ 44708.479] Initializing built-in extension XINERAMA [ 44708.483] Initializing built-in extension XFIXES [ 44708.487] Initializing built-in extension RENDER [ 44708.491] Initializing built-in extension RANDR [ 44708.494] Initializing built-in extension COMPOSITE [ 44708.498] Initializing built-in extension DAMAGE [ 44708.502] Initializing built-in extension MIT-SCREEN-SAVER [ 44708.506] Initializing built-in extension DOUBLE-BUFFER [ 44708.510] Initializing built-in extension RECORD [ 44708.513] Initializing built-in extension DPMS [ 44708.517] Initializing built-in extension Present [ 44708.521] Initializing built-in extension DRI3 [ 44708.525] Initializing built-in extension X-Resource [ 44708.528] Initializing built-in extension XVideo [ 44708.532] Initializing built-in extension XVideo-MotionCompensation [ 44708.535] Initializing built-in extension SELinux [ 44708.539] Initializing built-in extension XFree86-VidModeExtension [ 44708.542] Initializing built-in extension XFree86-DGA [ 44708.546] Initializing built-in extension XFree86-DRI [ 44708.549] Initializing built-in extension DRI2 [ 44708.549] (II) "glx" will be loaded. This was enabled by default and also specified in the config file. [ 44708.549] (WW) "xmir" is not to be loaded by default. Skipping. [ 44708.549] (II) LoadModule: "glx" [ 44708.549] (II) Loading /usr/lib/xorg/modules/extensions/libglx.so [ 44708.550] (II) Module glx: vendor="X.Org Foundation" [ 44708.550] compiled for 1.15.1, module version = 1.0.0 [ 44708.550] ABI class: X.Org Server Extension, version 8.0 [ 44708.550] (==) AIGLX enabled [ 44708.553] Loading extension GLX [ 44708.553] (II) LoadModule: "udlfb" [ 44708.554] (WW) Warning, couldn't open module udlfb [ 44708.554] (II) UnloadModule: "udlfb" [ 44708.554] (II) Unloading udlfb [ 44708.554] (EE) Failed to load module "udlfb" (module does not exist, 0) [ 44708.554] (II) LoadModule: "modesetting" [ 44708.554] (II) Loading /usr/lib/xorg/modules/drivers/modesetting_drv.so [ 44708.554] (II) Module modesetting: vendor="X.Org Foundation" [ 44708.554] compiled for 1.15.0, module version = 0.8.1 [ 44708.554] Module class: X.Org Video Driver [ 44708.554] ABI class: X.Org Video Driver, version 15.0 [ 44708.554] (==) Matched fglrx as autoconfigured driver 0 [ 44708.554] (==) Matched ati as autoconfigured driver 1 [ 44708.554] (==) Matched fglrx as autoconfigured driver 2 [ 44708.554] (==) Matched ati as autoconfigured driver 3 [ 44708.554] (==) Matched modesetting as autoconfigured driver 4 [ 44708.554] (==) Matched fbdev as autoconfigured driver 5 [ 44708.554] (==) Matched vesa as autoconfigured driver 6 [ 44708.554] (==) Assigned the driver to the xf86ConfigLayout [ 44708.554] (II) LoadModule: "fglrx" [ 44708.554] (WW) Warning, couldn't open module fglrx [ 44708.554] (II) UnloadModule: "fglrx" [ 44708.554] (II) Unloading fglrx [ 44708.554] (EE) Failed to load module "fglrx" (module does not exist, 0) [ 44708.554] (II) LoadModule: "ati" [ 44708.554] (II) Loading /usr/lib/xorg/modules/drivers/ati_drv.so [ 44708.554] (II) Module ati: vendor="X.Org Foundation" [ 44708.554] compiled for 1.15.0, module version = 7.3.0 [ 44708.554] Module class: X.Org Video Driver [ 44708.554] ABI class: X.Org Video Driver, version 15.0 [ 44708.554] (II) LoadModule: "radeon" [ 44708.555] (II) Loading /usr/lib/xorg/modules/drivers/radeon_drv.so [ 44708.555] (II) Module radeon: vendor="X.Org Foundation" [ 44708.555] compiled for 1.15.0, module version = 7.3.0 [ 44708.555] Module class: X.Org Video Driver [ 44708.555] ABI class: X.Org Video Driver, version 15.0 [ 44708.555] (II) LoadModule: "modesetting" [ 44708.555] (II) Loading /usr/lib/xorg/modules/drivers/modesetting_drv.so [ 44708.555] (II) Module modesetting: vendor="X.Org Foundation" [ 44708.555] compiled for 1.15.0, module version = 0.8.1 [ 44708.555] Module class: X.Org Video Driver [ 44708.555] ABI class: X.Org Video Driver, version 15.0 [ 44708.555] (II) UnloadModule: "modesetting" [ 44708.555] (II) Unloading modesetting [ 44708.555] (II) Failed to load module "modesetting" (already loaded, 0) [ 44708.555] (II) LoadModule: "fbdev" [ 44708.555] (II) Loading /usr/lib/xorg/modules/drivers/fbdev_drv.so [ 44708.555] (II) Module fbdev: vendor="X.Org Foundation" [ 44708.555] compiled for 1.15.0, module version = 0.4.4 [ 44708.555] Module class: X.Org Video Driver [ 44708.555] ABI class: X.Org Video Driver, version 15.0 [ 44708.555] (II) LoadModule: "vesa" [ 44708.555] (II) Loading /usr/lib/xorg/modules/drivers/vesa_drv.so [ 44708.555] (II) Module vesa: vendor="X.Org Foundation" [ 44708.555] compiled for 1.15.0, module version = 2.3.3 [ 44708.555] Module class: X.Org Video Driver [ 44708.555] ABI class: X.Org Video Driver, version 15.0 [ 44708.555] (II) modesetting: Driver for Modesetting Kernel Drivers: kms [ 44708.555] (II) RADEON: Driver for ATI Radeon chipsets: [ 44708.560] (II) FBDEV: driver for framebuffer: fbdev [ 44708.560] (II) VESA: driver for VESA chipsets: vesa [ 44708.560] (--) using VT number 7 [ 44708.578] (II) modesetting(0): using drv /dev/dri/card0 [ 44708.578] (II) modesetting(G0): using drv /dev/dri/card1 [ 44708.578] (WW) Falling back to old probe method for fbdev [ 44708.578] (II) Loading sub module "fbdevhw" [ 44708.578] (II) LoadModule: "fbdevhw" [ 44708.578] (II) Loading /usr/lib/xorg/modules/libfbdevhw.so [ 44708.578] (II) Module fbdevhw: vendor="X.Org Foundation" [ 44708.578] compiled for 1.15.1, module version = 0.0.2 [ 44708.578] ABI class: X.Org Video Driver, version 15.0 [ 44708.578] (WW) Falling back to old probe method for vesa [ 44708.578] (**) modesetting(0): Depth 16, (--) framebuffer bpp 16 [ 44708.578] (==) modesetting(0): RGB weight 565 [ 44708.578] (==) modesetting(0): Default visual is TrueColor [ 44708.578] (II) modesetting(0): ShadowFB: preferred YES, enabled YES [ 44708.608] (II) modesetting(0): Output VGA-0 using monitor section DisplayLinkMonitor [ 44708.610] (II) modesetting(0): Output DVI-0 has no monitor section [ 44708.640] (II) modesetting(0): EDID for output VGA-0 [ 44708.640] (II) modesetting(0): Manufacturer: ACR Model: 74 Serial#: 2483090993 [ 44708.640] (II) modesetting(0): Year: 2009 Week: 40 [ 44708.640] (II) modesetting(0): EDID Version: 1.3 [ 44708.640] (II) modesetting(0): Analog Display Input, Input Voltage Level: 0.700/0.700 V [ 44708.640] (II) modesetting(0): Sync: Separate [ 44708.640] (II) modesetting(0): Max Image Size [cm]: horiz.: 53 vert.: 29 [ 44708.640] (II) modesetting(0): Gamma: 2.20 [ 44708.640] (II) modesetting(0): DPMS capabilities: StandBy Suspend Off; RGB/Color Display [ 44708.641] (II) modesetting(0): First detailed timing is preferred mode [ 44708.641] (II) modesetting(0): redX: 0.649 redY: 0.338 greenX: 0.289 greenY: 0.609 [ 44708.641] (II) modesetting(0): blueX: 0.146 blueY: 0.070 whiteX: 0.313 whiteY: 0.329 [ 44708.641] (II) modesetting(0): Supported established timings: [ 44708.641] (II) modesetting(0): 720x400@70Hz [ 44708.641] (II) modesetting(0): 640x480@60Hz [ 44708.641] (II) modesetting(0): 640x480@72Hz [ 44708.641] (II) modesetting(0): 640x480@75Hz [ 44708.641] (II) modesetting(0): 800x600@56Hz [ 44708.641] (II) modesetting(0): 800x600@60Hz [ 44708.641] (II) modesetting(0): 800x600@72Hz [ 44708.641] (II) modesetting(0): 800x600@75Hz [ 44708.641] (II) modesetting(0): 1024x768@60Hz [ 44708.641] (II) modesetting(0): 1024x768@70Hz [ 44708.641] (II) modesetting(0): 1024x768@75Hz [ 44708.641] (II) modesetting(0): 1280x1024@75Hz [ 44708.641] (II) modesetting(0): Manufacturer's mask: 0 [ 44708.641] (II) modesetting(0): Supported standard timings: [ 44708.641] (II) modesetting(0): #0: hsize: 1280 vsize 1024 refresh: 60 vid: 32897 [ 44708.641] (II) modesetting(0): #1: hsize: 1152 vsize 864 refresh: 75 vid: 20337 [ 44708.641] (II) modesetting(0): #2: hsize: 1440 vsize 900 refresh: 60 vid: 149 [ 44708.641] (II) modesetting(0): #3: hsize: 1440 vsize 900 refresh: 75 vid: 3989 [ 44708.641] (II) modesetting(0): #4: hsize: 1600 vsize 1200 refresh: 60 vid: 16553 [ 44708.641] (II) modesetting(0): #5: hsize: 1680 vsize 1050 refresh: 60 vid: 179 [ 44708.641] (II) modesetting(0): Supported detailed timing: [ 44708.641] (II) modesetting(0): clock: 138.5 MHz Image Size: 531 x 298 mm [ 44708.641] (II) modesetting(0): h_active: 1920 h_sync: 1968 h_sync_end 2000 h_blank_end 2080 h_border: 0 [ 44708.641] (II) modesetting(0): v_active: 1080 v_sync: 1083 v_sync_end 1088 v_blanking: 1111 v_border: 0 [ 44708.641] (II) modesetting(0): Monitor name: H243H [ 44708.641] (II) modesetting(0): Ranges: V min: 56 V max: 76 Hz, H min: 31 H max: 83 kHz, PixClock max 185 MHz [ 44708.641] (II) modesetting(0): Serial No: LEW0C0044002 [ 44708.641] (II) modesetting(0): EDID (in hex): [ 44708.641] (II) modesetting(0): 00ffffffffffff000472740031f60094 [ 44708.641] (II) modesetting(0): 2813010368351d78ea6085a6564a9c25 [ 44708.641] (II) modesetting(0): 125054afcf008180714f9500950fa940 [ 44708.641] (II) modesetting(0): b300010101011a3680a070381f403020 [ 44708.641] (II) modesetting(0): 3500132a2100001a000000fc00483234 [ 44708.642] (II) modesetting(0): 33480a20202020202020000000fd0038 [ 44708.642] (II) modesetting(0): 4c1f5312000a202020202020000000ff [ 44708.642] (II) modesetting(0): 004c45573043303034343030320a003c [ 44708.642] (II) modesetting(0): Printing probed modes for output VGA-0 [ 44708.642] (II) modesetting(0): Modeline "1280x1024"x75.0 135.00 1280 1296 1440 1688 1024 1025 1028 1066 +hsync +vsync (80.0 kHz UeP) [ 44708.642] (II) modesetting(0): Modeline "1920x1080"x59.9 138.50 1920 1968 2000 2080 1080 1083 1088 1111 +hsync -vsync (66.6 kHz eP) [ 44708.642] (II) modesetting(0): Modeline "1600x1200"x60.0 162.00 1600 1664 1856 2160 1200 1201 1204 1250 +hsync +vsync (75.0 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1680x1050"x60.0 146.25 1680 1784 1960 2240 1050 1053 1059 1089 -hsync +vsync (65.3 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1280x1024"x60.0 108.00 1280 1328 1440 1688 1024 1025 1028 1066 +hsync +vsync (64.0 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1440x900"x75.0 136.75 1440 1536 1688 1936 900 903 909 942 -hsync +vsync (70.6 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1440x900"x59.9 106.50 1440 1520 1672 1904 900 903 909 934 -hsync +vsync (55.9 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1152x864"x75.0 108.00 1152 1216 1344 1600 864 865 868 900 +hsync +vsync (67.5 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1024x768"x75.1 78.80 1024 1040 1136 1312 768 769 772 800 +hsync +vsync (60.1 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1024x768"x70.1 75.00 1024 1048 1184 1328 768 771 777 806 -hsync -vsync (56.5 kHz e) [ 44708.642] (II) modesetting(0): Modeline "1024x768"x60.0 65.00 1024 1048 1184 1344 768 771 777 806 -hsync -vsync (48.4 kHz e) [ 44708.642] (II) modesetting(0): Modeline "800x600"x72.2 50.00 800 856 976 1040 600 637 643 666 +hsync +vsync (48.1 kHz e) [ 44708.642] (II) modesetting(0): Modeline "800x600"x75.0 49.50 800 816 896 1056 600 601 604 625 +hsync +vsync (46.9 kHz e) [ 44708.642] (II) modesetting(0): Modeline "800x600"x60.3 40.00 800 840 968 1056 600 601 605 628 +hsync +vsync (37.9 kHz e) [ 44708.642] (II) modesetting(0): Modeline "800x600"x56.2 36.00 800 824 896 1024 600 601 603 625 +hsync +vsync (35.2 kHz e) [ 44708.642] (II) modesetting(0): Modeline "640x480"x75.0 31.50 640 656 720 840 480 481 484 500 -hsync -vsync (37.5 kHz e) [ 44708.642] (II) modesetting(0): Modeline "640x480"x72.8 31.50 640 664 704 832 480 489 491 520 -hsync -vsync (37.9 kHz e) [ 44708.642] (II) modesetting(0): Modeline "640x480"x60.0 25.20 640 656 752 800 480 490 492 525 -hsync -vsync (31.5 kHz e) [ 44708.642] (II) modesetting(0): Modeline "720x400"x70.1 28.32 720 738 846 900 400 412 414 449 -hsync +vsync (31.5 kHz e) [ 44708.645] (II) modesetting(0): EDID for output DVI-0 [ 44708.645] (II) modesetting(0): Output VGA-0 connected [ 44708.645] (II) modesetting(0): Output DVI-0 disconnected [ 44708.645] (II) modesetting(0): Using user preference for initial modes [ 44708.645] (II) modesetting(0): Output VGA-0 using initial mode 1280x1024 [ 44708.645] (II) modesetting(0): Using default gamma of (1.0, 1.0, 1.0) unless otherwise stated. [ 44708.645] (==) modesetting(0): DPI set to (96, 96) [ 44708.645] (II) Loading sub module "fb" [ 44708.645] (II) LoadModule: "fb" [ 44708.645] (II) Loading /usr/lib/xorg/modules/libfb.so [ 44708.645] (II) Module fb: vendor="X.Org Foundation" [ 44708.645] compiled for 1.15.1, module version = 1.0.0 [ 44708.645] ABI class: X.Org ANSI C Emulation, version 0.4 [ 44708.645] (II) Loading sub module "shadow" [ 44708.645] (II) LoadModule: "shadow" [ 44708.646] (II) Loading /usr/lib/xorg/modules/libshadow.so [ 44708.646] (II) Module shadow: vendor="X.Org Foundation" [ 44708.646] compiled for 1.15.1, module version = 1.1.0 [ 44708.646] ABI class: X.Org ANSI C Emulation, version 0.4 [ 44708.646] (**) modesetting(G0): Depth 16, (--) framebuffer bpp 16 [ 44708.646] (==) modesetting(G0): RGB weight 565 [ 44708.646] (==) modesetting(G0): Default visual is TrueColor [ 44708.646] (II) modesetting(G0): ShadowFB: preferred NO, enabled NO [ 44708.727] (II) modesetting(G0): Output DVI-1-0 using monitor section DisplayLinkMonitor [ 44708.808] (II) modesetting(G0): EDID for output DVI-1-0 [ 44708.808] (II) modesetting(G0): Manufacturer: WDE Model: 1702 Serial#: 0 [ 44708.808] (II) modesetting(G0): Year: 2005 Week: 14 [ 44708.808] (II) modesetting(G0): EDID Version: 1.3 [ 44708.808] (II) modesetting(G0): Analog Display Input, Input Voltage Level: 0.700/0.700 V [ 44708.808] (II) modesetting(G0): Sync: Separate [ 44708.808] (II) modesetting(G0): Max Image Size [cm]: horiz.: 34 vert.: 27 [ 44708.808] (II) modesetting(G0): Gamma: 2.20 [ 44708.808] (II) modesetting(G0): DPMS capabilities: StandBy Suspend Off; RGB/Color Display [ 44708.808] (II) modesetting(G0): Default color space is primary color space [ 44708.808] (II) modesetting(G0): First detailed timing is preferred mode [ 44708.808] (II) modesetting(G0): GTF timings supported [ 44708.808] (II) modesetting(G0): redX: 0.643 redY: 0.352 greenX: 0.283 greenY: 0.608 [ 44708.808] (II) modesetting(G0): blueX: 0.147 blueY: 0.102 whiteX: 0.313 whiteY: 0.329 [ 44708.808] (II) modesetting(G0): Supported established timings: [ 44708.808] (II) modesetting(G0): 720x400@70Hz [ 44708.808] (II) modesetting(G0): 640x480@60Hz [ 44708.808] (II) modesetting(G0): 640x480@67Hz [ 44708.808] (II) modesetting(G0): 640x480@72Hz [ 44708.808] (II) modesetting(G0): 640x480@75Hz [ 44708.808] (II) modesetting(G0): 800x600@56Hz [ 44708.808] (II) modesetting(G0): 800x600@60Hz [ 44708.808] (II) modesetting(G0): 800x600@72Hz [ 44708.808] (II) modesetting(G0): 800x600@75Hz [ 44708.808] (II) modesetting(G0): 832x624@75Hz [ 44708.808] (II) modesetting(G0): 1024x768@60Hz [ 44708.808] (II) modesetting(G0): 1024x768@70Hz [ 44708.808] (II) modesetting(G0): 1024x768@75Hz [ 44708.809] (II) modesetting(G0): 1280x1024@75Hz [ 44708.809] (II) modesetting(G0): Manufacturer's mask: 0 [ 44708.809] (II) modesetting(G0): Supported standard timings: [ 44708.809] (II) modesetting(G0): #0: hsize: 1280 vsize 1024 refresh: 60 vid: 32897 [ 44708.809] (II) modesetting(G0): #1: hsize: 1152 vsize 864 refresh: 75 vid: 20337 [ 44708.809] (II) modesetting(G0): Supported detailed timing: [ 44708.809] (II) modesetting(G0): clock: 108.0 MHz Image Size: 338 x 270 mm [ 44708.809] (II) modesetting(G0): h_active: 1280 h_sync: 1328 h_sync_end 1440 h_blank_end 1688 h_border: 0 [ 44708.809] (II) modesetting(G0): v_active: 1024 v_sync: 1025 v_sync_end 1028 v_blanking: 1066 v_border: 0 [ 44708.809] (II) modesetting(G0): Ranges: V min: 50 V max: 75 Hz, H min: 30 H max: 82 kHz, PixClock max 145 MHz [ 44708.809] (II) modesetting(G0): Monitor name: WDE LCM-17v2 [ 44708.809] (II) modesetting(G0): Serial No: 0 [ 44708.809] (II) modesetting(G0): EDID (in hex): [ 44708.809] (II) modesetting(G0): 00ffffffffffff005c85021700000000 [ 44708.809] (II) modesetting(G0): 0e0f010368221b78ef8bc5a45a489b25 [ 44708.809] (II) modesetting(G0): 1a5054bfef008180714f010101010101 [ 44708.809] (II) modesetting(G0): 010101010101302a009851002a403070 [ 44708.809] (II) modesetting(G0): 1300520e1100001e000000fd00324b1e [ 44708.809] (II) modesetting(G0): 520e000a202020202020000000fc0057 [ 44708.809] (II) modesetting(G0): 4445204c434d2d313776320a000000ff [ 44708.809] (II) modesetting(G0): 00300a202020202020202020202000e7 [ 44708.809] (II) modesetting(G0): Printing probed modes for output DVI-1-0 [ 44708.809] (II) modesetting(G0): Modeline "1280x1024"x60.0 108.00 1280 1328 1440 1688 1024 1025 1028 1066 +hsync +vsync (64.0 kHz UeP) [ 44708.809] (II) modesetting(G0): Modeline "1280x1024"x75.0 135.00 1280 1296 1440 1688 1024 1025 1028 1066 +hsync +vsync (80.0 kHz e) [ 44708.809] (II) modesetting(G0): Modeline "1280x960"x60.0 108.00 1280 1376 1488 1800 960 961 964 1000 +hsync +vsync (60.0 kHz e) [ 44708.809] (II) modesetting(G0): Modeline "1280x800"x74.9 106.50 1280 1360 1488 1696 800 803 809 838 -hsync +vsync (62.8 kHz e) [ 44708.809] (II) modesetting(G0): Modeline "1280x800"x59.8 83.50 1280 1352 1480 1680 800 803 809 831 +hsync -vsync (49.7 kHz e) [ 44708.809] (II) modesetting(G0): Modeline "1152x864"x75.0 108.00 1152 1216 1344 1600 864 865 868 900 +hsync +vsync (67.5 kHz e) [ 44708.809] (II) modesetting(G0): Modeline "1280x768"x74.9 102.25 1280 1360 1488 1696 768 771 778 805 +hsync -vsync (60.3 kHz e) [ 44708.809] (II) modesetting(G0): Modeline "1280x768"x59.9 79.50 1280 1344 1472 1664 768 771 778 798 -hsync +vsync (47.8 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "1024x768"x75.1 78.80 1024 1040 1136 1312 768 769 772 800 +hsync +vsync (60.1 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "1024x768"x70.1 75.00 1024 1048 1184 1328 768 771 777 806 -hsync -vsync (56.5 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "1024x768"x60.0 65.00 1024 1048 1184 1344 768 771 777 806 -hsync -vsync (48.4 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "1024x576"x60.0 46.97 1024 1064 1168 1312 576 577 580 597 -hsync +vsync (35.8 kHz) [ 44708.810] (II) modesetting(G0): Modeline "832x624"x74.6 57.28 832 864 928 1152 624 625 628 667 -hsync -vsync (49.7 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "800x600"x72.2 50.00 800 856 976 1040 600 637 643 666 +hsync +vsync (48.1 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "800x600"x75.0 49.50 800 816 896 1056 600 601 604 625 +hsync +vsync (46.9 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "800x600"x60.3 40.00 800 840 968 1056 600 601 605 628 +hsync +vsync (37.9 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "800x600"x56.2 36.00 800 824 896 1024 600 601 603 625 +hsync +vsync (35.2 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "848x480"x60.0 33.75 848 864 976 1088 480 486 494 517 +hsync +vsync (31.0 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "640x480"x75.0 31.50 640 656 720 840 480 481 484 500 -hsync -vsync (37.5 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "640x480"x72.8 31.50 640 664 704 832 480 489 491 520 -hsync -vsync (37.9 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "640x480"x66.7 30.24 640 704 768 864 480 483 486 525 -hsync -vsync (35.0 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "640x480"x60.0 25.20 640 656 752 800 480 490 492 525 -hsync -vsync (31.5 kHz e) [ 44708.810] (II) modesetting(G0): Modeline "720x400"x70.1 28.32 720 738 846 900 400 412 414 449 -hsync +vsync (31.5 kHz e) [ 44708.810] (II) modesetting(G0): Using default gamma of (1.0, 1.0, 1.0) unless otherwise stated. [ 44708.810] (==) modesetting(G0): DPI set to (96, 96) [ 44708.810] (II) Loading sub module "fb" [ 44708.810] (II) LoadModule: "fb" [ 44708.810] (II) Loading /usr/lib/xorg/modules/libfb.so [ 44708.810] (II) Module fb: vendor="X.Org Foundation" [ 44708.810] compiled for 1.15.1, module version = 1.0.0 [ 44708.811] ABI class: X.Org ANSI C Emulation, version 0.4 [ 44708.811] (II) UnloadModule: "radeon" [ 44708.811] (II) Unloading radeon [ 44708.811] (II) UnloadModule: "fbdev" [ 44708.811] (II) Unloading fbdev [ 44708.811] (II) UnloadSubModule: "fbdevhw" [ 44708.811] (II) Unloading fbdevhw [ 44708.811] (II) UnloadModule: "vesa" [ 44708.811] (II) Unloading vesa [ 44708.811] (==) modesetting(G0): Backing store enabled [ 44708.811] (==) modesetting(G0): Silken mouse enabled [ 44708.812] (II) modesetting(G0): RandR 1.2 enabled, ignore the following RandR disabled message. [ 44708.812] (==) modesetting(G0): DPMS enabled [ 44708.812] (WW) modesetting(G0): Option "fbdev" is not used [ 44708.812] (==) modesetting(0): Backing store enabled [ 44708.812] (==) modesetting(0): Silken mouse enabled [ 44708.812] (II) modesetting(0): RandR 1.2 enabled, ignore the following RandR disabled message. [ 44708.812] (==) modesetting(0): DPMS enabled [ 44708.812] (WW) modesetting(0): Option "fbdev" is not used [ 44708.856] (--) RandR disabled [ 44708.867] (II) SELinux: Disabled on system [ 44708.868] (II) AIGLX: Screen 0 is not DRI2 capable [ 44708.868] (EE) AIGLX: reverting to software rendering [ 44708.878] (II) AIGLX: Loaded and initialized swrast [ 44708.878] (II) GLX: Initialized DRISWRAST GL provider for screen 0 [ 44708.879] (II) modesetting(G0): Damage tracking initialized [ 44708.879] (II) modesetting(0): Damage tracking initialized [ 44708.879] (II) modesetting(0): Setting screen physical size to 338 x 270 [ 44708.900] (II) XKB: generating xkmfile /tmp/server-B20D7FC79C7F597315E3E501AEF10E0D866E8E92.xkm [ 44708.918] (II) config/udev: Adding input device Power Button (/dev/input/event1) [ 44708.918] (**) Power Button: Applying InputClass "evdev keyboard catchall" [ 44708.918] (II) LoadModule: "evdev" [ 44708.918] (II) Loading /usr/lib/xorg/modules/input/evdev_drv.so [ 44708.918] (II) Module evdev: vendor="X.Org Foundation" [ 44708.918] compiled for 1.15.0, module version = 2.8.2 [ 44708.918] Module class: X.Org XInput Driver [ 44708.918] ABI class: X.Org XInput driver, version 20.0 [ 44708.918] (II) Using input driver 'evdev' for 'Power Button' [ 44708.918] (**) Power Button: always reports core events [ 44708.918] (**) evdev: Power Button: Device: "/dev/input/event1" [ 44708.918] (--) evdev: Power Button: Vendor 0 Product 0x1 [ 44708.918] (--) evdev: Power Button: Found keys [ 44708.918] (II) evdev: Power Button: Configuring as keyboard [ 44708.918] (**) Option "config_info" "udev:/sys/devices/LNXSYSTM:00/LNXPWRBN:00/input/input1/event1" [ 44708.918] (II) XINPUT: Adding extended input device "Power Button" (type: KEYBOARD, id 6) [ 44708.918] (**) Option "xkb_rules" "evdev" [ 44708.918] (**) Option "xkb_model" "pc105" [ 44708.918] (**) Option "xkb_layout" "us" [ 44708.919] (II) config/udev: Adding input device Power Button (/dev/input/event0) [ 44708.919] (**) Power Button: Applying InputClass "evdev keyboard catchall" [ 44708.919] (II) Using input driver 'evdev' for 'Power Button' [ 44708.919] (**) Power Button: always reports core events [ 44708.919] (**) evdev: Power Button: Device: "/dev/input/event0" [ 44708.919] (--) evdev: Power Button: Vendor 0 Product 0x1 [ 44708.919] (--) evdev: Power Button: Found keys [ 44708.919] (II) evdev: Power Button: Configuring as keyboard [ 44708.919] (**) Option "config_info" "udev:/sys/devices/LNXSYSTM:00/device:00/PNP0C0C:00/input/input0/event0" Is there anything I can do to fix this problem.

    Read the article

  • Xorg.conf (nvidia) Second Monitor getting settings of first

    - by HennyH
    I've been spending the weekend (and some time before that) trying to set up my Korean QHD270 and Benq G2222HDL monitors with Ubuntu 13.10. With the nouveau drivers install both monitor function perfectly fine. After installing the nvidia drivers the Benq works but the QHD270 does not. Now, after days of struggling I managed to get the QHD270 to work following a mixture of blogs, particularly; this one and learnitwithme. Now, unfortunatly my G2222HDL does not work. I fixed the QHD270 by supplying a custom EDID, my xorg.conf looks like so (excluding keyboard and mouse): Section "ServerLayout" Identifier "Layout0" Screen "Default Screen" 0 0 InputDevice "Keyboard0" "CoreKeyboard" InputDevice "Mouse0" "CorePointer" EndSection Section "Monitor" Identifier "Configured Monitor" EndSection Section "Device" Identifier "Configured Video Device" Driver "nvidia" Option "CustomEDID" "DFP:/etc/X11/edid-shimian.bin" EndSection Section "Screen" Identifier "Default Screen" Device "Configured Video Device" Monitor "Configured Monitor" EndSection Now, I tried defining a new Device,Monitor and Screen then in ServerLayout adding Screen "Second Screen" RightOf "Default Screen", but after doing so neither monitor worked. Hoping to fix the issue using a GUI based tool I opened up NVIDIA X Server Settings, which shows my current layout as: It seems that something is being output to the monitor, as suggested by my print screen: Any help would be greatly appreciated. Output of xrandr: Screen 0: minimum 8 x 8, current 5120 x 1440, maximum 16384 x 16384 DVI-I-0 disconnected (normal left inverted right x axis y axis) DVI-I-1 connected primary 2560x1440+0+0 (normal left inverted right x axis y axis) 597mm x 336mm 2560x1440 60.0*+ HDMI-0 disconnected (normal left inverted right x axis y axis) DP-0 disconnected (normal left inverted right x axis y axis) DVI-D-0 connected 2560x1440+2560+0 (normal left inverted right x axis y axis) 597mm x 336mm 2560x1440 60.0*+ DP-1 disconnected (normal left inverted right x axis y axis) And an extract from my log file (perhaps this is relevant?) [ 7.862] (--) NVIDIA(0): Valid display device(s) on GeForce GTX 680 at PCI:2:0:0 [ 7.862] (--) NVIDIA(0): CRT-0 [ 7.862] (--) NVIDIA(0): ACB QHD270 (DFP-0) (boot, connected) [ 7.862] (--) NVIDIA(0): DFP-1 [ 7.862] (--) NVIDIA(0): DFP-2 [ 7.862] (--) NVIDIA(0): DFP-3 [ 7.862] (--) NVIDIA(0): DFP-4 [ 7.862] (--) NVIDIA(0): CRT-0: 400.0 MHz maximum pixel clock [ 7.862] (--) NVIDIA(0): ACB QHD270 (DFP-0): 330.0 MHz maximum pixel clock [ 7.862] (--) NVIDIA(0): ACB QHD270 (DFP-0): Internal Dual Link TMDS [ 7.862] (--) NVIDIA(0): DFP-1: 165.0 MHz maximum pixel clock [ 7.862] (--) NVIDIA(0): DFP-1: Internal Single Link TMDS [ 7.862] (--) NVIDIA(0): DFP-2: 165.0 MHz maximum pixel clock [ 7.862] (--) NVIDIA(0): DFP-2: Internal Single Link TMDS [ 7.862] (--) NVIDIA(0): DFP-3: 330.0 MHz maximum pixel clock [ 7.862] (--) NVIDIA(0): DFP-3: Internal Single Link TMDS [ 7.862] (--) NVIDIA(0): DFP-4: 960.0 MHz maximum pixel clock [ 7.862] (--) NVIDIA(0): DFP-4: Internal DisplayPort

    Read the article

  • SSIS parsing of an irregular flat file?

    - by ElHaix
    I'm pretty familiar with SSIS parsing of regular delimited text data files, however, I'm looking for some advice on an approach to tackle a file that looks like this test file: ISA*00* *00* *01*220220220 *ZZ*RL CODE 01*060327*1212*U*00300*000008859*0*P*:~ GS*RA*CPA-BPT*LOCALUTILITY*060319*1212*970819003*X*003030~ ST*820*000000001~ BPR*C*321.91*C*X12*CBC*04*000300488**9918939***04*000300002**1598564*070319~ TRN*1*00075319970819105029~ REF*RR*0003199708190000174858~ DTM*097*070318~ DTM*107*070318~ N1*PR*DIRECT PAYMENT~ N1*PE*ABC CORPORATE BILLER*ZZ*90005836~ ENT*1~ N1*PR*BILLING - TEST - NATTRASS~ RMR*CR*0009381082105011**142.15~ REF*TN*000303965~ DTM*109*070316~ ENT*2~ N1*PR*BILL FREID TEST~ RMR*CR*0011010451800011**179.76~ REF*TN*000304189~ The 321.91 is the total of the transaction. I would prefer to do this with SSIS, but could also do create a C# parser. Suggestions would be appreciated. Thank you.

    Read the article

  • unresolved external symbol __penter referenced in function _WspiapiStrdup@4

    - by John Weldon
    I started getting this compile error after upgrading to Visual Studio 2010. Not sure if it's related, but I can't figure out what library to reference to satisfy this dependency? Is it just an API change bug or something? Microsoft (R) Program Maintenance Utility Version 10.00.30319.01 Copyright (C) Microsoft Corporation. All rights reserved. del wstest.res wstest.obj wstest.pdb wstest.ilk wstest.exe wstest.exe.manifest vc90.pdb cl -Gh -Ox -DNDEBUG -c -DCRTAPI1=_cdecl -DCRTAPI2=_cdecl -nologo -GS -D_X86_=1 -DWIN32 -D_WIN32 -W3 -D_WINNT -D_WIN32_WINNT =0x0501 -DNTDDI_VERSION=0x05010000 -D_WIN32_IE=0x0600 -DWINVER=0x0501 -D_MT -D_DLL -MDd wstest.c wstest.c link /DEBUG /DEBUGTYPE:cv -out:wstest.exe wstest.obj Ws2_32.lib Shlwapi.lib Microsoft (R) Incremental Linker Version 10.00.30319.01 Copyright (C) Microsoft Corporation. All rights reserved. wstest.obj : error LNK2019: unresolved external symbol __penter referenced in function _WspiapiStrdup@4 wstest.exe : fatal error LNK1120: 1 unresolved externals NMAKE : fatal error U1077: '"c:\program files (x86)\microsoft visual studio 10.0\vc\bin\link.EXE"' : return code '0x460' Stop.

    Read the article

  • How to get a 64 bit dll with c source file, def file, link file by using command line in vc 6.0

    - by allan
    Hi, all My compile environment is windows xp and vc 6.0. Now I have a c source file(msgRout.c), def file(msgRout.def), link file(msgRout.link), then I use commands below to get a 32 bit dll: 1.cl /I ../include -c -W3 -Gs- -Z7 -Od -nologo -LD -D_X86_=1 -DWIN32 -D_WIN32 -D_MT -D_DLL msgRout.c 2.lib -out:msgRout.lib -def:msgRout.def -machine:i386 3.link /LIBPATH:../../Lib -nod -nologo -debug:full -dll @msgRout.link -out:msgRout.dll But the dll I got cannot be loaded on X64 application. it required a 64 bit dll. So here is my question: Can I get a 64 bit dll with vc 6.0? Using only above 3 commands alike, how can I get 64 bit dll? Many GREAT THANKS!!! Allan

    Read the article

  • Java: Netbeans debugging session works faster than normal run

    - by Martijn Courteaux
    Hello, I'm making Braid in Netbeans 6.7.1. Computer Spec: Windows 7 Running processes: 46 Running threads: +/- 650 NVidia GeForce 9200M GS Intel Core 2 Duo CPU P8400 @ 2.26Ghz Game-spec with normal run: Memory: between 80 MB and 110 MB CPU: between 9% and 20% CPU when time rewinding: 90% The same values for the debugging session, except when I rewind the time: CPU: 20%. Is there any reason for? Is there a way to reach the same performance with a normal run. This is my repaint code: @Override public void repaint() { BufferStrategy bs = getBufferStrategy(); // numBuffers: 4 Graphics g = bs.getDrawGraphics(); g.setColor(Color.BLACK); g.fillRect(-1, -1, 2000, 2000); gamePanel.paint(g.create(x, y, gameDim.width, gameDim.height)); bs.show(); g.dispose(); Toolkit.getDefaultToolkit().sync(); update(g); } The game runs in fullscreen (undecorated + frame.size = screensize) Martijn

    Read the article

  • Favorite web host.

    - by Greg Hostetler
    I've used many over the years like Media Temple gs, dreamhost, slicehost, and some others that I don't care to remember. But it's pretty hard to find a new host with search engines, because they normally give you those crappy affiliate driven reviews sites. Which host would you use for: Small personal websites with small traffic. Medium to large websites/applications with medium to large traffic. What host would you use for your assets (large images, media, etc...). Favorite dedicated/vps host.

    Read the article

  • How modify ascii table in C?

    - by drigoSkalWalker
    like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ascii sequence in this function and when it return, the ascii sequence back to the original. thanks in advance!

    Read the article

  • Weird problem, with ghostscript and pdf files.

    - by kofucii
    Hello, am using ghostscript to create pdf file from postscript file. My PS file, doesn't have orientation instructions, so when I want to create landscape pdf file, I'm using ghostscript to rotate the page. The problem is, that ghostscript rotates only the first page, and when my pdf file is more than 1 page, the others, are not rotated correctly. Here is the command I'm using: cat $psinput | gs -sPAPERSIZE=a4 -sDEVICE=pdfwrite -sOuputFile="/tmp/pdf" \ -dAutoRotatePages="/None" -c "<< /Orientation 3 >> setpagedevice" \ 90 rotate 0 -595 translate -dNOPAUSE -dEPSCrop -f - -c -quit Does anybody have an idea how to correct this?

    Read the article

  • Help with regex pulling XML data from response body in PHP

    - by spdaly
    I am working on a project that pulls data from JMS queue using PHP and Zend Framework. The HTTP client response is below. All I need is the XML string. I came up with /(.*)<\/RequestDetails/gs which tests ok on http://gskinner.com/RegExr/ but the preg_match call is returning an empty matches array. I'm going to continue to hunt around for a pattern, but thought I would post here as well. Thanks to all who read, etc... Steve UPDATE: I can't get the code to paste correctly. Here's a link to a pastbin: http://pastebin.com/rQxzcfSg

    Read the article

  • How are clientside security vulnerabilities generally discovered?

    - by Jehjoa
    I mean in operating systems or their applications. The only way I can think of is examine binaries for the use of dangerous functions like strcpy(), and then try to exploit those. Though with compiler improvements like Visual Studio's /GS switch this possibility should mostly be a thing of the past. Or am I mistaken? What other ways do people use to find vulnerabilities? Just load your target in a debugger, then send unexpected input and see what happens? This seems like a long and tedious process. Could anyone recommend some good books or websites on this subject? Thanks in advance.

    Read the article

  • How to Split a Big Postscript file (3000 pages) into one individual file per page (using Windows 7)?

    - by Pablo
    Hi, I'm having trouble doing the following: I have a big PDF file that I converted to postscript (for commercial printing). The resulting file is too big to be processed by the printer (machine). I've been trying to find a way to either: Convert from the original (many pages) PDF file to many Postscript file (one postcript file per PDF page in original PDF file(. Convert from PDF to PS (or even EPS). - I managed to do this Then split the PS file into a collection of smaller files. I've tried using Ghostscript, but it is all gibberish to me. Thanks. PS. If you have a good GS tutorial (for dummies?), please share the link.

    Read the article

  • PHP exec error, possibly MAMP using ghostscript

    - by user1762526
    I have been trying to use ghostscript in PHP to convert pdf files to images (png, jpg). I don't really care as long as they are images. This is the code that I used. exec("gs -sDEVICE=jpeg -sOutputFile=/Applications/Mamp/htdocs/cover.jpg -r144 /Applications/Mamp/htdocs/test.pdf"); When I enter the exact same thing, without the exec and quotes obviously, into the command line it does exactly what I want. However, when I run the php file nothing happens. I am using a MAMP server and the server seems to work fine, whenever I run another file with it I have no issues. Anyone have any ideas why it might not execute right?

    Read the article

  • __defineSetter__ on innerHTML stops it from rendering

    - by Tokimon
    Hi, i'm trying to create a watch method for HTML elements, using __define[GS]etter__ when a property is changed. It reacts just fine when i set the value, but if the property listened to, is innerHTML, it somehow fails to render the given string. So basically, when im adding something to innerHTML it doesn't show. Im using the watch method described in this previous question: http://stackoverflow.com/questions/1269633/javascript-watch-for-object-properties-changes I could of cause just not listen to innerHTML changes, but i'm also wondering if the __defineSetter__ somehow prevents original handling of setting the value. Thanks!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Thread 0 crashed with X86 Thread State (32-bit): in cocoa Application

    - by John
    I am doing crash fixing in an osx application .The crash report shows Date/Time: 2012-05-01 16:05:58.004 +0200 OS Version: Mac OS X 10.5.8 (9L31a) Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000000545f5f00 Crashed Thread: 8 Thread 8 crashed with X86 Thread State (32-bit): eax: 0x140e0850 ebx: 0x00060fc8 ecx: 0x92df0ec0 edx: 0xc0000003 edi: 0x545f5f00 esi: 0x140e0870 ebp: 0xb0445988 esp: 0xb0445964 ss: 0x0000001f efl: 0x00010206 eip: 0x92dca68c cs: 0x00000017 ds: 0x0000001f es: 0x0000001f fs: 0x0000001f gs: 0x00000037 cr2: 0x545f5f00 How to tares the application code with this report? what is Thread 0 crashed with X86 Thread State (32-bit)? if anybody know please help me. Thanks in advance.

    Read the article

  • Popping UIView crashes app

    - by Adun
    I'm basically pushing a UIView from a UITableViewController and all it contains is a UIWebView. However when I remove the UIView to return back to the UITableView the app crashes. - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. if (indexPath.row == websiteCell) { NSString *urlPath = [NSString stringWithFormat:@"http://%@", exhibitor.website]; WebViewController *webViewController = [[WebViewController alloc] initWithURLString:urlPath]; // Pass the selected object to the new view controller. [self.parentViewController presentModalViewController:webViewController animated:YES]; [webViewController release]; } } If I comment out the [webViewController release] the app doesn't crash, but I know that this would be a leak. Below is the code for the Web Browser: #import "WebViewController.h" @implementation WebViewController @synthesize webBrowserView; @synthesize urlValue; @synthesize toolBar; @synthesize spinner; @synthesize loadUrl; -(id)initWithURLString:(NSString *)urlString { if (self = [super init]) { urlValue = urlString; } return self; } #pragma mark WebView Controls - (void)goBack { [webBrowserView goBack]; } - (void)goForward { [webBrowserView goForward]; } - (void)reload { [webBrowserView reload]; } - (void)closeBrowser { [self.parentViewController dismissModalViewControllerAnimated:YES]; } #pragma end // Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { [super viewDidLoad]; CGRect contentRect = self.view.bounds; //NSLog(@"%f", contentRect.size.height); float webViewHeight = contentRect.size.height - 44.0f; // navBar = 44 float toolBarHeight = contentRect.size.height - webViewHeight; // navigation bar UINavigationBar *navBar = [[[UINavigationBar alloc] initWithFrame:CGRectMake(0, 20, contentRect.size.width, 44)] autorelease]; navBar.delegate = self; UIBarButtonItem *doneButton = [[[UIBarButtonItem alloc] initWithTitle:@"Done" style:UIBarButtonItemStyleDone target:nil action:@selector(closeBrowser)] autorelease]; UINavigationItem *item = [[[UINavigationItem alloc] initWithTitle:@"CEDIA10"] autorelease]; item.leftBarButtonItem = doneButton; [navBar pushNavigationItem:item animated:NO]; [self.view addSubview:navBar]; // web browser webBrowserView = [[UIWebView alloc] initWithFrame:CGRectMake(0, 64, contentRect.size.width, webViewHeight)]; webBrowserView.delegate = self; webBrowserView.autoresizingMask = UIViewAutoresizingFlexibleWidth | UIViewAutoresizingFlexibleHeight; webBrowserView.scalesPageToFit = YES; [self.view addSubview:webBrowserView]; // buttons UIBarButtonItem *backButton = [[[UIBarButtonItem alloc] initWithImage:[UIImage imageNamed:@"arrowleft.png"] style:UIBarButtonItemStylePlain target:self action:@selector(goBack)] autorelease]; UIBarButtonItem *fwdButton = [[[UIBarButtonItem alloc] initWithImage:[UIImage imageNamed:@"arrowright.png"] style:UIBarButtonItemStylePlain target:self action:@selector(goForward)] autorelease]; UIBarButtonItem *refreshButton = [[[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemRefresh target:self action:@selector(reload)] autorelease]; UIBarButtonItem *flexSpace = [[[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemFlexibleSpace target:nil action:nil] autorelease]; UIBarButtonItem *fixSpace = [[[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemFixedSpace target:nil action:nil] autorelease]; [fixSpace setWidth: 40.0f]; spinner = [[[UIActivityIndicatorView alloc] initWithActivityIndicatorStyle:UIActivityIndicatorViewStyleWhite] autorelease]; [spinner startAnimating]; UIBarButtonItem *loadingIcon = [[[UIBarButtonItem alloc] initWithCustomView:spinner] autorelease]; NSArray *toolBarButtons = [[NSArray alloc] initWithObjects: fixSpace, backButton, fixSpace, fwdButton, flexSpace, loadingIcon, flexSpace, refreshButton, nil]; // toolbar toolBar = [[UIToolbar alloc] initWithFrame:CGRectMake(0, webViewHeight, contentRect.size.width, toolBarHeight)]; toolBar.autoresizingMask = UIViewAutoresizingFlexibleTopMargin | UIViewAutoresizingFlexibleWidth; toolBar.items = toolBarButtons; [self.view addSubview:toolBar]; // load the request NSURL *requestString = [NSURL URLWithString:urlValue]; [webBrowserView loadRequest:[NSURLRequest requestWithURL: requestString]]; [toolBarButtons release]; } - (void)viewWillDisappear { if ([webBrowserView isLoading]) { [webBrowserView stopLoading]; webBrowserView.delegate = nil; } } #pragma mark UIWebView - (void)webViewDidStartLoad:(UIWebView*)webView { [spinner startAnimating]; } - (void)webViewDidFinishLoad:(UIWebView*)webView { [spinner stopAnimating]; } - (BOOL)webView:(UIWebView *)webView shouldStartLoadWithRequest:(NSURLRequest *)request navigationType:(UIWebViewNavigationType)navigationType { loadUrl = [[request URL] retain]; if ([[loadUrl scheme] isEqualToString: @"mailto"]) { UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"CEDIA10" message:@"Do you want to open Mail and exit AREC10?" delegate:self cancelButtonTitle:@"No" otherButtonTitles:@"Yes",nil]; [alert show]; [alert release]; return NO; } [loadUrl release]; return YES; } - (void)webView:(UIWebView *)webView didFailLoadWithError:(NSError *)error { [spinner stopAnimating]; if (error.code == -1009) { // no internet connection UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"CEDIA10" message:@"You need an active Internet connection." delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [alert show]; [alert release]; } } #pragma mark UIAlertView - (void)alertView:(UIAlertView *)alertView clickedButtonAtIndex:(NSInteger)buttonIndex { if (buttonIndex == 1) { [[UIApplication sharedApplication] openURL:loadUrl]; [loadUrl release]; } } - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Release any cached data, images, etc that aren't in use. [webBrowserView release]; [urlValue release]; [toolBar release]; [spinner release]; [loadUrl release]; webBrowserView = nil; webBrowserView.delegate = nil; urlValue = nil; toolBar = nil; spinner = nil; loadUrl = nil; } - (void)viewDidUnload { // Release any retained subviews of the main view. // e.g. self.myOutlet = nil; } - (void)dealloc { [webBrowserView release]; [urlValue release]; [toolBar release]; [spinner release]; [loadUrl release]; webBrowserView.delegate = nil; urlValue = nil; toolBar = nil; spinner = nil; loadUrl = nil; [super dealloc]; } @end Below this is the crash log that I am getting: Date/Time: 2010-05-13 11:58:20.023 +1000 OS Version: iPhone OS 3.1.3 (7E18) Report Version: 104 Exception Type: EXC_CRASH (SIGABRT) Exception Codes: 0x00000000, 0x00000000 Crashed Thread: 0 Thread 0 Crashed: 0 libSystem.B.dylib 0x00090b2c __kill + 8 1 libSystem.B.dylib 0x00090b1a kill + 4 2 libSystem.B.dylib 0x00090b0e raise + 10 3 libSystem.B.dylib 0x000a7e34 abort + 36 4 libstdc++.6.dylib 0x00066390 __gnu_cxx::__verbose_terminate_handler() + 588 5 libobjc.A.dylib 0x00008898 _objc_terminate + 160 6 libstdc++.6.dylib 0x00063a84 __cxxabiv1::__terminate(void (*)()) + 76 7 libstdc++.6.dylib 0x00063afc std::terminate() + 16 8 libstdc++.6.dylib 0x00063c24 __cxa_throw + 100 9 libobjc.A.dylib 0x00006e54 objc_exception_throw + 104 10 CoreFoundation 0x00095bf6 -[NSObject doesNotRecognizeSelector:] + 106 11 CoreFoundation 0x0001ab12 ___forwarding___ + 474 12 CoreFoundation 0x00011838 _CF_forwarding_prep_0 + 40 13 QuartzCore 0x0000f448 CALayerCopyRenderLayer + 24 14 QuartzCore 0x0000f048 CA::Context::commit_layer(_CALayer*, unsigned int, unsigned int, void*) + 100 15 QuartzCore 0x0000ef34 CALayerCommitIfNeeded + 336 16 QuartzCore 0x0000eedc CALayerCommitIfNeeded + 248 17 QuartzCore 0x00011ee8 CA::Context::commit_root(void*, void*) + 52 18 QuartzCore 0x00011e80 x_hash_table_foreach + 64 19 QuartzCore 0x00011e2c CA::Transaction::foreach_root(void (*)(void*, void*), void*) + 40 20 QuartzCore 0x0000bb68 CA::Context::commit_transaction(CA::Transaction*) + 1068 21 QuartzCore 0x0000b46c CA::Transaction::commit() + 276 22 QuartzCore 0x000135d4 CA::Transaction::observer_callback(__CFRunLoopObserver*, unsigned long, void*) + 84 23 CoreFoundation 0x0000f82a __CFRunLoopDoObservers + 466 24 CoreFoundation 0x00057340 CFRunLoopRunSpecific + 1812 25 CoreFoundation 0x00056c18 CFRunLoopRunInMode + 44 26 GraphicsServices 0x000041c0 GSEventRunModal + 188 27 UIKit 0x00003c28 -[UIApplication _run] + 552 28 UIKit 0x00002228 UIApplicationMain + 960 29 CEDIA10 0x00002e16 main (main.m:14) 30 CEDIA10 0x00002db8 start + 32 Any ideas on why the app is crashing?

    Read the article

  • Get the current location of the Gps? Showing the default one

    - by Gagandeep
    Need help Urgent!!!!! Did changes with help but still unsuccessful... I have to request location updates, but I am unsuccessful in implementing that... i modified the code but need help so that i can see the current location. PLEASE look through my code and help please.. I am learning this and new to this concept and android.. any help would be appreciated here is my code: package com.GoogleMaps; import java.util.List; import com.google.android.maps.GeoPoint; import com.google.android.maps.MapActivity; import com.google.android.maps.MapController; import com.google.android.maps.MapView; import com.google.android.maps.Overlay; import android.content.Context; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.graphics.Canvas; import android.graphics.Paint; import android.graphics.Point; import android.graphics.drawable.Drawable; import android.location.Location; import android.location.LocationListener; import android.location.LocationManager; import android.os.Bundle; import android.widget.Toast; public class MapsActivity extends MapActivity { /** Called when the activity is first created. */ private MapView mapView; private LocationManager lm; private LocationListener ll; private MapController mc; GeoPoint p = null; Drawable defaultMarker = null; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mapView = (MapView)findViewById(R.id.mapview); //show zoom in/out buttons mapView.setBuiltInZoomControls(true); //Standard view of the map(map/sat) mapView.setSatellite(false); // get zoom tool mapView.setBuiltInZoomControls(true); //get controller of the map for zooming in/out mc = mapView.getController(); // Zoom Level mc.setZoom(18); lm = (LocationManager)getSystemService(Context.LOCATION_SERVICE); ll = new MyLocationListener(); lm.requestLocationUpdates( LocationManager.GPS_PROVIDER, 0, 0, ll); //Get the current location in start-up lm = (LocationManager)getSystemService(Context.LOCATION_SERVICE); ll = new MyLocationListener(); lm.requestLocationUpdates( LocationManager.GPS_PROVIDER, 0, 0, ll); //Get the current location in start-up if (lm.getLastKnownLocation(LocationManager.GPS_PROVIDER) != null){ GeoPoint p = new GeoPoint( (int)(lm.getLastKnownLocation(LocationManager.GPS_PROVIDER).getLatitude()*1000000), (int)(lm.getLastKnownLocation(LocationManager.GPS_PROVIDER).getLongitude()*1000000)); mc.animateTo(p); } MyLocationOverlay myLocationOverlay = new MyLocationOverlay(); List<Overlay> list = mapView.getOverlays(); list.add(myLocationOverlay); } protected class MyLocationOverlay extends com.google.android.maps.Overlay { @Override public boolean draw(Canvas canvas, MapView mapView, boolean shadow, long when) { Paint paint = new Paint(); super.draw(canvas, mapView, shadow); GeoPoint p = null; // Converts lat/lng-Point to OUR coordinates on the screen. Point myScreenCoords = new Point(); mapView.getProjection().toPixels(p, myScreenCoords); paint.setStrokeWidth(1); paint.setARGB(255, 255, 255, 255); paint.setStyle(Paint.Style.STROKE); Bitmap bmp = BitmapFactory.decodeResource(getResources(), R.drawable.ic_launcher); canvas.drawBitmap(bmp, myScreenCoords.x, myScreenCoords.y, paint); canvas.drawText("I am here...", myScreenCoords.x, myScreenCoords.y, paint); return true; } } private class MyLocationListener implements LocationListener{ public void onLocationChanged(Location argLocation) { // TODO Auto-generated method stub p = new GeoPoint((int)(argLocation.getLatitude()*1000000), (int)(argLocation.getLongitude()*1000000)); Toast.makeText(getBaseContext(), "New location latitude [" +argLocation.getLatitude() + "] longitude [" + argLocation.getLongitude()+"]", Toast.LENGTH_SHORT).show(); mc.animateTo(p); mapView.invalidate(); // call this so UI of map was updated } public void onProviderDisabled(String provider) { // TODO Auto-generated method stub } public void onProviderEnabled(String provider) { // TODO Auto-generated method stub } public void onStatusChanged(String provider, int status, Bundle extras) { // TODO Auto-generated method stub } } protected boolean isRouteDisplayed() { return false; } } catlog: 11-29 17:40:42.699: D/dalvikvm(371): GC_FOR_MALLOC freed 6074 objects / 369952 bytes in 74ms 11-29 17:40:42.970: I/MapActivity(371): Handling network change notification:CONNECTED 11-29 17:40:42.980: E/MapActivity(371): Couldn't get connection factory client 11-29 17:40:43.190: D/AndroidRuntime(371): Shutting down VM 11-29 17:40:43.190: W/dalvikvm(371): threadid=1: thread exiting with uncaught exception (group=0x4001d800) 11-29 17:40:43.280: E/AndroidRuntime(371): FATAL EXCEPTION: main 11-29 17:40:43.280: E/AndroidRuntime(371): java.lang.NullPointerException 11-29 17:40:43.280: E/AndroidRuntime(371): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:71) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:61) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.GoogleMaps.MapsActivity$MyLocationOverlay.draw(MapsActivity.java:106) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.google.android.maps.OverlayBundle.draw(OverlayBundle.java:42) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.google.android.maps.MapView.onDraw(MapView.java:494) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.View.draw(View.java:6740) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.drawChild(ViewGroup.java:1640) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1367) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.drawChild(ViewGroup.java:1638) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1367) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.View.draw(View.java:6743) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.widget.FrameLayout.draw(FrameLayout.java:352) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.drawChild(ViewGroup.java:1640) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1367) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.drawChild(ViewGroup.java:1638) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1367) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.View.draw(View.java:6743) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.widget.FrameLayout.draw(FrameLayout.java:352) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1842) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewRoot.draw(ViewRoot.java:1407) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewRoot.performTraversals(ViewRoot.java:1163) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.view.ViewRoot.handleMessage(ViewRoot.java:1727) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.os.Handler.dispatchMessage(Handler.java:99) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.os.Looper.loop(Looper.java:123) 11-29 17:40:43.280: E/AndroidRuntime(371): at android.app.ActivityThread.main(ActivityThread.java:4627) 11-29 17:40:43.280: E/AndroidRuntime(371): at java.lang.reflect.Method.invokeNative(Native Method) 11-29 17:40:43.280: E/AndroidRuntime(371): at java.lang.reflect.Method.invoke(Method.java:521) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:868) 11-29 17:40:43.280: E/AndroidRuntime(371): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:626) 11-29 17:40:43.280: E/AndroidRuntime(371): at dalvik.system.NativeStart.main(Native Method) 11-29 17:40:45.779: D/dalvikvm(371): GC_FOR_MALLOC freed 5970 objects / 506624 bytes in 1179ms 11-29 17:40:45.779: I/dalvikvm-heap(371): Grow heap (frag case) to 3.147MB for 17858-byte allocation 11-29 17:40:45.870: D/dalvikvm(371): GC_FOR_MALLOC freed 56 objects / 2304 bytes in 92ms 11-29 17:40:45.960: D/dalvikvm(371): GC_EXPLICIT freed 3459 objects / 196432 bytes in 74ms 11-29 17:40:48.310: D/dalvikvm(371): GC_EXPLICIT freed 116 objects / 41448 bytes in 68ms 11-29 17:40:49.540: I/Process(371): Sending signal. PID: 371 SIG: 9

    Read the article

  • css menu for cross browser...mobile and desktop

    - by user1763319
    I made a cross browser drop down menu, which works well with IE6. However, I have problems with other browsers such as IE9, Firefox, Chrome... etc. How can I modify my HTML and CSS to get the same effect that works in IE6? Link to JSFiddle Here is my CSS: <style> .bar ul,li{ z-index:999; margin:0; padding:0; } .bar { color: #FFFFFF; font-weight: bold; text-align: center; } .bar a { padding: 11px; } .bar a:visited { color: #FFFFFF; font-weight: bold; text-decoration:none } .bar a:link { color: #FFFFFF; font-weight: bold; text-decoration:none } .bar a:hover { color: #FFFFFF; font-weight: bold; text-decoration:underline } #nav0{ list-style:none; font-weight:bold; /* Clear floats */ float:left; width:100%; } #nav0 li{ float:left; margin-right:10px; position:relative; } #nav0 a{ display:block; padding:5px; color:#fff; background:#003399; text-decoration:none; } #nav0 a:hover{ color:#fff; background:#333; text-decoration:underline; } /*--- DROPDOWN ---*/ #nav0 ul{ background:#fff; background:rgba(255,255,255,0); list-style:none; position:absolute; left:-9999px; } #nav0 ul li{ padding-top:1px; float:none; } #nav0 ul a{ white-space:nowrap; } #nav0 li:hover ul{ left:0; } #nav0 li:hover a{ text-decoration:underline; } #nav0 li:hover ul a{ text-decoration:none; } #nav0 li:hover ul li a:hover{ background:#333; } #nav0 li ul li a{ text-align: left; } #nav0 li:hover ul li ul { display:block; background:#003399; float:left; position:relative; padding-left:20px; } #nav0 li ul li:hover ul { display:block; background:#003399; float:left; position:relative; padding-left:20px; } </style> Here is my HTML: <body bgcolor="#79A6A6"> <div id="page" align="center"> <table class="bar" border="0" width="960" cellspacing="0" cellpadding="0" id="table_bar" bgcolor="#003399"> <tr> <td> <ul id="nav0"> <li><a><strong>Home</strong> </a> <ul> <li><a href="#" title>Top Item 1</a><ul> <li><a href="#" title="-">Item 1</a></li> <li><a href="#" title="-">Item 2</a></li> </ul> </li> <li><a href="#" title>Top Item 2</a><ul> <li><a href="@" title>Item 3</a></li> <li><a href="@" title>Item 4</a></li> </ul> </li> </ul> </li> <li><a><strong>Home</strong> </a> <ul> <li><a href="#" title>Top Title</a><ul> <li><a href="#" title="-">title</a></li> <li><a href="#" title="-">title123456789</a></li> </ul> </li> <li><a href="#" title>Top Hello</a><ul> <li><a href="@" title>hello</a></li> <li><a href="@" title>hello123456789</a></li> </ul> </li> </ul> </li> </ul> </li> <ul> </ul> </td> <td width="50" style="text-align: left">&nbsp;</td> </tr> </table> </div> </body> In ie6 Home Top Item 1 Item 1 Item 2 Top Item 2 Item3 Item4 In ie9 Home Top Item 1 Top Item 2 Item 2 Item 3 Item 4

    Read the article

  • Built-in network card not working?

    - by Zeeshan
    Hi, I am new to Ubuntu. I have installed Ubuntu 9.04(Jaunty). After installation I found that network card is not wokring. And id doest not list in "System Preferenes Network Connections" So , i got another card from my friend and try to search on internat about my problem but still cant find solution. Some commands output is here which may be help to solve problem root@mzeeshan-desktop:/home/mzeeshan# uname -r 2.6.28-11-generic root@mzeeshan-desktop:/home/mzeeshan# ifconfig -a eth0 Link encap:Ethernet HWaddr 00:02:44:4a:45:12 inet addr:192.168.5.37 Bcast:192.168.5.255 Mask:255.255.255.0 inet6 addr: fe80::202:44ff:fe4a:4512/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:3774 errors:0 dropped:0 overruns:0 frame:0 TX packets:3611 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:4307045 (4.3 MB) TX bytes:583067 (583.0 KB) Interrupt:22 Base address:0x1000 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:4 errors:0 dropped:0 overruns:0 frame:0 TX packets:4 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:240 (240.0 B) TX bytes:240 (240.0 B) pan0 Link encap:Ethernet HWaddr 5e:25:17:a1:18:ac BROADCAST MULTICAST MTU:1500 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:0 (0.0 B) TX bytes:0 (0.0 B) root@mzeeshan-desktop:/home/mzeeshan# lspci 00:00.0 Host bridge: Intel Corporation Device 0069 (rev 12) 00:01.0 PCI bridge: Intel Corporation Auburndale/Havendale PCI Express x16 Root Port (rev 12) 00:19.0 Ethernet controller: Intel Corporation Device 10f0 (rev 05) 00:1a.0 USB Controller: Intel Corporation Ibex Peak USB2 Enhanced Host Controller (rev 05) 00:1c.0 PCI bridge: Intel Corporation Ibex Peak PCI Express Root Port 1 (rev 05) 00:1c.4 PCI bridge: Intel Corporation Ibex Peak PCI Express Root Port 5 (rev 05) 00:1c.6 PCI bridge: Intel Corporation Ibex Peak PCI Express Root Port 7 (rev 05) 00:1c.7 PCI bridge: Intel Corporation Ibex Peak PCI Express Root Port 8 (rev 05) 00:1d.0 USB Controller: Intel Corporation Ibex Peak USB2 Enhanced Host Controller (rev 05) 00:1e.0 PCI bridge: Intel Corporation 82801 PCI Bridge (rev a5) 00:1f.0 ISA bridge: Intel Corporation Ibex Peak LPC Interface Controller (rev 05) 00:1f.2 IDE interface: Intel Corporation Ibex Peak 4 port SATA IDE Controller (rev 05) 00:1f.3 SMBus: Intel Corporation Ibex Peak SMBus Controller (rev 05) 00:1f.5 IDE interface: Intel Corporation Ibex Peak 2 port SATA IDE Controller (rev 05) 01:00.0 VGA compatible controller: nVidia Corporation GeForce 8400 GS (rev a1) 06:00.0 Multimedia audio controller: Creative Labs SB Live! EMU10k1 (rev 07) 06:00.1 Input device controller: Creative Labs SB Live! Game Port (rev 07) 06:01.0 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL-8139/8139C/8139C+ (rev 10) 06:03.0 FireWire (IEEE 1394): Texas Instruments TSB43AB22/A IEEE-1394a-2000 Controller (PHY/Link) root@mzeeshan-desktop:/home/mzeeshan# Motherboard is Intel DP55WG. I don't know what to do next. Any help will be greatly appreciated.. Thanks

    Read the article

  • View the Real Links Behind Shortened URLs in Chrome

    - by Asian Angel
    When you encounter shortened URLs there is always that worry in the back of your mind about where they really lead to. Now you can get a “sneak peak” at the real links behind those URLs with the View Thru extension for Google Chrome. The URL Shortening services officially supported at this time are: bit.ly, cli.gs, ff.im, goo.gl, is.gd, nyti.ms, ow.ly, post.ly, su.pr, & tinyurl.com. Before When you encounter a shortened URL you are pretty much on your own in deciding whether to trust that link or not. It would really be nice if you could just hover your mouse over those links and know where they will lead ahead of time. After Once you have the extension installed you are ready to access that link viewing goodness. Please note that you will need to reload any pages that were open prior to installing the extension. For our first example we chose a shortened URL from “bit.ly”. As you can see the entire link behind the shortened URL is displayed very nicely…no hidden surprises there! Note: There are no options to worry with for the extension. Another perfect result for the “goo.gl URL” shown below. View Thru will certainly remove a lot of the stress related to clicking on shortened URLs. Bonus Find Just out of curiosity we looked for a shortened URL not listed as being officially supported at this time. We found one with the “http://nyti.ms/” domain and View Thru showed the link perfectly…so be sure to give it a try on other services too. Conclusion If you worry about where a shortened URL will really lead you then the View Thru extension can help alleviate that stress. Links Download the View Thru extension (Google Chrome Extensions) Similar Articles Productive Geek Tips See Where Shortened URLs “Link To” in Your Favorite BrowserVerify the Destinations of Shortened URLs the Easy WayCreate Shortened goo.gl URLs in Google Chrome the Easy WayCreate Shortened goo.gl URLs in Your Favorite BrowserAccess Google Chrome’s Special Pages the Easy Way TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 QuicklyCode Provides Cheatsheets & Other Programming Stuff Download Free MP3s from Amazon Awe inspiring, inter-galactic theme (Win 7) Case Study – How to Optimize Popular Wordpress Sites Restore Hidden Updates in Windows 7 & Vista Iceland an Insurance Job?

    Read the article

  • Crash Report in Ubuntu... hardware problem?

    - by Andrew
    Got this on my machine. I was just browsing the web on Chrome and my computer froze. I recently just built this machine. I have a feeling it is a hardware problem... Possibly one of my parts arrived broken in some way.... Starting anac(h)ronistic cron Stopping anac(h)ronistic cron Stopping cold plug devices Stopping log initial device creation Starting enable remaining boot-time encrypted block devices Starting configure network device security Starting configure virtual network devices Starting save udev log and update rules Stopping configure virtual network devices Stopping save udev log and update rules Checking battery state... Stopping System V runlevel compatibility Stopping enable remaining boot-time encrypted block devices Stopping Mount filesystems on boot 91.573384] BUG: unable to handle kernel NULL pointer dereference at (null) 91.573437] IP: [<ffffffff81313514>] strcmp+0x14/0x30 91.573470] PGD 1f7822067 PUD 1ed7a6067 PMD 0 91.573498] Oops: 0000 [#1] SMP 91.573519] CPU 3 91.573531] Modules linked in: dm_crypt bnep snd_hda_codec_realtek rfcomm bluetooth parport_pc ppdev arc4 fglrx(P) rt2800usb rt2800lib crc_ccitt rt2x00usb rt2x00lib mac0021 cfg80211 psmouse snd_hda_intel snd_hda_codec snd_hwdep snd_pcm snd_seq_midi snd_rawmidi snd_seq_midi_event snd_seq snd_timer send_seq_device snd joydev mac_hid mei(C) soundcore serio_raw snd_page_alloc lp parport ses enclosure usbhid hid i915 drm_kms_helper drm i2c_algo_bit mxm_umi tg_video wmi usb_storage 91.573826] 91.573837] Pid: 2297, comm: update-notifier Tainted: P C O 3.2.0-29-generic #46-Ubuntu To Be Filled By O.E.M. To Be Filled By O.E.M./Z77 Extreme4 91.573912] RIP: 0010:[<ffffffff81313514>] [<ffffffff81313514>] strcmp+0x14/0x30 91.573954] RSP: 0018:ffff8801f83f5bb8 EFLAGS: 00010246 91.573982] RAX: 0000000000000000 RBX: 0000000000000000 RCX: 0000000000000000 91.574019] RDX: 0000000000000069 RSI: 0000000000000000 RDI: ffff88021adb26f8 91.574056] RBP: ffff8801f83f5bb8 R08: ffff88022f2d6e80 R09: 0000000000000000 91.574093] R10: ffff88021e7dbf00 R11: 0000000000000003 R12: ffff88021c10eb40 91.574130] R13: 0000000000000000 R14: ffff88021adb26f8 R15: ffff8801f83f5d40 91.574168] FS: 00007f958cf53940(0000) GS:ffff88022f2c0000(0000) kn1GS:0000000000000000 91.574210] CS: 0010 DS: 0000 ES: 0000 CR0: 0000000080050033 91.574240] CR2: 0000000000000000 CR3: 000000021f6d7000 CR4: 00000000000406e0 91.574277] DR0: 0000000000000000 DR1: 0000000000000000 DR2: 0000000000000000 91.574314] DR3: 0000000000000000 DR6: 00000000ffff0ff0 DR7: 0000000000000000 91.574351] Process update-notifier (pid: 2297, threadinfo ffff801f83f4000, task ffff880208fe2e00) 91.574397] Stack: 91.574409] ffff8801f83f5be8 ffffffff811ed509 ffff88021adb26c0 ffff88021b8b7020 91.574453] ffff88021b461c60 fffffffffffffffe ffff8801f83f5c18 ffffffff811ed61f 91.574496] ffff88021adb26c0 ffff88021b8b7020 ffff8801f83f5dc8 0000000000000001 91.574539] Call Trace: 91.574558] [<ffffffff811ed509] sysfs_find_dirent+0x59/0x110 91.574591] [<ffffffff811ed61f] sysfs_lookup+0x5f/0x110 91.574621] [<ffffffff81182745] d_alloc_and_lookup+0x45/0x90 91.574654] [<ffffffff8118fe65] ? d_lookup+0x35/0x60 91.574683] [<ffffffff811848d2] do_lookup+0x202/0x310 91.574712] [<ffffffff8118660c] path_lookupat+0x11c/0x750 91.574744] [<ffffffff81318db7] ? __strncpy_from_user+0x27/0x60 91.574778] [<ffffffff81186c71] do_path_lookup+0x31/0xc0 91.574809] [<ffffffff81187779] user_path_at_empty+0x59/0xa0 91.574842] [<ffffffff81187822] ? do_filp_open+0x42/0xa0 91.574872] [<ffffffff811877d1] user_path_at+0x11/0x20 91.574902] [<ffffffff8117c80a] vfs_fstatat+0x3a/0x70 91.574933] [<ffffffff81161cff] ? kmem_cache_free+0x2f/0x110 91.574965] [<ffffffff8117c85e] vfs_lstat+-x31/0x70 91.574993] [<ffffffff8117c9fa] sys_newlstat+0x1a/0x40 91.575022] [<ffffffff81176ee1] ? do_sys_open+0x171/0x220 91.575053] [<ffffffff8117cb1a] ? sys_readlinkat+0x7a/0xb0 91.575086] [<ffffffff81661ec2] system_call_fastpath+0x16/0x1b 91.575118] Code: 83 c1 01 40 84 ff 75 ef 5d c3 66 66 66 66 2e 0f 1f 84 00 00 00 00 00 00 55 31 c0 48 89 e5 66 2e 0f 1f 84 00 00 00 00 00 0f b6 14 07 <3a> 14 06 75 0f 48 83 c0 01 84 d2 75 ef 31 c0 5d c3 0f 1f 00 19 91.577243] RIP [<ffffffff81313514>] strcmp+0x14/0x30 91.579314] RSP <ffff8801f83f5bb8> 91.581385] CR2: 0000000000000000

    Read the article

  • Installing Age of Empires II using PlayOnLinux doesn't work?

    - by user70342
    I have tried installing age of empires 2 using PlayOnLinux, the installation appeared to go fine but when I try and open the game it says there is a serious fault. The error report is below, unfortunately this doesn't mean alot to me, I was wondering if you could help, a) By highlighting the problem and b) by suggesting a solution. Many Thanks Unhandled exception: page fault on read access to 0xffffffff in 32-bit code (0x0040aaad). Register dump: CS:0073 SS:007b DS:007b ES:007b FS:0033 GS:003b EIP:0040aaad ESP:0033fd00 EBP:0033fde4 EFLAGS:00010293( R- -- I S -A- -C) EAX:00000001 EBX:bde88d9d ECX:00000067 EDX:00400000 ESI:7b867c00 EDI:00400000 Stack dump: 0x0033fd00:00410fed 00000000 00400000 00000067 0x0033fd10:0041ab90 00130d8a 7b895848 7bc483b1 0x0033fd20:0044c800 00000002 0044bdd0 7bca4e6c 0x0033fd30:7bc3590f 00000800 00000094 00000005 0x0033fd40:00000000 00000893 00000002 76726553 0x0033fd50:20656369 6b636150 00003420 00000800 Backtrace: =0 0x0040aaad in empires2 (+0xaaad) (0x0033fde4) 1 0x0041ace2 in empires2 (+0x1ace1) (0x0033fe70) 2 0x7b85ac0c call_process_entry+0xb() in kernel32 (0x0033fe88) 3 0x7b85e13b in kernel32 (+0x4e13a) (0x0033fec8) 4 0x7bc714f0 call_thread_func_wrapper+0xb() in ntdll (0x0033fed8) 5 0x7bc7172d call_thread_func+0x7c() in ntdll (0x0033ffa8) 6 0x7bc714ce RtlRaiseException+0x21() in ntdll (0x0033ffc8) 7 0x7bc4c30e in ntdll (+0x3c30d) (0x0033ffe8) 0x0040aaad: pop %ss Modules: Module Address Debug info Name (51 modules) PE 400000- 44b000 Export empires2 PE 10000000-1000c000 Deferred drvmgt ELF 35cae000-35d24000 Deferred rpcrt4 -PE 35cc0000-35d24000 \ rpcrt4 ELF 68000000-68022000 Deferred ld-linux.so.2 ELF 68022000-681c7000 Deferred libc.so.6 ELF 681c7000-681cc000 Deferred libdl.so.2 ELF 681cc000-681f8000 Deferred libm.so.6 ELF 681f8000-68201000 Deferred libnss_compat.so.2 ELF 68201000-6821b000 Deferred libnsl.so.1 ELF 6821b000-68228000 Deferred libnss_files.so.2 ELF 68228000-68366000 Deferred user32 -PE 68240000-68366000 \ user32 ELF 68366000-68421000 Deferred gdi32 -PE 68370000-68421000 \ gdi32 ELF 68421000-68481000 Deferred advapi32 -PE 68430000-68481000 \ advapi32 ELF 68481000-68499000 Deferred version -PE 68490000-68499000 \ version ELF 68499000-68533000 Deferred libfreetype.so.6 ELF 68533000-68549000 Deferred libz.so.1 ELF 68549000-685db000 Deferred winex11 -PE 68550000-685db000 \ winex11 ELF 685db000-685e4000 Deferred libsm.so.6 ELF 685e4000-685fe000 Deferred libice.so.6 ELF 685fe000-68610000 Deferred libxext.so.6 ELF 68610000-68744000 Deferred libx11.so.6 ELF 68744000-6874a000 Deferred libuuid.so.1 ELF 6874a000-68751000 Deferred libxdmcp.so.6 ELF 68751000-68755000 Deferred libxinerama.so.1 ELF 68755000-6875b000 Deferred libxxf86vm.so.1 ELF 6875b000-68765000 Deferred libxrender.so.1 ELF 68765000-6876e000 Deferred libxrandr.so.2 ELF 6876e000-68772000 Deferred libxcomposite.so.1 ELF 68772000-68782000 Deferred libxi.so.6 ELF 68782000-687b6000 Deferred libfontconfig.so.1 ELF 687b6000-687e0000 Deferred libexpat.so.1 ELF 687e0000-687eb000 Deferred libxcursor.so.1 ELF 687eb000-687f1000 Deferred libxfixes.so.3 ELF 6f102000-6f10e000 Deferred libnss_nis.so.2 ELF 7194d000-7196e000 Deferred imm32 -PE 71950000-7196e000 \ imm32 ELF 72c76000-72db7000 Dwarf libwine.so.1 ELF 75d65000-75d86000 Deferred libxcb.so.1 ELF 79223000-79227000 Deferred libxau.so.6 ELF 7b800000-7b8f5000 Dwarf kernel32 -PE 7b810000-7b8f5000 \ kernel32 ELF 7bc00000-7bcc1000 Dwarf ntdll -PE 7bc10000-7bcc1000 \ ntdll ELF 7bf00000-7bf03000 Deferred ELF 7c708000-7c723000 Deferred libpthread.so.0 Threads: process tid prio (all id:s are in hex) 00000008 (D) C:\Program Files\Microsoft Games\Age of Empires II\empires2.exe 00000009 0 <== 0000000e services.exe 00000039 0 00000038 0 0000001f 0 00000019 0 00000018 0 00000017 0 00000015 0 00000010 0 0000000f 0 00000012 winedevice.exe 0000001e 0 0000001a 0 00000014 0 00000013 0 0000001b plugplay.exe 00000021 0 0000001d 0 0000001c 0 00000024 explorer.exe 00000025 0 00000035 winedevice.exe 0000003a 0 00000037 0 00000036 0 System information: Wine build: wine-1.4-rc1 Platform: i386 Host system: Linux Host version: 3.2.0-24-generic

    Read the article

  • Announcing Oracle Mobile Timecards for Oracle E-Business Suite, Release 12.1 and Release 12.2

    - by CaroleB
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Oracle E-Business Suite Development is pleased to announce the availability of Oracle Mobile Timecards for Oracle E-Business Suite iPhone application.  With this new mobile app, users can record time on the go, and quickly submit timecards to ensure that downstream processes like Payroll, Projects Costing and Vendor Settlements are executed on time. Key features include: Enter time day-wise for easy time booking Enter time in Quick Time or Regular Time modes Support Payroll and Projects based time entry Aggregate day-wise entries into timecard periods Submit and view timecards while on the go Oracle Mobile Timecards for Oracle E-Business Suite is currently available on OS, and Android availability is planned. It is available to Oracle E-Business Suite customers as part of an existing Oracle Time and Labor product license; no new "mobile" license is required. Download Availability You can download Oracle E-Business Suite Smartphone Applications directly from the Apple Store and run them on Oracle Business Suite 12.1.3 or 12.2.3 – the same client-side code runs with either release: iTunes link: https://itunes.apple.com/us/app/oracle-timecards-for-oracle/id883064245?mt=8  For each app, an administrator performs a simple, one-time ennoblement using server-side patches. For deployment instructions, see Oracle E-Business Suite Mobile Apps, Release 12.1 and 12.2 Documentation (Note 1641772.1). Demo Availability   Support for demo-ING in GS environments will be available shortly. A demo preview of Oracle Mobile Timecards for Oracle E-Business Suite is available here. Configured Layouts on Mobile Timecards Note.1671889.1 Mobile Timecard Layout Configuration Whitepaper for OTL Mobile Time Entry /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-family:"Times New Roman","serif";}

    Read the article

< Previous Page | 9 10 11 12 13 14 15 16 17  | Next Page >