Search Results

Search found 13693 results on 548 pages for 'python metaprogramming'.

Page 136/548 | < Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >

  • Decoding not reversing unicode encoding in Django/Python

    - by PhilGo20
    Ok, I have a hardcoded string I declare like this name = u"Par Catégorie" I have a # -- coding: utf-8 -- magic header, so I am guessing it's converted to utf-8 Down the road it's outputted to xml through xml_output.toprettyxml(indent='....', encoding='utf-8') And I get a UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 3: ordinal not in range(128) Most of my data is in French and is ouputted correctly in CDATA nodes, but that one harcoded string keep ... I don't see why an ascii codec is called. what's wrong ?

    Read the article

  • Help a Python newbie with a Django model inheritance problem

    - by Joshmaker
    I'm working on my first real Django project after years of PHP programming, and I am running into a problem with my models. First, I noticed that I was copying and pasting code between the models, and being a diligent OO programmer I decided to make a parent class that the other models could inherit from: class Common(model.Model): self.name = models.CharField(max_length=255) date_created = models.DateTimeField(auto_now_add=True) date_modified = models.DateTimeField(auto_now=True) def __unicode__(self): return self.name class Meta: abstract=True So far so good. Now all my other models extend "Common" and have names and dates like I want. However, I have a class for "Categories" were the name has to be unique. I assume there should be a relatively simple way for me to access the name attribute from Common and make it unique. However, the different methods I have tried to use have all failed. For example: class Category(Common): def __init__(self, *args, **kwargs): self.name.unique=True Spits up the error "Caught an exception while rendering: 'Category' object has no attribute 'name' Can someone point me in the right direction?

    Read the article

  • Can't get MySQL source query to work using Python mysqldb module

    - by Chris
    I have the following lines of code: sql = "source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql" cursor.execute (sql) When I execute my program, I get the following error: Error 1064: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'source C:\My Dropbox\workspace\projects\hosted_inv\create_site_db.sql' at line 1 Now I can copy and past the following into mysql as a query: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql And it works perfect. When I check the query log for the query executed by my script, it shows that my query was the following: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql However, when I manually paste it in and execute, the entire create_site_db.sql gets expanded in the query log and it shows all the sql queries in that file. Am I missing something here on how mysqldb does queries? Am I running into a limitation. My goal is to run a sql script to create the schema structure, but I don't want to have to call mysql in a shell process to source the sql file. Any thoughts? Thanks!

    Read the article

  • feedparser fails during script run, but can't reproduce in interactive python console

    - by Rhubarb
    It's failing with this when I run eclipse or when I run my script in iPython: 'ascii' codec can't decode byte 0xe2 in position 32: ordinal not in range(128) I don't know why, but when I simply execute the feedparse.parse(url) statement using the same url, there is no error thrown. This is stumping me big time. The code is as simple as: try: d = feedparser.parse(url) except Exception, e: logging.error('Error while retrieving feed.') logging.error(e) logging.error(formatExceptionInfo(None)) logging.error(formatExceptionInfo1()) Here is the stack trace: d = feedparser.parse(url) File "C:\Python26\lib\site-packages\feedparser.py", line 2623, in parse feedparser.feed(data) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 143, in goahead k = self.parse_endtag(i) File "C:\Python26\lib\sgmllib.py", line 320, in parse_endtag self.finish_endtag(tag) File "C:\Python26\lib\sgmllib.py", line 360, in finish_endtag self.unknown_endtag(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 476, in unknown_endtag method() File "C:\Python26\lib\site-packages\feedparser.py", line 1318, in _end_content value = self.popContent('content') File "C:\Python26\lib\site-packages\feedparser.py", line 700, in popContent value = self.pop(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 641, in pop output = _resolveRelativeURIs(output, self.baseuri, self.encoding) File "C:\Python26\lib\site-packages\feedparser.py", line 1594, in _resolveRelativeURIs p.feed(htmlSource) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 138, in goahead k = self.parse_starttag(i) File "C:\Python26\lib\sgmllib.py", line 296, in parse_starttag self.finish_starttag(tag, attrs) File "C:\Python26\lib\sgmllib.py", line 338, in finish_starttag self.unknown_starttag(tag, attrs) File "C:\Python26\lib\site-packages\feedparser.py", line 1588, in unknown_starttag attrs = [(key, ((tag, key) in self.relative_uris) and self.resolveURI(value) or value) for key, value in attrs] File "C:\Python26\lib\site-packages\feedparser.py", line 1584, in resolveURI return _urljoin(self.baseuri, uri) File "C:\Python26\lib\site-packages\feedparser.py", line 286, in _urljoin return urlparse.urljoin(base, uri) File "C:\Python26\lib\urlparse.py", line 215, in urljoin params, query, fragment)) File "C:\Python26\lib\urlparse.py", line 184, in urlunparse return urlunsplit((scheme, netloc, url, query, fragment)) File "C:\Python26\lib\urlparse.py", line 192, in urlunsplit url = scheme + ':' + url File "C:\Python26\lib\encodings\cp1252.py", line 15, in decode return codecs.charmap_decode(input,errors,decoding_table)

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • Python: Split by 1 or more occurrences of a delimiter

    - by Adam Matan
    Hi, I have a formatted string from a log file, which looks like: >>> a="test result" That is, the test and the result are split by some spaces - it was probably created using formatted string which gave test some constant spacing. Simple splitting won't do the trick: >>> a.split(" ") ['test', '', '', '', ... '', '', '', '', '', '', '', '', '', '', '', 'result'] split(DELIMITER, COUNT) cleared some unnecessary values: >>> a.split(" ",1) ['test', ' result'] This helped - but of course, I really need: ['test', 'result'] I can use split() followed by map + strip(), but I wondered if there is a more Pythonic way to do it. Thanks, Adam

    Read the article

  • Working with bytes and binary data in Python

    - by ignoramus
    Four consecutive bytes in a byte string together specify some value. However, only 7 bits in each byte are used; the most significant bit is ignored (that makes 28 bits altogether). So... b"\x00\x00\x02\x01" would be 000 0000 000 0000 000 0010 000 0001. Or, for the sake of legibility, 10 000 0001. That's the value the four bytes represent. But I want a decimal, so I do this: >>> 0b100000001 257 I can work all that out myself, but how would I incorporate it into a program?

    Read the article

  • read a binary file (python)

    - by beratch
    Hi, I cant read a file, and I dont understand why: f = open("test/test.pdf", "r") data = list(f.read()) print data Returns : [] I would like to open a PDF, and extract every bytes, and put it in a List. What's wrong with my code ? :( Thanks,

    Read the article

  • How to Extract data asocaited with attribute of XML file using python 3.2

    - by user1460383
    I have this xml format..... <event timestamp="0.447463" bustype="LIN" channel="LIN 1"> <col name="Time"/> <col name="Start of Frame">0.440708</col> <col name="Channel">LIN 1</col> <col name="Dir">Tx</col> <col name="Event Type">LIN Frame (Diagnostic Request)</col> <col name="Frame Name">MasterReq_DB</col> <col name="Id">3C</col> <col name="Data">81 06 04 04 FF FF 50 4C</col> <col name="Publisher">TestMaster (simulated)</col> <col name="Checksum">D3 &quot;Classic&quot;</col> <col name="Header Duration">2.090 ms (40.1 bits)</col> <col name="Resp. Duration">4.688 ms (90.0 bits)</col> <col name="Time difference">0.049987</col> <empty/> </event> In above xml, i need to extract data associated with attribute 'name' Am able to get all names but am unable to fetch MasterReq_DB< field Please help me ... Thanks in advance

    Read the article

  • Errno socket error in python

    - by Emma
    i wrote this code : import random import sys import urllib openfile = open(sys.argv[1]).readlines() c = random.choice(openfile) i = 0 while i < 5: i=i+1 c = random.choice(openfile) proxies = {'http': c} opener = urllib.FancyURLopener(proxies).open("http://whatismyip.com.au/").read() ::: I put 3 proxy in a txt file . : http://211.161.159.74:8080 http://119.70.40.101:8080 http://124.42.10.119:8080 but when execute it i get this error : IOError: [Errno socket error] (10054, 'Connection reset by peer') what am i going to do ? please help me .

    Read the article

  • python parsing file json

    - by michele
    File json: {"maps":[{"id":"blabla","iscategorical":"0"},{"id":"blabla","iscategorical":"0"}], "masks":["id":"valore"], "om_points":"value", "parameters":["id":"valore"] } I write this script but it only print all the text. json_data=open(file_directory).read() data = json.loads(json_data) pprint(data) How can I parse the file and extract single values? Thanks in advance.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Python, a smarter way of string to integer conversion

    - by Hellnar
    Hello I have written this code to convert string in such format "0(532) 222 22 22" to integer such as 05322222222 . class Phone(): def __init__(self,input): self.phone = input def __str__(self): return self.phone #convert to integer. def to_int(self): return int((self.phone).replace(" ","").replace("(","").replace(")","")) test = Phone("0(532) 222 22 22") print test.to_int() It feels very clumsy to use 3 replace methods to solve this. I am curious if there is a better solution?

    Read the article

  • Python metaclass for enforcing immutability of custom types

    - by Mark Lehmacher
    Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

    Read the article

  • mouse rollover event in Python (VPython)

    - by kame
    Is there something similar to scene.mouse.getclick in the visual module (VPython)? I need it for a rollover. Thanks in advance. EDIT: I need a function for doing something when the mouse moves inside a special area without clicking.

    Read the article

  • Python: unable to inherit from a C extension.

    - by celil
    I am trying to add a few extra methods to a matrix type from the pysparse library. Apart from that I want the new class to behave exactly like the original, so I chose to implement the changes using inheritance. However, when I try from pysparse import spmatrix class ll_mat(spmatrix.ll_mat): pass this results in the following error TypeError: Error when calling the metaclass bases cannot create 'builtin_function_or_method' instances What is this causing this error? Is there a way to use delegation so that my new class behaves exactly the same way as the original?

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

  • Python dealing with dates and times

    - by randombits
    I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

    Read the article

  • python search replace using wildcards

    - by tom smith
    hi somewhat confused.. but trying to do a search/repace using wildcards if i have something like: <blah.... ssf ff> <bl.... ssf dfggg ff> <b.... ssf ghhjj fhf> and i want to replace all of the above strings with say, <hh >t any thoughts/comments on how this can be accomplished? thanks update (thanks for the comments!) i'm missing something... my initial sample text are: Soo Choi</span>LONGEDITBOX">Apryl Berney Soo Choi</span>LONGEDITBOX">Joel Franks Joel Franks</span>GEDITBOX">Alexander Yamato and i'm trying to get Soo Choi foo Apryl Berney Soo Choi foo Joel Franks Joel Franks foo Alexander Yamato i've tried derivations of name=re.sub("</s[^>]*\">"," foo ",name) but i'm missing something... thoughts... thanks

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

  • how to send file via http with python

    - by ep45
    Hello, I have a problem. I use Apache with mod_wsgi and webpy, and when i send a file on http, a lot packets are lost. This is my code : web.header('Content-Type','video/x-flv') web.header('Content-length',sizeFile) f = file(FILE_PATH, 'rb') while True: buffer = f.read(4*1024) if buffer : yield buffer else : break f.close() What in my code is wrong ? thanks.

    Read the article

< Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >