Search Results

Search found 9016 results on 361 pages for 'regex libraries'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 144/361 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • Regular expression one or more times JAVA

    - by user1381564
    Hi i am trying to match a string against a pattern this is the possible string signal CS, NS, dl: stateType := writeOrRead0; signal CS, pS : stateType := writeOrRead0; signal dS : stateType := writeOrRead0; i am only concerned with the pattern as far as the first colon. but the number of signals define can be more than one it could be three or four even this is the regular expression i have ^signal\\s*(\\w+),*\\s*(\\w+)\\s*: it will pick up the second two signal but and for the second one it picks up CS and pS and but the d and S in the next signal when i use matcher.group() come up seperately Can anyone give me an expression that will pick up all signal names whether there is one two three or more?

    Read the article

  • actionscript find and convert text to url

    - by gravesit
    I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

    Read the article

  • JavaScript: add or subtract from number in string

    - by yoavf
    I have a string that looks like "(3) New stuff" where 3 can be any number. I would like to add or subtract to this number. I figured out the following way: var thenumber = string.match((/\d+/)); thenumber++; string = string.replace(/\(\d+\)/ ,'('+ thenumber +')'); Is there a more elegant way to do it?

    Read the article

  • Sed: regular expression match lines without <!--

    - by sixtyfootersdude
    I have a sed command to comment out xml commands sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml Takes: <a> <!-- Comment --> <b> bla </b> </a> Produces: <!-- Security: <a> --> <!-- Security: <!-- Comment --> --> // NOTE: there are two end comments. <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> Ideally I would like to not use my sed script to comment things that are already commented. Ie: <!-- Security: <a> --> <!-- Comment --> <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> I could do something like this: sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml sed 's/^[ \t]*<!-- Security: \(<!--.*-->\) -->/\1/' web.xml but I think a one liner is cleaner (?) This is pretty similar: http://stackoverflow.com/questions/436850/matching-a-line-that-doesnt-contain-specific-text-with-regular-expressions

    Read the article

  • Elegant way to distinct Path or Entry key

    - by sum1stolemyname
    I have an application loading CAD data (Custom format), either from the local filesystem specifing an absolute path to a drawing or from a database. Database access is realized through a library function taking the drawings identifier as a parameter. the identifiers have a format like ABC 01234T56-T, while my paths a typical windows Paths (eg x:\Data\cadfiles\cadfile001.bin). I would like to write a wrapper function Taking a String as an argument which can be either a path or an identifier which calls the appropriate functions to load my data. Like this: Function CadLoader(nameOrPath : String):TCadData; My Question: How can I elegantly decide wether my string is an idnetifier or a Path to a file? Use A regexp? Or just search for '\' and ':', which are not appearing in the Identifiers?

    Read the article

  • How to match a variable list of items separated by commas

    - by user261915
    I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

    Read the article

  • Regular expression to match text that doesn't start with substring?

    - by Steven
    I have text with file names scattered throughout. The filenames appear in the text like this: |test.txt| |usr01.txt| |usr02.txt| |foo.txt| I want to match the filenames that don't start with usr. I came up with (?<=\|).*\.txt(?=\|) to match the filenames, but it doesn't exclude the ones starting with usr. Is this possible with regular expressions?

    Read the article

  • Regular expression - starting and ending with a letter, accepting only letters, numbers and _

    - by jreid9001
    I'm trying to write a regular expression which specifies that text should start with a letter, every character should be a letter, number or underscore, there should not be 2 underscores in a row and it should end with a letter or number. At the moment, the only thing I have is ^[a-zA-Z]\w[a-zA-Z1-9_] but this doesn't seem to work properly since it only ever matches 3 characters, and allows repeated underscores. I also don't know how to specify requirements for the last character.

    Read the article

  • How can I test if an input field contains foreign characters?

    - by zeckdude
    I have an input field in a form. Upon pushing submit, I want to validate to make sure the user entered non-latin characters only, so any foreign language characters, like Chinese among many others. Or at the very least test to make sure it does not contain any latin characters. Could I use a regular expression for this? What would be the best approach for this? I am validating in both javaScript and in PHP. What solutions can I use to check for foreign characters in the input field in both programming languages?

    Read the article

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Match Phrases (in array) in text string

    - by Tim Hanssen
    I'm using the Twitter API streaming to collect thousand of tweets every minute. They need to be matched to a list of keywords (can contain spaces). This is my current method: $text = preg_replace( '/[^a-z0-9]+/i', ' ', strtolower( $data['text'] ) ); $breakout = explode( " ", $text ); $result = array_intersect( $this->_currentTracks, $breakout ); I chop the tweet into words, and the matches them against my current keywords. This works well for all the keywords without a space ofc. If I wanted to find for example "Den Haag", It won't show up, because the string is exploded into words (based on the spaces). Any ideas about how I can do this in a quick way? Kind regards, Tim

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Need to add specific characters to regular expression

    - by lordryan
    i'm using the following regular expression to form a basic email validation. var emailRegEx = /^([a-zA-Z0-9])(([a-zA-Z0-9])*([\._\+-])*([a-zA-Z0-9]))*@(([a-zA-Z0-9\-])+(\.))+([a-zA-Z]{2,4})+$/; this works pretty well for what i need but i also need to exclude these specific characters for reasons i won't go into. !,#,$,%,^,&,*,(,),-,+,|,{,},[,],:,>,<,?,/,\,= - (the characters between the "," if that isn't clear) could someone help me with adding the second group to the first? I know the pro's and cons of using javascript to validate email addresses - i have to do it this way. thanks.

    Read the article

  • extracting multiple fields from a text file using php

    - by Dave
    Hi, what is the best way of extracting multiple (~40 values) from a text file using php? the data is more or less like: NAMEA valuea NAMEB valueb I'm looking for a proper* approach to extracting this data into a data-structure, because i will need to specify regexs for all of them (all 40). did i make myself clear? *meaning, the default/painful method would be for me to do: $namea = extractfunction("regexa", $textfilevalue); $nameb = extractfunction("regeb", $textfilevalue); ... 40 times!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >