Search Results

Search found 13596 results on 544 pages for 'mechanize python'.

Page 160/544 | < Previous Page | 156 157 158 159 160 161 162 163 164 165 166 167  | Next Page >

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Exporting dates properly formatted on Google Appengine in Python

    - by Chris M
    I think this is right but google appengine seems to get to a certain point and cop-out; Firstly is this code actually right; and secondly is there away to skip the record if it cant output (like an ignore errors and continue)? class TrackerExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'SearchRec', [('__key__', lambda key:key.name(), None), ('WebSite', str, None), ('DateStamp', lambda x: datetime.datetime.strptime(x, '%d-%m-%Y').date(), None), ('IP', str, None), ('UserAgent', str, None)]) Thanks

    Read the article

  • How to print a dictionary in python c api function

    - by dizgam
    PyObject* dict = PyDict_New(); PyDict_SetItem(dict, key, value); PyDict_GetItem(dict, key); Bus error if i use getitem function otherwise not. So Want to confirm that the dictionary has the same values which i have set. Other than using PyDict_GetItem function, Is there any other method to print the values of the dictionary?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Python: Taking an array and break it into subarrays based on some criteria

    - by randombits
    I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day). In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.

    Read the article

  • Python - Subprocess Popen and Thread error

    - by n0idea
    In both functions record and ftp, i have subprocess.Popen if __name__ == '__main__': try: t1 = threading.Thread(target = record) t1.daemon = True t1.start() t2 = threading.Thread(target = ftp) t2.daemon = True t2.start() except (KeyboardInterrupt, SystemExit): sys.exit() The error I'm receiving is: Exception in thread Thread-1 (most likely raised during interpreter shutdown): Traceback (most recent call last): File "/usr/lib/python2.7/threading.py", line 551, in __bootstrap_inner File "/usr/lib/python2.7/threading.py", line 504, in run File "./in.py", line 20, in recordaudio File "/usr/lib/python2.7/subprocess.py", line 493, in call File "/usr/lib/python2.7/subprocess.py", line 679, in __init__ File "/usr/lib/python2.7/subprocess.py", line 1237, in _execute_child <type 'exceptions.AttributeError'>: 'NoneType' object has no attribute 'close' What might the issue be ?

    Read the article

  • I want to design a html form in python

    - by VaIbHaV-JaIn
    when user will enter details in the text box on the html from <h1>Please enter new password</h1> <form method="POST" enctype="application/json action="uid"> Password<input name="passwd"type="password" /><br> Retype Password<input name="repasswd" type="password" /><br> <input type="Submit" /> </form> </body> i want to post the data in json format through http post request and also i want to set content-type = application/json

    Read the article

  • Implement loops for python 3

    - by Alex
    Implement this loop: total up the product of the numbers from 1 to x. Implement this loop: total up the product of the numbers from a to b. Implement this loop: total up the sum of the numbers from a to b. Implement this loop: total up the sum of the numbers from 1 to x. Implement this loop: count the number of characters in a string s. i'm very lost on implementing loops these are just some examples that i am having trouble with-- if someone could help me understand how to do them that would be awesome

    Read the article

  • Rectangle Rotation in Python/Pygame

    - by mramazingguy
    Hey I'm trying to rotate a rectangle around its center and when I try to rotate the rectangle, it moves up and to the left at the same time. Does anyone have any ideas on how to fix this? def rotatePoint(self, angle, point, origin): sinT = sin(radians(angle)) cosT = cos(radians(angle)) return (origin[0] + (cosT * (point[0] - origin[0]) - sinT * (point[1] - origin[1])), origin[1] + (sinT * (point[0] - origin[0]) + cosT * (point[1] - origin[1]))) def rotateRect(self, degrees): center = (self.collideRect.centerx, self.collideRect.centery) self.collideRect.topleft = self.rotatePoint(degrees, self.collideRect.topleft, center) self.collideRect.topright = self.rotatePoint(degrees, self.collideRect.topright, center) self.collideRect.bottomleft = self.rotatePoint(degrees, self.collideRect.bottomleft, center) self.collideRect.bottomright = self.rotatePoint(degrees, self.collideRect.bottomright, center)

    Read the article

  • Extract anything that looks like links from large amount of data in python

    - by Riz
    Hi, I have around 5 GB of html data which I want to process to find links to a set of websites and perform some additional filtering. Right now I use simple regexp for each site and iterate over them, searching for matches. In my case links can be outside of "a" tags and be not well formed in many ways(like "\n" in the middle of link) so I try to grab as much "links" as I can and check them later in other scripts(so no BeatifulSoup\lxml\etc). The problem is that my script is pretty slow, so I am thinking about any ways to speed it up. I am writing a set of test to check different approaches, but hope to get some advices :) Right now I am thinking about getting all links without filtering first(maybe using C module or standalone app, which doesn't use regexp but simple search to get start and end of every link) and then using regexp to match ones I need.

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • filtering elements from list of lists in Python?

    - by user248237
    I want to filter elements from a list of lists, and iterate over the elements of each element using a lambda. For example, given the list: a = [[1,2,3],[4,5,6]] suppose that I want to keep only elements where the sum of the list is greater than N. I tried writing: filter(lambda x, y, z: x + y + z >= N, a) but I get the error: <lambda>() takes exactly 3 arguments (1 given) How can I iterate while assigning values of each element to x, y, and z? Something like zip, but for arbitrarily long lists. thanks, p.s. I know I can write this using: filter(lambda x: sum(x)..., a) but that's not the point, imagine that these were not numbers but arbitrary elements and I wanted to assign their values to variable names.

    Read the article

  • how to use @ in python.. and the @property

    - by zjm1126
    this is my code: def a(): print 'sss' @a() def b(): print 'aaa' b() and the Traceback is: sss Traceback (most recent call last): File "D:\zjm_code\a.py", line 8, in <module> @a() TypeError: 'NoneType' object is not callable so how to use the '@' thanks updated class a: @property def b(x): print 'sss' aa=a() print aa.b it print : sss None how to use @property thanks

    Read the article

  • Optimizing python code performance when importing zipped csv to a mongo collection

    - by mark
    I need to import a zipped csv into a mongo collection, but there is a catch - every record contains a timestamp in Pacific Time, which must be converted to the local time corresponding to the (longitude,latitude) pair found in the same record. The code looks like so: def read_csv_zip(path, timezones): with ZipFile(path) as z, z.open(z.namelist()[0]) as input: csv_rows = csv.reader(input) header = csv_rows.next() check,converters = get_aux_stuff(header) for csv_row in csv_rows: if check(csv_row): row = { converter[0]:converter[1](value) for converter, value in zip(converters, csv_row) if allow_field(converter) } ts = row['ts'] lng, lat = row['loc'] found_tz_entry = timezones.find_one(SON({'loc': {'$within': {'$box': [[lng-tz_lookup_radius, lat-tz_lookup_radius],[lng+tz_lookup_radius, lat+tz_lookup_radius]]}}})) if found_tz_entry: tz_name = found_tz_entry['tz'] local_ts = ts.astimezone(timezone(tz_name)).replace(tzinfo=None) row['tz'] = tz_name else: local_ts = (ts.astimezone(utc) + timedelta(hours = int(lng/15))).replace(tzinfo = None) row['local_ts'] = local_ts yield row def insert_documents(collection, source, batch_size): while True: items = list(itertools.islice(source, batch_size)) if len(items) == 0: break; try: collection.insert(items) except: for item in items: try: collection.insert(item) except Exception as exc: print("Failed to insert record {0} - {1}".format(item['_id'], exc)) def main(zip_path): with Connection() as connection: data = connection.mydb.data timezones = connection.timezones.data insert_documents(data, read_csv_zip(zip_path, timezones), 1000) The code proceeds as follows: Every record read from the csv is checked and converted to a dictionary, where some fields may be skipped, some titles be renamed (from those appearing in the csv header), some values may be converted (to datetime, to integers, to floats. etc ...) For each record read from the csv, a lookup is made into the timezones collection to map the record location to the respective time zone. If the mapping is successful - that timezone is used to convert the record timestamp (pacific time) to the respective local timestamp. If no mapping is found - a rough approximation is calculated. The timezones collection is appropriately indexed, of course - calling explain() confirms it. The process is slow. Naturally, having to query the timezones collection for every record kills the performance. I am looking for advises on how to improve it. Thanks. EDIT The timezones collection contains 8176040 records, each containing four values: > db.data.findOne() { "_id" : 3038814, "loc" : [ 1.48333, 42.5 ], "tz" : "Europe/Andorra" } EDIT2 OK, I have compiled a release build of http://toblerity.github.com/rtree/ and configured the rtree package. Then I have created an rtree dat/idx pair of files corresponding to my timezones collection. So, instead of calling collection.find_one I call index.intersection. Surprisingly, not only there is no improvement, but it works even more slowly now! May be rtree could be fine tuned to load the entire dat/idx pair into RAM (704M), but I do not know how to do it. Until then, it is not an alternative. In general, I think the solution should involve parallelization of the task. EDIT3 Profile output when using collection.find_one: >>> p.sort_stats('cumulative').print_stats(10) Tue Apr 10 14:28:39 2012 ImportDataIntoMongo.profile 64549590 function calls (64549180 primitive calls) in 1231.257 seconds Ordered by: cumulative time List reduced from 730 to 10 due to restriction <10> ncalls tottime percall cumtime percall filename:lineno(function) 1 0.012 0.012 1231.257 1231.257 ImportDataIntoMongo.py:1(<module>) 1 0.001 0.001 1230.959 1230.959 ImportDataIntoMongo.py:187(main) 1 853.558 853.558 853.558 853.558 {raw_input} 1 0.598 0.598 370.510 370.510 ImportDataIntoMongo.py:165(insert_documents) 343407 9.965 0.000 359.034 0.001 ImportDataIntoMongo.py:137(read_csv_zip) 343408 2.927 0.000 287.035 0.001 c:\python27\lib\site-packages\pymongo\collection.py:489(find_one) 343408 1.842 0.000 274.803 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:699(next) 343408 2.542 0.000 271.212 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:644(_refresh) 343408 4.512 0.000 253.673 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:605(__send_message) 343408 0.971 0.000 242.078 0.001 c:\python27\lib\site-packages\pymongo\connection.py:871(_send_message_with_response) Profile output when using index.intersection: >>> p.sort_stats('cumulative').print_stats(10) Wed Apr 11 16:21:31 2012 ImportDataIntoMongo.profile 41542960 function calls (41542536 primitive calls) in 2889.164 seconds Ordered by: cumulative time List reduced from 778 to 10 due to restriction <10> ncalls tottime percall cumtime percall filename:lineno(function) 1 0.028 0.028 2889.164 2889.164 ImportDataIntoMongo.py:1(<module>) 1 0.017 0.017 2888.679 2888.679 ImportDataIntoMongo.py:202(main) 1 2365.526 2365.526 2365.526 2365.526 {raw_input} 1 0.766 0.766 502.817 502.817 ImportDataIntoMongo.py:180(insert_documents) 343407 9.147 0.000 491.433 0.001 ImportDataIntoMongo.py:152(read_csv_zip) 343406 0.571 0.000 391.394 0.001 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:384(intersection) 343406 379.957 0.001 390.824 0.001 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:435(_intersection_obj) 686513 22.616 0.000 38.705 0.000 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:451(_get_objects) 343406 6.134 0.000 33.326 0.000 ImportDataIntoMongo.py:162(<dictcomp>) 346 0.396 0.001 30.665 0.089 c:\python27\lib\site-packages\pymongo\collection.py:240(insert) EDIT4 I have parallelized the code, but the results are still not very encouraging. I am convinced it could be done better. See my own answer to this question for details.

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • python feedparser with yahoo weather rss

    - by mudder
    I'm trying to use feedparser to get some data from yahoos weather rss. It looks like feed parser strips out the yweather namespace data: http://weather.yahooapis.com/forecastrss?w=24260013&u=c <yweather:condition text="Fair" code="34" temp="23" date="Wed, 19 May 2010 5:55 pm EDT" /> looks like feedparser is completely ignoring that. is there away to get it?

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • Python module being reloaded for each request with django and mod_wsgi

    - by Vishal
    I have a variable in init of a module which get loaded from the database and takes about 15 seconds. For django development server everything is working fine but looks like with apache2 and mod_wsgi the module is loaded with every request (taking 15 seconds). Any idea about this behavior? Update: I have enabled daemon mode in mod wsgi, looks like its not reloading the modules now! needs more testing and I will update.

    Read the article

< Previous Page | 156 157 158 159 160 161 162 163 164 165 166 167  | Next Page >