Search Results

Search found 57986 results on 2320 pages for 'breadth first search'.

Page 177/2320 | < Previous Page | 173 174 175 176 177 178 179 180 181 182 183 184  | Next Page >

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Teach Perl as a first language?

    - by yossale
    I need to teach a non-programmer the basics of computer programming + some basic programming skills (- He's going to be in a position between the clients and the programmers , so the company requires him to learn the basic concepts of programming). I thought of Perl - You can teach it without getting into typing and pointers and it's syntax is very close to human (precious "bless" :) ) - but I'm a bit troubled because I feel like I'm going to "spoil" him for other languages in the future (C,C++,Java - What some people call "Real" languages) - exactly because of the reasons mentioned above. What do you think?

    Read the article

  • javascript regex: match altered version of first match with only one expression

    - by theseion
    Hi there I'm writing a brush for Alex Gorbatchev's Syntax Highlighter to get highlighting for Smalltalk code. Now, consider the following Smalltalk code: aCollection do: [ :each | each shout ] I want to find the block argument ":each" and then match "each" every time it occurrs afterwards (for simplicity, let's say every occurrence an not just inside the brackets). Note that the argument can have any name, e.g. ":myArg". My attempt to match ":each": \:([\d\w]+) This seems to work. The problem is for me to match the occurrences of "each". I thought something like this could work: \:([\d\w]+)|\1 but the right hand side of the alternation seems to be treated as an independent expression, so backreferencing doesn't work. So my question is: is it even possible to accomplish what I want in a single expression? Or would I have to use the backreference within a second expression (via another function call)? Cheers.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Raw XML Push from input stream captures only the first line of XML

    - by pqsk
    I'm trying to read XML that is being pushed to my java app. I originally had this in my glassfish server working. The working code in glassfish is as follows: public class XMLPush implements Serializable { public void processXML() { StringBuilder sb = new StringBuilder(); BufferedReader br = null; try { br = ((HttpServletRequest)FacesContext.getCurrentInstance().getExternalContext().getRequest()).getReader (); String s = null; while((s = br.readLine ()) != null) { sb.append ( s ); } //other code to process xml ........... ............................. }catch(Exception ex) { XMLCreator.exceptionOutput ( "processXML","Exception",ex); } .... ..... }//processXML }//class It works perfect, but my client is unable to have glassfish on their server. I tried grabbing the raw xml from php, but I couldn't get it to work. I decided to open up a socket and listen for the xml push manually. Here is my code for receiving the push: public class ListenerService extends Thread { private BufferedReader reader = null; private String line; public ListenerService ( Socket connection )thows Exception { this.reader = new BufferedReader ( new InputStreamReader ( connection.getInputStream () ) ); this.line = null; }//ListenerService @Override public void run () { try { while ( (this.line = this.reader.readLine ()) != null) { System.out.println ( this.line ); ........ }//while } System.out.println ( ex.toString () ); } } catch ( Exception ex ) { ... }//catch }//run I haven't done much socket programing, but from what I read for the past week is that passing the xml into a string is bad. What am I doing wrong and why is it that in glassfish server it works, and when I just open a socket myself it doesn't? this is all that I receive from the push: PUT /?XML_EXPORT_REASON=ResponseLoop&TIMESTAMP=1292559547 HTTP/1.1 Host: ************************ Accept: */* Content-Length: 470346 Expect: 100-continue <?xml version="1.0" encoding="UTF-8" ?> Where did the xml go? Is it because I am placing it in a string? I just need to grab the xml and save it into a file and then process it. Everything else works, but this.Any help would be greatly appreciated.

    Read the article

  • First order logic formula

    - by user177883
    R(x) is a red block B(x) is a blue block T(x,y) block x is on top of block y Question: Write a formula asserting that if no red block is on top of a red block then no red block is on top of itself. My answer: (Ax)(Ay)(R(x) and R(y) - ~T(x,y))-(Ax)(R(x)- ~T(x,x)) A = For all

    Read the article

  • Exporting a report from Crystal 8.5 causes the report to first refresh, then export, with unexpected

    - by LittleBobbyTables
    We have a VB6 application that can generate reports using the Crystal Reports 8.5 runtime. To generate one of the more complicated reports we have, the VB app does the following: Deletes records from a SQL table (we'll call it Foo) based on the session ID of the user Performs a select statement, and populates the Foo table with the contents of the select statement. Massages the data in Foo. Executes the report (we'll call it Bar). The Bar report uses the Foo table as part of some outer joins to get some descriptions. After the report is opened and populated, the code then deletes the records in Foo. If you ever look in Foo there will be no data since it is always purged at the end, but the Crystal Report will still have the data, since Foo wasn't cleared out until after the report ran. Most sites can export this report afterwards, to either PDF or Excel, with no issue. One site, however, has two servers in production where if you attempt to export the Bar report (doesn't matter what format it is exported to), the report will visibly refresh and then export the report in the requested format. This refresh, however, causes the exported data to be invalid because the report is still doing the outer joins to the Foo table, which is now empty. I'm at a total loss why the report refreshes before printing on these two servers. One server has Crystal Reports 8.5 installed on it as well as the Crystal Reports 8.5 runtime (so they can modify reports). The other server only has the Crystal Reports 8.5 runtime (so you can generate reports from the VB application, but can't modify them on that server). Both of the servers belong to a French site. Another support staff here said the issue sounded vaguely familiar to an issue a few years ago, and suggested re-registering DLLs. I have tried unregistering and re-registering the following DLLs out of frustration: Crystl32.ocx crxlat32.dll cpeau32.dll exportmodeller.dll crtslv.dll atl.dll Unregistering and re-registering the above DLLs does not fix the issue. If we take the problem report, and run it on any of our development or QA servers, we have no issues; the report does NOT refresh before exporting, and the data looks consistent. It seems like a server or regional setting may be causing this, but what could possibly cause the report to refresh before exporting on only two of our servers? The most obvious solution is to simply alter the code so the Foo table isn't purged after the report is run, only when the report is run, but this is a production issue, the customer wants a fix now, and there's quite a few hoops to jump through to make the change.

    Read the article

  • iPhone development: Best method to allow user to chose search scope

    - by Mark Pemburn
    Hi, I'm developing my first iPhone app and want to allow the user to select the scope of their search in a more complex way than the 'scope buttons' permit. The app is related to wines and I want to the user to be able to select the 'color' (Red, White, Blush, etc.) first, and then select the type/varietal within that category. Right now, I'm using the UISearchBar's scope buttons for the colors and tapping the button opens a view with the selection of colors. This is okay except that once the 'Red' button has been selected, I can't select it a second time to change my choice of type (e.g., change from 'Merlot' to 'Syrrah', etc.) If there's a better way to do this, I'm willing to scrap my method and start from scratch. Thanks!

    Read the article

  • Storing index values in FAST-ESP without modifications

    - by Abel Morelos
    Hi, first of all I'm totally new to FAST but I already have a couple of issues I need to solve, so I'm sorry if my questions are very basic =) Well, the problem is that I have a field in the FAST index which in the source document is something like "ABC 12345" (please note the intentional whitespaces) but when stored in the index is in the form "ABC 123456" (please note that now there is a single space). If I retrieve all the document values then this specific value is OK (with all the whitespaces), my only problem is with the way the value is stored in the index since I need to retrieve and display it to my user just like it appears in the original document, and I don't want to go to the full document just for this value, I want the value that I already have in the index. I think I need to update one of the FAST XML configuration files but I don't have enough documentation at hand in order to decide where to perform the change, index_profile.xml? in the XMLMapper file?

    Read the article

  • Explaining verity index and document search limits

    - by Ahmad
    As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

    Read the article

  • javascript setTimeout() first argument: expression error

    - by Jonah
    function Timer() { this.initialTime = 0; this.timeStart = null; this.getTotalTime = function() { timeEnd = new Date(); diff = timeEnd.getTime() - this.timeStart.getTime(); return diff+this.initialTime; }; this.formatTime = function() { interval = new Date(this.getTotalTime()); return interval.getHours() + ":" + interval.getMinutes() + ":" + interval.getSeconds(); }; this.start = function() { this.timeStart = new Date(); setTimeout("this.updateTime()", 1000); }; this.updateTime = function() { alert(this.formatTime()); setTimeout("this.updateTime()", 1000); }; } timer = new Timer(); timer.start(); I am getting an error: this.updateTime is not a function Any ideas? Thanks

    Read the article

  • Creating stored procedure having different WHERE clause on different search criteria without putting

    - by Muhammad Kashif Nadeem
    Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

    Read the article

  • Presence icon only showing for first person

    - by James123
    I am trying to show my colleagues in my custom webpart. So I adding presence Icon to each of colleague. It is showing fine when colleague is 1 only. If We have colleague more than 1 Presence Icon showing for 1st colleague you can dropdow that Icon also but other colleagues it is show simple Presense Icon (grayout) (not drop down is comming). code is like this. private static Panel GetUserInfo(UserProfile profile,Panel html, int cnt) { LiteralControl imnrc = new LiteralControl(); imnrc.Text = "<span style=\"padding: 0 5px 0 5px;\"><img border=\"0\" valign=\"middle\" height=\"12\" width=\"12\" src=\"/_layouts/images/imnhdr.gif\" onload=\"IMNRC('" + profile[PropertyConstants.WorkEmail].Value.ToString() + "')\" ShowOfflinePawn=1 id=\"IMID[GUID]\" ></span>"; html.Controls.Add(imnrc); html.Controls.Add(GetNameControl(profile)); //html.Controls.Add(new LiteralControl("<br>")); return html; } private static Control GetNameControl(UserProfile profile) { //bool hasMySite = profile[PropertyConstants.PublicSiteRedirect].Value == null ? false : true; bool hasMySite =string.IsNullOrEmpty(profile.PublicUrl.ToString()) ? false : true; string name = profile[PropertyConstants.PreferredName].Value.ToString(); if (hasMySite) { HyperLink control = new HyperLink(); control.NavigateUrl = String.IsNullOrEmpty(profile.PublicUrl.ToString()) ? null : profile.PublicUrl.ToString(); control.Style.Add("text-decoration","none"); control.Text = name; return control; } else { LiteralControl control = new LiteralControl(); control.Text = name; return control; } } http://i700.photobucket.com/albums/ww5/vsrikanth/presence-1.jpg

    Read the article

  • Java Searchable JTree

    - by Studer
    I'm trying to use the Searchable JTree from girishchavan on a FileSystemModel from Sun. It didn't work the first time because Sun's Node implementation is a File so I transform it into DefaultMutableTreeNode to be compatible with Searchable JTree. I also edited Searchable JTree to match the path of a file. But it still doesn't work. As far as I can see, it seems that the Searchable JTree only detects the root of the original JTree and cannot go further. Maybe the Nodes are not bind to each others even if they display correctly in a JTree. How can I make it compatible ?

    Read the article

  • Scribe-LinkedIn Search API

    - by Rupeshit
    Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

    Read the article

  • Search for index.php and index.html and replace string

    - by Jonas
    Hello. I recently had some sort of Malware on my computer that added to all index.php and index.html ON THE WEBSERVER! the following string(s): echo "<iframe src=\"http://fabujob.com/?click=AD4A4\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; echo "<iframe src=\"http://fabujob.com/?click=AC785\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; So the parameter after "click=" always changes. These two were only examples. Is there a way to do that quick and fast? . . EDIT: It is on my webserver, so no use of find...

    Read the article

  • php scandir --> search for files/directories

    - by Peter
    Hi! I searched before I ask, without lucky.. I looking for a simple script for myself, which I can search for files/folders. Found this code snippet in the php manual (I think I need this), but it is not work for me. "Was looking for a simple way to search for a file/directory using a mask. Here is such a function. By default, this function will keep in memory the scandir() result, to avoid scaning multiple time for the same directory." <?php function sdir( $path='.', $mask='*', $nocache=0 ){ static $dir = array(); // cache result in memory if ( !isset($dir[$path]) || $nocache) { $dir[$path] = scandir($path); } foreach ($dir[$path] as $i=>$entry) { if ($entry!='.' && $entry!='..' && fnmatch($mask, $entry) ) { $sdir[] = $entry; } } return ($sdir); } ?> Thank you for any help, Peter

    Read the article

  • To find first N prime numbers in python

    - by Rahul Tripathi
    Hi All, I am new to the programming world. I was just writing this code in python to generate N prime numbers. User should input the value for N which is the total number of prime numbers to print out. I have written this code but it doesn't throw the desired output. Instead it prints the prime numbers till the Nth number. For eg.: User enters the value of N = 7. Desired output: 2, 3, 5, 7, 11, 13, 19 Actual output: 2, 3, 5, 7 Kindly advise. i=1 x = int(input("Enter the number:")) for k in range (1, (x+1), 1): c=0 for j in range (1, (i+1), 1): a = i%j if (a==0): c = c+1 if (c==2): print (i) else: k = k-1 i=i+1

    Read the article

  • Content search through source code in finder

    - by gf
    I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

    Read the article

  • does actionscript addChild require a display object first

    - by touB
    I'm trying to move away from mxml to actionsctipt. I have a <s:Rect> that I've created and set its properties, but having trouble adding it. var aRect:Rect = new Rect(); //set properties like aRect.x, aRect.y, aRect.width, aRect.height //tried adding it various ways addChild(aRect); Application.addChild(aRect); Application.application.addChild(aRect); stage.addChild(aRect); But I keep getting the error 1067: Implicit coercion of a value of type spark.primitives:Rect to an unrelated type flash.display:DisplayObject Originally in the mxml, it was right inside <s:Application> not nested inside anything <s:Application> <s:Rect id="aRect" x="10" y="10" width="15%" height="15%"> //then fill code here, removed for readability </s:Rect> </s:Application> What's the deal, I thought actionscript would be nicer than mxml.

    Read the article

  • Custom realm/starting Tomcat 6.0 from Netbeans 6.8/first HTTP request

    - by Drew
    I'm using NetBeans 6.8 and Tomcat 6.0.xx. I've created a custom realm and updated the NetBeans project build.xml to deploy the realm to Tomcat. When I debug the project, NetBeans starts the Tomcat server and makes an initial HTTP GET request for 'manager/list'. Tomcat graciously hands this request off to my custom realm for authentication. The request gets denied and NetBeans displays the following error in the output window: (note: error is displayed after NetBeans gets access denied) Access to Tomcat server has not been authorized. Set the correct username and password with the "manager" role in the Tomcat customizer in the Server Manager. Do I have something incorrectly configured? How do I prevent NetBeans from issuing this initial request? Thanks, Drew

    Read the article

  • c# reflection - getting the first item out of a reflected collection without casting to specific col

    - by Andy Clarke
    Hi, I've got a Customer object with a Collection of CustomerContacts IEnumerable Contacts { get; set; } In some other code I'm using Reflection and have the PropertyInfo of Contacts property var contacts = propertyInfo.GetValue(customerObject, null); I know contacts has at least one object in it, but how do I get it out? I don't want to Cast it to IEnumerable because I want to keep my reflection method dynamic. I thought about calling FirstOrDefault() by reflection - but can't do that easily because its an extension method. Does anyone have any ideas? Thanks

    Read the article

< Previous Page | 173 174 175 176 177 178 179 180 181 182 183 184  | Next Page >