Search Results

Search found 1742 results on 70 pages for 'combine'.

Page 21/70 | < Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >

  • Compressibility Example

    - by user285726
    From my algorithms textbook: The annual county horse race is bringing in three thoroughbreds who have never competed against one another. Excited, you study their past 200 races and summarize these as prob- ability distributions over four outcomes: first (“first place”), second, third, and other. Outcome Aurora Whirlwind Phantasm 0.15 0.30 0.20 first 0.10 0.05 0.30 second 0.70 0.25 0.30 third 0.05 0.40 0.20 other Which horse is the most predictable? One quantitative approach to this question is to look at compressibility. Write down the history of each horse as a string of 200 values (first, second, third, other). The total number of bits needed to encode these track- record strings can then be computed using Huffman’s algorithm. This works out to 290 bits for Aurora, 380 for Whirlwind, and 420 for Phantasm (check it!). Aurora has the shortest encoding and is therefore in a strong sense the most predictable. How did they get 420 for Phantasm? I keep getting 400 bytes, as so: Combine first, other = 0.4, combine second, third = 0.6. End up with 2 bits encoding each position. Is there something I've misunderstood about the Huffman encoding algorithm? Textbook available here: http://www.cs.berkeley.edu/~vazirani/algorithms.html (page 156).

    Read the article

  • How to adjust size of programatically created Bitmap to match text drawn on it?

    - by TooFat
    I have the following .ashx page that takes some query string parameters and returns a bitmap with the specified text written on it. The problem I have is that I am currently just manually setting the initial size of the bitmap at 100 X 100 when what I really want is to have the bitmap be just big enough to include all the text that was written to it. How can I do this? public void ProcessRequest (HttpContext context) { context.Response.ContentType = "image/png"; string text = context.Request.QueryString["Text"]; //set FontName string fontName; if (context.Request.QueryString["FontName"] != null) { fontName = context.Request.QueryString["FontName"]; } else { fontName = "Arial"; } //Set FontSize int fontEms; if (context.Request.QueryString["FontSize"] != null) { string fontSize = context.Request.QueryString["FontSize"]; fontEms = Int32.Parse(fontSize); } else { fontEms = 12; } //Set Font Color System.Drawing.Color color; if (context.Request.QueryString["FontColor"] != null) { string fontColor = context.Request.QueryString["FontColor"]; color = System.Drawing.ColorTranslator.FromHtml(fontColor); context.Response.Write(color.ToString()); } else { color = System.Drawing.Color.Red; } using (System.Drawing.Text.PrivateFontCollection fnts = new System.Drawing.Text.PrivateFontCollection()) using (System.Drawing.FontFamily fntfam = new System.Drawing.FontFamily(fontName)) using (System.Drawing.SolidBrush brush = new System.Drawing.SolidBrush(color)) using (System.Drawing.Bitmap bmp = new System.Drawing.Bitmap(100, 100)) { using (System.Drawing.Font fnt = new System.Drawing.Font(fntfam, fontEms)) { fnts.AddFontFile(System.IO.Path.Combine(@"C:\Development\Fonts\", fontName)); System.Drawing.Graphics graph = System.Drawing.Graphics.FromImage(bmp); graph.DrawString(text, fnt, brush, new System.Drawing.Point(0, 0)); string imgPath = System.IO.Path.Combine(@"C:\Development\MyPath\Images\Text", System.IO.Path.GetRandomFileName()); bmp.Save(imgPath); context.Response.WriteFile(imgPath); } } }

    Read the article

  • JQuery methods and DOM properties

    - by Bob Smith
    I am confused as to when I can use the DOM properties and when I could use the Jquery methods on a Jquery object. Say, I use a selector var $elemSel = $('#myDiv').find('[id *= \'select\']') At this point, $elemSel is a jquery object which I understand to be a wrapper around the array of DOM elements. I could get a reference to the DOM elements by iterating through the $elemSel object/array (Correct?) My questions: 1. Is there a way to convert this $elemSel into a non JQuery regular array of DOM elements? 2. Can I combine DOM properties and JQuery methods at the same time (something like this) $elemSel.children('td').nodeName (nodeName is DOM related, children is JQuery related) EDIT: What's wrong with this? $elemSel.get(0).is(':checked') EDIT 2: Thanks for the responses. I understand now that I can use the get(0) to get a DOM element. Additional questions: How would I convert a DOM element to a JQuery object? If I assign "this" to a variable, is that new var DOM or JQuery? If it's JQuery, how can I convert this to a DOM element? (Since I can't use get(0)) var $elemTd = $(this); When I do a assignment like the one above, I have seen some code samples not include the $ sign for the variable name. Why? And as for my original question, can I combine the DOM properties and JQuery functions at the same time on a JQuery object? $elemSel.children('td').nodeName

    Read the article

  • Impossible to be const-correct when combining data and it's lock?

    - by Graeme
    I've been looking at ways to combine a piece of data which will be accessed by multiple threads alongside the lock provisioned for thread-safety. I think I've got to a point where I don't think its possible to do this whilst maintaining const-correctness. Take the following class for example: template <typename TType, typename TMutex> class basic_lockable_type { public: typedef TMutex lock_type; public: template <typename... TArgs> explicit basic_lockable_type(TArgs&&... args) : TType(std::forward<TArgs...>(args)...) {} TType& data() { return data_; } const TType& data() const { return data_; } void lock() { mutex_.lock(); } void unlock() { mutex_.unlock(); } private: TType data_; mutable TMutex mutex_; }; typedef basic_lockable_type<std::vector<int>, std::mutex> vector_with_lock; In this I try to combine the data and lock, marking mutex_ as mutable. Unfortunately this isn't enough as I see it because when used, vector_with_lock would have to be marked as mutable in order for a read operation to be performed from a const function which isn't entirely correct (data_ should be mutable from a const). void print_values() const { std::lock_guard<vector_with_lock>(values_); for(const int val : values_) { std::cout << val << std::endl; } } vector_with_lock values_; Can anyone see anyway around this such that const-correctness is maintained whilst combining data and lock? Also, have I made any incorrect assumptions here?

    Read the article

  • Multiple Inheritence with same Base Classes in Python

    - by Jordan Reiter
    I'm trying to wrap my head around multiple inheritance in python. Suppose I have the following base class: class Structure(object): def build(self, *args): print "I am building a structure!" self.components = args And let's say I have two classes that inherit from it: class House(Structure): def build(self, *args): print "I am building a house!" super(House, self).build(*args) class School(Structure): def build(self, type="Elementary", *args): print "I am building a school!" super(School, self).build(*args) Finally, a create a class that uses multiple inheritance: class SchoolHouse(School, House): def build(self, *args): print "I am building a schoolhouse!" super(School, self).build(*args) Then, I create a SchoolHouse object and run build on it: >>> sh = SchoolHouse() >>> sh.build("roof", "walls") I am building a schoolhouse! I am building a house! I am building a structure! So I'm wondering -- what happened to the School class? Is there any way to get Python to run both somehow? I'm wondering specifically because there are a fair number of Django packages out there that provide custom Managers for models. But there doesn't appear to be a way to combine them without writing one or the other of the Managers as inheriting from the other one. It'd be nice to just import both and use both somehow, but looks like it can't be done? Also I guess it'd just help to be pointed to a good primer on multiple inheritance in Python. I have done some work with Mixins before and really enjoy using them. I guess I just wonder if there is any elegant way to combine functionality from two different classes when they inherit from the same base class.

    Read the article

  • Can't seem to get .Union to work (merging 2 array's together, exclude duplicates)

    - by D. Veloper
    I want to combine two array's, excluding duplicates. I am using a custom class: public class ArcContact : IEquatable<ArcContact> { public String Text; public Boolean Equals(ArcContact other) { if (Object.ReferenceEquals(other, null)) return false; if (Object.ReferenceEquals(this, other)) return true; return Text.Equals(other.Text); } public override Int32 GetHashCode() { return Text == null ? 0 : Text.GetHashCode(); } } I implemented and the needed IEquatable interface as mentioned in this msdn section. I only want to check the Text property of the ArcContact class and make sure an Array of ArcContact have an unique Text. Here I pasted the code that I use, as you can see I have method with two parameters, array's to combine and below that the code I got from the previous mentioned msdn section. internal static class ArcBizz { internal static ArcContact[] MergeDuplicateContacts(ArcContact[] contacts1, ArcContact[] contacts2) { return (ArcContact[])contacts1.Union(contacts2); } internal static IEnumerable<T> Union<T>(this IEnumerable<T> a, IEnumerable<T> b); } What am I doing wrong?

    Read the article

  • Auditing front end performance on web application

    - by user1018494
    I am currently trying to performance tune the UI of a company web application. The application is only ever going to be accessed by staff, so the speed of the connection between the server and client will always be considerably more than if it was on the internet. I have been using performance auditing tools such as Y Slow! and Google Chrome's profiling tool to try and highlight areas that are worth targeting for investigation. However, these tools are written with the internet in mind. For example, the current suggestions from a Google Chrome audit of the application suggests is as follows: Network Utilization Combine external CSS (Red warning) Combine external JavaScript (Red warning) Enable gzip compression (Red warning) Leverage browser caching (Red warning) Leverage proxy caching (Amber warning) Minimise cookie size (Amber warning) Parallelize downloads across hostnames (Amber warning) Serve static content from a cookieless domain (Amber warning) Web Page Performance Remove unused CSS rules (Amber warning) Use normal CSS property names instead of vendor-prefixed ones (Amber warning) Are any of these bits of advice totally redundant given the connection speed and usage pattern? The users will be using the application frequently throughout the day, so it doesn't matter if the initial hit is large (when they first visit the page and build their cache) so long as a minimal amount of work is done on future page views. For example, is it worth the effort of combining all of our CSS and JavaScript files? It may speed up the initial page view, but how much of a difference will it really make on subsequent page views throughout the working day? I've tried searching for this but all I keep coming up with is the standard internet facing performance advice. Any advice on what to focus my performance tweaking efforts on in this scenario, or other auditing tool recommendations, would be much appreciated.

    Read the article

  • Gathering entropy in web apps to create (more) secure random numbers

    - by H M
    after several days of research and discussion i came up with this method to gather entropy from visitors (u can see the history of my research here) when a user visits i run this code: $entropy=sha1(microtime().$pepper.$_SERVER['REMOTE_ADDR'].$_SERVER['REMOTE_PORT']. $_SERVER['HTTP_USER_AGENT'].serialize($_POST).serialize($_GET).serialize($_COOKIE)); note: pepper is a per site/setup random string set by hand. then i execute the following (My)SQL query: $query="update `crypto` set `value`=sha1(concat(`value`, '$entropy')) where name='entropy'"; that means we combine the entropy of the visitor's request with the others' gathered already. that's all. then when we want to generate random numbers we combine the gathered entropy with the output: $query="select `value` from `crypto` where `name`='entropy'"; //... extract(unpack('Nrandom', pack('H*', sha1(mt_rand(0, 0x7FFFFFFF).$entropy.microtime())))); note: the last line is a part of a modified version of the crypt_rand function of the phpseclib. please tell me your opinion about the scheme and other ideas/info regarding entropy gathering/random number generation. ps: i know about randomness sources like /dev/urandom. this system is just an auxiliary system or (when we don't have (access to) these sources) a fallback scheme.

    Read the article

  • Combining Data from two MySQL tables.

    - by Nick
    I'm trying to combine data from two tables in MySQL with PHP. I want to select all the data (id, title, post_by, content and created_at) from the "posts" table. Then I would like to select the comment_id COUNT from the "comments" table IF the comment_id equals the posts id. Finally, I would like to echo/print something on this order: <? echo $row->title; ?> Posted by <? echo $row->post_by; ?> on <? echo $row->created_at; ?> CST <? echo $row->content; ?> <? echo $row->comment_id; ?> comments | <a href="comment.php?id=<? echo $row->id; ?>">view/post comments</a> I'm uncertain as to how to "combine" the data from two tables. I have tried numerous things and have spent several evenings and have had no luck. Any help would be greatly appreciated!

    Read the article

  • Combining XmlWriter objects?

    - by Kevin
    The way my application is structured, each component generates output as XML and returns an XmlWriter object. Before rendering the final output to the page, I combine all XML and perform an XSL transformation on that object. Below, is a simplified code sample of the application structure. Does it make sense to combine XmlWriter objects like this? Is there a better way to structure my application? The optimal solution would be one where I didn't have to pass a single XmlWriter instance as a parameter to each component. function page1Xml() { $content = new XmlWriter(); $content->openMemory(); $content->startElement('content'); $content->text('Sample content'); $content->endElement(); return $content; } function generateSiteMap() { $sitemap = new XmlWriter(); $sitemap->openMemory(); $sitemap->startElement('sitemap'); $sitemap->startElement('page'); $sitemap->writeAttribute('href', 'page1.php'); $sitemap->text('Page 1'); $sitemap->endElement(); $sitemap->endElement(); return $sitemap; } function output($content) { $doc = new XmlWriter(); $doc->openMemory(); $doc->writePi('xml-stylesheet', 'type="text/xsl" href="template.xsl"'); $doc->startElement('document'); $doc->writeRaw( generateSiteMap()->outputMemory() ); $doc->writeRaw( $content->outputMemory() ); $doc->endElement(); $doc->endDocument(); $output = xslTransform($doc); return $output; } $content = page1Xml(); echo output($content); Update: I may abandon XmlWriter altogether and use DomDocument instead. It is more flexible and it also seemed to perform better (at least on the crude tests I created).

    Read the article

  • iPhone: How to Determine Average Light/Dark of an Area of an UIImage

    - by TechZen
    I need to place labels with a transparent background over a variable-content UIImage. Readability will vary significantly depending on the relationship between the color of the label's text and the color/luminosity of the area of the image displayed under the label. Since the image will be constantly changing, the color of the label's text needs to change in sync. I have found several techniques for determining the color, perceived luminosity etc of a single pixel. However, I need to rather quickly (while a view loads) determine the rough perceived color/luminosity of an area of the UIImage under the frame of the UILabel. I presume I will also need to measure the alpha because the same color/luminosity looks different at different alpha values. Is there a way to calculate such a value for an area? Will I be reduced to simply summing pixels? If it comes to that, is there an algorithm to accomplish this? I've thought of two possible approaches: Perform some "folding" operations i.e. combining pixels from one half of the area to the other half. Then repeat until I get a single value. Would this be practical? How would you logically combine pixels to average their perceived color/luminosity? Sample a statistically significant number of pixels in the area and then combine them (somehow) to get a rough measure. I think this problem comes up a lot these days with people being so found of customizing backgrounds. Seems like something that would be worth my time to bang out a category or class to handle this and then share it around.

    Read the article

  • Combining two .png images into one image using .NET

    - by Omega
    I have two (actually many) .png images in my application. Both have transparent areas here and there. I want, in my application, to take both images, combine them, and display the result in a picture box. Later I want to save the result through a button. So far I managed to find the two images and combine them, but it seems the transparency thing won't work. I mean, if you put one image over another, only the top image is visible as the result because, apparently, the image's background is a plain white box. Which is not. Here is a bit of my code: Dim Result As New Bitmap(96, 128) Dim g As Graphics = Graphics.FromImage(Result) Dim Name As String For Each Name In BasesCheckList.CheckedItems Dim Layer As New Bitmap(resourcesPath & "Bases\" & Name) For x = 0 To Layer.Width - 1 For y = 0 To Layer.Height - 1 Result.SetPixel(x, y, Layer.GetPixel(x, y)) Next Next Layer = Nothing Next resourcesPath is the path to my resources folder. Bases is a folder in it. And Name is the image's name. Thank you.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to Save data in txt file in MATLAB

    - by Jessy
    I have 3 txt files s1.txt, s2.txt, s3.txt.Each have the same format and number of data.I want to combine only the second column of each of the 3 files into one file. Before I combine the data, I sorted it according to the 1st column: UnSorted file: s1.txt s2.txt s3.txt 1 23 2 33 3 22 4 32 4 32 2 11 5 22 1 10 5 28 2 55 8 11 7 11 Sorted file: s1.txt s2.txt s3.txt 1 23 1 10 2 11 2 55 2 33 3 22 4 32 4 32 5 28 5 22 8 11 7 11 Here is the code I have so far: BaseFile ='s' n=3 fid=fopen('RT.txt','w'); for i=1:n %Open each file consecutively d(i)=fopen([BaseFile num2str(i)'.txt']); %read data from file A=textscan(d(i),'%f%f') a=A{1} b=A{2} ab=[a,b]; %sort the data according to the 1st column B=sortrows(ab,1); %delete the 1st column after being sorted B(:,1)=[] %write to a new file fprintf(fid,'%d\n',B'); %close (d(i)); end fclose(fid); How can I get the output in the new txt file in this format? 23 10 11 55 33 22 32 32 28 22 11 11 instead of this format? 23 55 32 22 10 33 32 11 11 22 28 11

    Read the article

  • Combining JavaScript for Google Analytics with yours. (Asynchronous tracking.)

    - by lorenzo 72
    I have a JavaScript file which is loaded up at the end of my HTML page. Rather than adding the script code for asynchronous tracking for Google in yet another script I would rather combine the two scripts together. So instead of this: <html> ... <script src="myScript.js"> <!-- google analytics --> <script type="text/javascript"> var _gaq = _gaq || []; _gaq.push(['_setAccount', 'UA-XXXXX-X']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; (document.getElementsByTagName('head')[0] || document.getElementsByTagName('body')[0]).appendChild(ga); })(); </script> </html> I would have that bit of code in the second script tag at the end of my 'myScript.js'. I have not found one place in google documentation where it suggests to combine the script with yours.

    Read the article

  • auto-document exceptions on methods in C#/.NET

    - by Sarah Vessels
    I would like some tool, preferably one that plugs into VS 2008/2010, that will go through my methods and add XML comments about the possible exceptions they can throw. I don't want the <summary> or other XML tags to be generated for me because I'll fill those out myself, but it would be nice if even on private/protected methods I could see which exceptions could be thrown. Otherwise I find myself going through the methods and hovering on all the method calls within them to see the list of exceptions, then updating that method's <exception list to include those. Maybe a VS macro could do this? From this: private static string getConfigFilePath() { return Path.Combine(Environment.CurrentDirectory, CONFIG_FILE); } To this: /// <exception cref="System.ArgumentException"/> /// <exception cref="System.ArgumentNullException"/> /// <exception cref="System.IO.IOException"/> /// <exception cref="System.IO.DirectoryNotFoundException"/> /// <exception cref="System.Security.SecurityException"/> private static string getConfigFilePath() { return Path.Combine(Environment.CurrentDirectory, CONFIG_FILE); } Update: it seems like the tool would have to go through the methods recursively, e.g., method1 calls method2 which calls method3 which is documented as throwing NullReferenceException, so both method2 and method1 are documented by the tool as also throwing NullReferenceException. The tool would also need to eliminate duplicates, like if two calls within a method are documented as throwing DirectoryNotFoundException, the method would only list <exception cref="System.IO.DirectoryNotFoundException"/> once.

    Read the article

  • 10 Essential Tools for building ASP.NET Websites

    - by Stephen Walther
    I recently put together a simple public website created with ASP.NET for my company at Superexpert.com. I was surprised by the number of free tools that I ended up using to put together the website. Therefore, I thought it would be interesting to create a list of essential tools for building ASP.NET websites. These tools work equally well with both ASP.NET Web Forms and ASP.NET MVC. Performance Tools After reading Steve Souders two (very excellent) books on front-end website performance High Performance Web Sites and Even Faster Web Sites, I have been super sensitive to front-end website performance. According to Souders’ Performance Golden Rule: “Optimize front-end performance first, that's where 80% or more of the end-user response time is spent” You can use the tools below to reduce the size of the images, JavaScript files, and CSS files used by an ASP.NET application. 1. Sprite and Image Optimization Framework CSS sprites were first described in an article written for A List Apart entitled CSS sprites: Image Slicing’s Kiss of Death. When you use sprites, you combine multiple images used by a website into a single image. Next, you use CSS trickery to display particular sub-images from the combined image in a webpage. The primary advantage of sprites is that they reduce the number of requests required to display a webpage. Requesting a single large image is faster than requesting multiple small images. In general, the more resources – images, JavaScript files, CSS files – that must be moved across the wire, the slower your website. However, most people avoid using sprites because they require a lot of work. You need to combine all of the images and write just the right CSS rules to display the sub-images. The Microsoft Sprite and Image Optimization Framework enables you to avoid all of this work. The framework combines the images for you automatically. Furthermore, the framework includes an ASP.NET Web Forms control and an ASP.NET MVC helper that makes it easy to display the sub-images. You can download the Sprite and Image Optimization Framework from CodePlex at http://aspnet.codeplex.com/releases/view/50869. The Sprite and Image Optimization Framework was written by Morgan McClean who worked in the office next to mine at Microsoft. Morgan was a scary smart Intern from Canada and we discussed the Framework while he was building it (I was really excited to learn that he was working on it). Morgan added some great advanced features to this framework. For example, the Sprite and Image Optimization Framework supports something called image inlining. When you use image inlining, the actual image is stored in the CSS file. Here’s an example of what image inlining looks like: .Home_StephenWalther_small-jpg { width:75px; height:100px; background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAEsAAABkCAIAAABB1lpeAAAAB GdBTUEAALGOfPtRkwAAACBjSFJNAACHDwAAjA8AAP1SAACBQAAAfXkAAOmLAAA85QAAGcxzPIV3AAAKL s+zNfREAAAAASUVORK5CYII=) no-repeat 0% 0%; } The actual image (in this case a picture of me that is displayed on the home page of the Superexpert.com website) is stored in the CSS file. If you visit the Superexpert.com website then very few separate images are downloaded. For example, all of the images with a red border in the screenshot below take advantage of CSS sprites: Unfortunately, there are some significant Gotchas that you need to be aware of when using the Sprite and Image Optimization Framework. There are workarounds for these Gotchas. I plan to write about these Gotchas and workarounds in a future blog entry. 2. Microsoft Ajax Minifier Whenever possible you should combine, minify, compress, and cache with a far future header all of your JavaScript and CSS files. The Microsoft Ajax Minifier makes it easy to minify JavaScript and CSS files. Don’t confuse minification and compression. You need to do both. According to Souders, you can reduce the size of a JavaScript file by an additional 20% (on average) by minifying a JavaScript file after you compress the file. When you minify a JavaScript or CSS file, you use various tricks to reduce the size of the file before you compress the file. For example, you can minify a JavaScript file by replacing long JavaScript variables names with short variables names and removing unnecessary white space and comments. You can minify a CSS file by doing such things as replacing long color names such as #ffffff with shorter equivalents such as #fff. The Microsoft Ajax Minifier was created by Microsoft employee Ron Logan. Internally, this tool was being used by several large Microsoft websites. We also used the tool heavily on the ASP.NET team. I convinced Ron to publish the tool on CodePlex so that everyone in the world could take advantage of it. You can download the tool from the ASP.NET Ajax website and read documentation for the tool here. I created the installer for the Microsoft Ajax Minifier. When creating the installer, I also created a Visual Studio build task to make it easy to minify all of your JavaScript and CSS files whenever you do a build within Visual Studio automatically. Read the Ajax Minifier Quick Start to learn how to configure the build task. 3. ySlow The ySlow tool is a free add-on for Firefox created by Yahoo that enables you to test the front-end of your website. For example, here are the current test results for the Superexpert.com website: The Superexpert.com website has an overall score of B (not perfect but not bad). The ySlow tool is not perfect. For example, the Superexpert.com website received a failing grade of F for not using a Content Delivery Network even though the website using the Microsoft Ajax Content Delivery Network for JavaScript files such as jQuery. Uptime After publishing a website live to the world, you want to ensure that the website does not encounter any issues and that it stays live. I use the following tools to monitor the Superexpert.com website now that it is live. 4. ELMAH ELMAH stands for Error Logging Modules and Handlers for ASP.NET. ELMAH enables you to record any errors that happen at your website so you can review them in the future. You can download ELMAH for free from the ELMAH project website. ELMAH works great with both ASP.NET Web Forms and ASP.NET MVC. You can configure ELMAH to store errors in a number of different stores including XML files, the Event Log, an Access database, a SQL database, an Oracle database, or in computer RAM. You also can configure ELMAH to email error messages to you when they happen. By default, you can access ELMAH by requesting the elmah.axd page from a website with ELMAH installed. Here’s what the elmah page looks like from the Superexpert.com website (this page is password-protected because secret information can be revealed in an error message): If you click on a particular error message, you can view the original Yellow Screen ASP.NET error message (even when the error message was never displayed to the actual user). I installed ELMAH by taking advantage of the new package manager for ASP.NET named NuGet (originally named NuPack). You can read the details about NuGet in the following blog entry by Scott Guthrie. You can download NuGet from CodePlex. 5. Pingdom I use Pingdom to verify that the Superexpert.com website is always up. You can sign up for Pingdom by visiting Pingdom.com. You can use Pingdom to monitor a single website for free. At the Pingdom website, you configure the frequency that your website gets pinged. I verify that the Superexpert.com website is up every 5 minutes. I have the Pingdom service verify that it can retrieve the string “Contact Us” from the website homepage. If your website goes down, you can configure Pingdom so that it sends an email, Twitter, SMS, or iPhone alert. I use the Pingdom iPhone app which looks like this: 6. Host Tracker If your website does go down then you need some way of determining whether it is a problem with your local network or if your website is down for everyone. I use a website named Host-Tracker.com to check how badly a website is down. Here’s what the Host-Tracker website displays for the Superexpert.com website when the website can be successfully pinged from everywhere in the world: Notice that Host-Tracker pinged the Superexpert.com website from 68 locations including Roubaix, France and Scranton, PA. Debugging I mean debugging in the broadest possible sense. I use the following tools when building a website to verify that I have not made a mistake. 7. HTML Spell Checker Why doesn’t Visual Studio have a built-in spell checker? Don’t know – I’ve always found this mysterious. Fortunately, however, a former member of the ASP.NET team wrote a free spell checker that you can use with your ASP.NET pages. I find a spell checker indispensible. It is easy to delude yourself that you are capable of perfect spelling. I’m always super embarrassed when I actually run the spell checking tool and discover all of my spelling mistakes. The fastest way to add the HTML Spell Checker extension to Visual Studio is to select the menu option Tools, Extension Manager within Visual Studio. Click on Online Gallery and search for HTML Spell Checker: 8. IIS SEO Toolkit If people cannot find your website through Google then you should not even bother to create it. Microsoft has a great extension for IIS named the IIS Search Engine Optimization Toolkit that you can use to identify issue with your website that would hurt its page rank. You also can use this tool to quickly create a sitemap for your website that you can submit to Google or Bing. You can even generate the sitemap for an ASP.NET MVC website. Here’s what the report overview for the Superexpert.com website looks like: Notice that the Sueprexpert.com website had plenty of violations. For example, there are 65 cases in which a page has a broken hyperlink. You can drill into these violations to identity the exact page and location where these violations occur. 9. LinqPad If your ASP.NET website accesses a database then you should be using LINQ to Entities with the Entity Framework. Using LINQ involves some magic. LINQ queries written in C# get converted into SQL queries for you. If you are not careful about how you write your LINQ queries, you could unintentionally build a really badly performing website. LinqPad is a free tool that enables you to experiment with your LINQ queries. It even works with Microsoft SQL CE 4 and Azure. You can use LinqPad to execute a LINQ to Entities query and see the results. You also can use it to see the resulting SQL that gets executed against the database: 10. .NET Reflector I use .NET Reflector daily. The .NET Reflector tool enables you to take any assembly and disassemble the assembly into C# or VB.NET code. You can use .NET Reflector to see the “Source Code” of an assembly even when you do not have the actual source code. You can download a free version of .NET Reflector from the Redgate website. I use .NET Reflector primarily to help me understand what code is doing internally. For example, I used .NET Reflector with the Sprite and Image Optimization Framework to better understand how the MVC Image helper works. Here’s part of the disassembled code from the Image helper class: Summary In this blog entry, I’ve discussed several of the tools that I used to create the Superexpert.com website. These are tools that I use to improve the performance, improve the SEO, verify the uptime, or debug the Superexpert.com website. All of the tools discussed in this blog entry are free. Furthermore, all of these tools work with both ASP.NET Web Forms and ASP.NET MVC. Let me know if there are any tools that you use daily when building ASP.NET websites.

    Read the article

  • Nginx, Varnish, ESI - Will that work?

    - by Roland
    I've serveral backends (one is nginx+passenger) to combine via ESI. Since I don't want to go without gzip/deflate and SSL varnish can't do the job out of the box. So I thought about the following setup: http://img693.imageshack.us/img693/38/esinginx.png What do you think? overkill?

    Read the article

  • How Can I Edit a DVD Already Burned to Disc?

    - by AJ
    I have been asked to edit a DVD - specifically doing the following: Add chapter markers Add chapter selection menu Combine two shorter discs into one I would like to know if there is software that can allow me to import a DVD, make these changes, and then create a new master DVD?

    Read the article

  • iTunes mono play?

    - by Seth Glickman
    I've got a set of speakers, but one of them doesn't work. Is there any way to get iTunes to output to mono, but with both channels? I'm on Leopard, and going to System Preferences - Sound - Output and sliding the Balance all the way to one side doesn't help, as it doesn't combine the channels.

    Read the article

  • RabbitMQ - How I do configure servers for zero-downtime upgrades?

    - by Terence Johnson
    Having read through the docs and RabbitMQ in Action, creating a RabbitMQ cluster seems straightforward enough, but upgrading or patching an existing RabbitMQ cluster seems to require the whole cluster to be restarted. Is there a way to combine clustering, shovel, federation, and load balancing to make a rolling upgrade possible without losing queues or messages, or have I missed something slightly more obvious?

    Read the article

  • Gif output not as smooth when selecting a sequence of files individually

    - by Keikoku
    I have a sequence of images 001.png 002.png 003.png that I would like to combine into an animation. I used the following command convert -dispose 3 -loop 0 *.png out.gif And it looks ok. However, when I tried this convert -dispose 3 -loop 0 "001.png" "002.png" "003.png" out2.gif out2.gif was not as "smooth" as out.gif. Why is there a difference in the output between the two commands, which seem to mean the same thing?

    Read the article

  • Using custom variables in Google Analytics funnels?

    - by Matt Huggins
    Google Analytics allow you to view how many users completed funnels through a set of pages in order to reach a goal URL. The service also allows you to pass custom variables when tracking a page view. Is it possible to combine the two, such that I create a funnel based upon the vale of a custom variable set for each visitor?

    Read the article

  • Show multiple calendars in overlay view by default

    - by Kyle Strand
    In MS Outlook 2007/2010, it's possible to show multiple calendars overlayed on each other (a la Google Calendar; see http://office.microsoft.com/en-us/help/view-calendars-side-by-side-or-overlaid-HA001230157.aspx#BM4). However, it appears that in order to do this, you must first open the calendars side-by-side and then press the little left-arrow button to "combine" them into an overlaid view. Is there a way to make "overlaid" the default view for multiple calendars (again, a la Google Calendar)?

    Read the article

< Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >