Search Results

Search found 6743 results on 270 pages for 'regular joe'.

Page 210/270 | < Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >

• Apply a class to a <h1> based on the site url

  - by user1870639

  I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

  Read the article

• Need Regex for to match special situations

  - by Daniel

  I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Get seleted text parent tag using regex C#

  - by Aruna Tennakoon

  <SPAN id=spanD121C150D2 style="BACKGROUND-COLOR: antiquewhite" CategoryID="1" MessageID="2316" refSpan=""> <SPAN id=span1CE69EDE12 style="BACKGROUND-COLOR: blue" CategoryID="2" MessageID="2316" refSpan="">platnosci inny srodkiem platnosci. DC - zakup paliwa na stacji benzynowej 101-500 (150 zl). 27 </SPAN> </SPAN> I have a string like above. If the selected text is "srodkiem ", is it possible to get the relevant span tag? Is this possible using a regular expression?

  Read the article

• How to move many files in multiple different directories (on Linux)

  - by user1335982

  My problem is that I have too many files in single directory. I cannot "ls" the directory, cos is too large. I need to move all files in better directory structure. I'm using the last 3 digits from ID as folders in reverse way. For example ID 2018972 will gotta go in /2/7/9/img_2018972.jpg. I've created the directories, but now I need help with bash script. I know the IDs, there are in range 1,300,000 - 2,000,000. But I can't handle regular expressions. I wan't to move all files like this: /images/folder/img_2018972.jpg -> /images/2/7/9/img_2018972.jpg I will appreciate any help on this subject. Thanks!

  Read the article

• Regex doesn't work properly

  - by oneofthelions

  I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

  Read the article

• why does InnoDB keep on growing without for every update?

  - by Akash Kava

  I have a table which consists of heavy blobs, and I wanted to conduct some tests on it. I know deleted space is not reclaimed by innodb, so I decided to reuse existing records by updating its own values instead of createing new records. But I noticed, whether I delete and insert a new entry, or I do UPDATE on existing ROW, InnoDB keeps on growing. Assuming I have 100 Rows, each Storing 500KB of information, My InnoDB size is 10MB, now when I call UPDATE on all rows (no insert/ no delete), the innodb grows by ~8MB for every run I do. All I am doing is I am storing exactly 500KB of data in each row, with little modification, and size of blob is fixed. What can I do to prevent this? I know about optimize table, but I cant do it because on regular usage, the table is going to be 60-100GB big, and running optimize will just stall entire server.

  Read the article

• Creating Slugs from Titles?

  - by James Jeffery

  I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

  Read the article

• richtextbox font

  - by habbo95

  hi.... I want to change the font color and size for 1 line in richTextBox enter code here String [] Words = {"hi","hello","11111","he","she"}; richTextBox1.SelectionFont = new Font("Verdana", 10, FontStyle.Regular); richTextBox1.SelectionColor = Color.Blue; richTextBox1.SelectedText += Environment.NewLine + wo[0]; richTextBox1.SelectedText += Environment.NewLine + wo[1]; richTextBox1.SelectedText += Environment.NewLine + wo[2]; richTextBox1.SelectedText += Environment.NewLine + wo[3]; richTextBox1.SelectedText += Environment.NewLine + wo[4]; I want to change just the string "11111" and keep the rest lines as default any help

  Read the article

• PHP reg expr. replace ALL URLs except img src URLs

  - by zilveer

  Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

  Read the article

• Replace non-html links with <A> tags

  - by tombazza

  I have a block of code that will take a block of text like the following: Sample text sample text http://www.google.com sample text Using the preg_replace_callback method and the following regular expression: preg_replace_callback('/http:\/\/([,\%\w.\-_\/\?\=\+\&\~\#\$]+)/', create_function( '$matches', '$url = $matches[1]; $anchorText = ( strlen($url) > 35 ? substr($url, 0, 35).\'...\' : $url); return \'<a href="http://\'. $url .\'">\'. $anchorText .\'</a>\';'), $str); Will convert the sample text to look like: Sample text sample text < a href="http://www.google.com"http://www.google.com< /a sample text My problem now is that we have introduced a rich text editor that can create links before being sent to the script. I need to update this piece of code so that it will ignore any URLs that are already inside an tag.

  Read the article

• Zend Framework: How to handle exceptions in Ajax requests?

  - by understack

  Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

  Read the article

• Only strip commas surrounded by numbers in a string

  - by overlook77

  I am using StreamReader to read each line of a CSV file into a string. As I am processing each line, I need to strip out any commas that ONLY are surrounded by other numbers. For example, if the string was: "textfield1", "textfield2", "100.00", "1,070.00" I would need to only take the comma out of "1,070.00" from this entire string, resulting in: "textfield1", "textfield2", "100.00", "1070.00" Each string read from the CSV file can differ in number of fields, length, etc., so I need to use something (Regular Expressions maybe?) that looks at the entire string without hardcoding a location or blanket removal of all commas. Here is the approach I have been trying: StreamReader sr = new StreamReader(strInputFile); string nextLine = sr.ReadLine(); try { while ((nextLine = sr.ReadLine()) != null) { string rawtext = nextLine.Replace("[0-9]"+","+"[0-9]" , "[0-9]"+"[0-9]"); // ....rest of code } } This obviously doesn't work because I don't understand how to do this :) I am new at C# and inexperienced in Regex, so hopefully this is relatively simple.

  Read the article

• How do I compute a variable in Javascript if and only if it is used?

  - by LLer

  This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

  Read the article

• Given a user control with a form containing validation can I validate entirely server side?

  - by JoshBaltzell

  We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

  Read the article

• Assign RegEx submatches to variables or map (C++/C)

  - by Michael

  I need to extract the SAME type of information (e.g. First name, Last Name, Telephone, ...), from numerous different text sources (each with a different format & different order of the variables of interest). I want a function that does the extraction based on a regular expression and returns the result as DESCRIPTIVE variables. In other words, instead of returning each match result as submatch[0], submatch[1], submatch[2], ..., have it do EITHER of the following: 1.) return std::map so that the submatches can be accessed via: submatch["first_name"], submatch["last_name"], submatch["telephone"] 2.) return a variables with the submatches so that the submatches can be accessed via: submatch_first_name, submatch_last_name, submatch_telephone I can write a wrapper class around boost::regex to do #1, but I was hoping there would be a built-in or a more elegant way to do this in C++/Boost/STL/C.

  Read the article

• Get "2:35pm" instead of "02:35PM" from Python date/time?

  - by anonymous coward

  I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

  Read the article

• compare date split across colums

  - by alex-tech

  Greetings. I am querying tables from Microsoft SQL 2008 which have date split across 3 columns: day, month and year. Unfortunately, I do not have control over this because data is coming in to the database daily from a 3rd party source in that format. I need to add between to a where clause so user can pull records within a range. Would be easy enough if date was in a single column but finding it nearly impossible when its split across three columns. To display the date, I am doing a CAST( CAST(year as varchar(4)) + '-' + CAST(month as varchar(2)) + '-' + CAST(day as varchar(2)) as date) AS "date"` in a select. I tried to put it as a parameter for datediff function or just the regular between but get no results. Thanks for any help.

  Read the article

• Java Util Linked List - how to find next?

  - by drozzy

  When using Java LinkedList how do you find out the element's next or previous relationships? I mean, in a regular linked list I would do something like this: Node node1 = new Node(); Node node2 = new Node(); LinkedList list = new LinkedList(); list.add(node1); list.add(node2); //then my node1 will know who it's next is: assertEquals(node2, node1.next()); But in Java's LinkedList, the data does not seem to be modified. So how do I actually find out who the "next" (or "previous" in the case of doubly-linked lists) element is?

  Read the article

• Within headers, images with alt text vs. text

  - by Court

  Do search engines treat the alt text of an image placed within an h1 tag the same way they would treat regular text placed in an h1 tag? I gave a search through here looking for an answer to this question, but was only able to find information on image replacement and the infamous h1 debate. For example would: <h1><img src="#" alt="Contact Us" /></h1> Act the same as: <h1>Contact Us</h1> In the electronic eye of a search engine? This seems considerably less "CSS Hacky" than other image replacement techniques like negative text indents, display:none, height:0, or ridiculous z-index integers.

  Read the article

• c# performance- create font

  - by user85917

  I have performance issues in this code segment which I think is caused by the "new Font". Will it be faster if fonts are static/global ? if (row.StartsWith(TILD_BEGIN)) { rtbTrace.SelectionColor = Color.Maroon; rtbTrace.SelectionFont = new Font(myFont, (float)8.25, FontStyle.Regular); if (row.StartsWith(BEGIN) ) rtbTrace.AppendText(Environment.NewLine + row + Environment.NewLine); else rtbTrace.AppendText(Environment.NewLine + row.Substring(1) + Environment.NewLine); continue; } if (row.StartsWith(EXCL_BEGIN)) { -- similar block } if (row.StartsWith(DLR_BEGIN)) { -- similar block } . . .

  Read the article

• How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

  - by prateeksaluja20

  I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

  Read the article

• How can I handle validation of non-latin script input in PHP?

  - by Matt

  I am trying to adapt a php application to handle non-latin scripts (specifically: Japanese, simplified Chinese and Arabic). The app's data validation routines make frequent use of regular expressions to check input, but I am not sure how to adapt the \w character type to other languages without installing additional locales on the system (which I cannot rely on). Previous developers to have worked on the app have simply added needed characters to the regexes as the number of languages we supported grew (you frequently see "[\wÀÁÂÃÄÅÆÇÈÉ... etc" in the code), but I can't really do this for all the alphabets I need to support now. Does anybody out there have some advice on how to tackle this?

  Read the article

• Best solution to import records from MySQL database to MS SQL (Hourly)

  - by xkingpin

  I need to import records stored in a MySQL Database that I do not maintain into my Sql Server 2005 database (x64) We should import the records at an interval basis (probably 1 hour). What would be the best solution to perform the regular import? Windows Service (using reference MySql.data dll) Windows Client (could make it automated) SQL Extended Stored Procedure (is it possible to reference the MySQL.data dll?) SSIS package - Install MySQL ODBC driver The problem with #4 is that I do not really want to support the ODBC driver on the sql server. I'm not sure if you can even reference the x86 MySql.data dll into a x64 sql server process for #3. (Or if you can even reference that dll within a sql server project)

  Read the article

• .NET regex inner text between td, span, a tag

  - by mushtaqck

  <table > <tr> <td colspan="2" style="height: 14px"> tdtext1 <a>hyperlinktext1<a/> </td> </tr> <tr> <td> tdtext2 </td> <td> <span>spantext1</span> </td> </tr> </table> This is my sample text how to write a regular expression in C# to get the matches for the innertext for td, span, hyperlinks.

  Read the article

< Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >