Search Results

Search found 6743 results on 270 pages for 'regular joe'.

Page 210/270 | < Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • Are there design-time watch windows for Visual Studio 2008/2010?

    - by Jeff
    There are many times when I need to test a little snippet of .net code but rebuilding and publishing the entire project or writing a suite of unit tests just seems like overkill. For example, I am writing a regular expression right now and I want to see if it the pattern is matching on the right parts. I could go and find a million other utilities that do that sort of thing, but that is not exactly my point. FireBug has an exact analogue to what I want - the FireBug console. There is a text box where the user can enter some JavaScript and FireBug will execute it on the spot and display the return value. I would love to be able to enter something like (new Regex("b+")).Replace("abc", "x") and see the results without having to do all the overhead. Does VS have anything like this?

    Read the article

  • Java Util Linked List - how to find next?

    - by drozzy
    When using Java LinkedList how do you find out the element's next or previous relationships? I mean, in a regular linked list I would do something like this: Node node1 = new Node(); Node node2 = new Node(); LinkedList list = new LinkedList(); list.add(node1); list.add(node2); //then my node1 will know who it's next is: assertEquals(node2, node1.next()); But in Java's LinkedList, the data does not seem to be modified. So how do I actually find out who the "next" (or "previous" in the case of doubly-linked lists) element is?

    Read the article

  • Yet another URL prefix regex question (to be used in C#).

    - by Hamish Grubijan
    Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • Prevent RegEx Hang on Large Matches...

    - by developerjay
    This is a great regular expression for dates... However it hangs indefinitely on this one page I tried... I wanted to try this page ( http://pleac.sourceforge.net/pleac%5Fpython/datesandtimes.html ) for the fact that it does have lots of dates on it and I want to grab all of them. I don't understand why it is hanging when it doesn't on other pages... Why is my regexp hanging and/or how could I clean it up to make it better/efficient ? Python Code: monthnames = "(?:Jan\w*|Feb\w*|Mar\w*|Apr\w*|May|Jun\w?|Jul\w?|Aug\w*|Sep\w*|Oct\w*|Nov(?:ember)?|Dec\w*)" pattern1 = re.compile(r"(\d{1,4}[\/\\\-]+\d{1,2}[\/\\\-]+\d{2,4})") pattern4 = re.compile(r"(?:[\d]*[\,\.\ \-]+)*%s(?:[\,\.\ \-]+[\d]+[stndrh]*)+[:\d]*[\ ]?(PM)?(AM)?([\ \-\+\d]{4,7}|[UTCESTGMT\ ]{2,4})*"%monthnames, re.I) patterns = [pattern4, pattern1] for pattern in patterns: print re.findall(pattern, s) btw... when i say im trying it against this site.. I'm trying it against the webpage source.

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • How to publish to Facebook fan/business pages (not user profiles)

    - by Jeff Putz
    I'm trying to figure out if fan/business pages are conceptually similar to regular user pages. My end goal is to publish events from a third-party Web site (new content, announcements, etc.) into the FB page that promotes the third-party site. I'm not sure where to start exactly. Been looking at the .NET Facebook SDK, and it seems focused on FB apps and authentication. Not sure where I should be looking. Help is appreciated!

    Read the article

  • Get "2:35pm" instead of "02:35PM" from Python date/time?

    - by anonymous coward
    I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

    Read the article

  • XAMPP on windows 7 not working properly

    - by 404Error
    Hey there, I just installed XAMPP lite on Windows 7. I have two drives - C: for the OS and regular files, and an external drive E:. I installed XAMPP lite on E: (on the root), and its been giving me problems. Apache works well enough, but MySQL doesn't work. When I go to http://localhost/phpmyadmin/, it gives me the following error: Error MySQL said: #2003 - Can't connect to MySQL server on 'localhost' (10061) Connection for controluser as defined in your configuration failed. Any ideas as to what could be the problem? I used the zip file for XAMPP lite, the 32 bit version. This is on Windows 7 Home premium. Thanks!

    Read the article

  • Magento - how to create different prices for different sizes of a products?

    - by Lisa Li
    Hi, I am trying to set different prices for different sizes of a few products I have in my store. I am not really sure how to do that propely. The problem is that I already have the regular size defined as a simple product. Now, I want to add a smaller size as well, that can be chosen from the same product page, and I need to set the weight of the smaller size, so postage is calculated properly. Any suggestions? Many thanks!

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Change selected value of drop down list with jQuery

    - by Phairoh
    I have a drop down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById("ID of element goes here"); ddl.value = 2; // 2 being the value I want to set it to. However, I need to do this with jQuery because I'm using a CSS class for my selector (stupid ASP.NET client ids...). Here are a few things I've tried: $("._statusDDL").val(2); // doesn't find 2 as a value $("._statusDDL").children("option").val(2) // also failed. How can I do it with jQuery?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • parse unformatted string into dictionary with python

    - by user553131
    I have following string. DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) Key: a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO I need to create dictionary so it would be like { "DATE": "12242010", "Key Type": "Nod32 Anti-Vir (30d trial)", "Key": "a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO" } The problem is that string is unformatted DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) there is no space after Date before Key Type also it would be nice to have some validation for Key, eg if there are 5 chars in each box of key and number of boxes I am a beginner in python and moreover in regular expressions. Thanks a lot.

    Read the article

  • c# performance- create font

    - by user85917
    I have performance issues in this code segment which I think is caused by the "new Font". Will it be faster if fonts are static/global ? if (row.StartsWith(TILD_BEGIN)) { rtbTrace.SelectionColor = Color.Maroon; rtbTrace.SelectionFont = new Font(myFont, (float)8.25, FontStyle.Regular); if (row.StartsWith(BEGIN) ) rtbTrace.AppendText(Environment.NewLine + row + Environment.NewLine); else rtbTrace.AppendText(Environment.NewLine + row.Substring(1) + Environment.NewLine); continue; } if (row.StartsWith(EXCL_BEGIN)) { -- similar block } if (row.StartsWith(DLR_BEGIN)) { -- similar block } . . .

    Read the article

  • Replace non-html links with <A> tags

    - by tombazza
    I have a block of code that will take a block of text like the following: Sample text sample text http://www.google.com sample text Using the preg_replace_callback method and the following regular expression: preg_replace_callback('/http:\/\/([,\%\w.\-_\/\?\=\+\&\~\#\$]+)/', create_function( '$matches', '$url = $matches[1]; $anchorText = ( strlen($url) > 35 ? substr($url, 0, 35).\'...\' : $url); return \'<a href="http://\'. $url .\'">\'. $anchorText .\'</a>\';'), $str); Will convert the sample text to look like: Sample text sample text < a href="http://www.google.com"http://www.google.com< /a sample text My problem now is that we have introduced a rich text editor that can create links before being sent to the script. I need to update this piece of code so that it will ignore any URLs that are already inside an tag.

    Read the article

  • How do I compute a variable in Javascript if and only if it is used?

    - by LLer
    This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

    Read the article

  • Assign RegEx submatches to variables or map (C++/C)

    - by Michael
    I need to extract the SAME type of information (e.g. First name, Last Name, Telephone, ...), from numerous different text sources (each with a different format & different order of the variables of interest). I want a function that does the extraction based on a regular expression and returns the result as DESCRIPTIVE variables. In other words, instead of returning each match result as submatch[0], submatch[1], submatch[2], ..., have it do EITHER of the following: 1.) return std::map so that the submatches can be accessed via: submatch["first_name"], submatch["last_name"], submatch["telephone"] 2.) return a variables with the submatches so that the submatches can be accessed via: submatch_first_name, submatch_last_name, submatch_telephone I can write a wrapper class around boost::regex to do #1, but I was hoping there would be a built-in or a more elegant way to do this in C++/Boost/STL/C.

    Read the article

  • Given a user control with a form containing validation can I validate entirely server side?

    - by JoshBaltzell
    We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • Just how much do I want to make virtual?

    - by Alex
    I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

    Read the article

  • Get seleted text parent tag using regex C#

    - by Aruna Tennakoon
    <SPAN id=spanD121C150D2 style="BACKGROUND-COLOR: antiquewhite" CategoryID="1" MessageID="2316" refSpan=""> <SPAN id=span1CE69EDE12 style="BACKGROUND-COLOR: blue" CategoryID="2" MessageID="2316" refSpan="">platnosci inny srodkiem platnosci. DC - zakup paliwa na stacji benzynowej 101-500 (150 zl). 27 </SPAN> </SPAN> I have a string like above. If the selected text is "srodkiem ", is it possible to get the relevant span tag? Is this possible using a regular expression?

    Read the article

  • Need Regex for to match special situations

    - by Daniel
    I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

    Read the article

  • compare date split across colums

    - by alex-tech
    Greetings. I am querying tables from Microsoft SQL 2008 which have date split across 3 columns: day, month and year. Unfortunately, I do not have control over this because data is coming in to the database daily from a 3rd party source in that format. I need to add between to a where clause so user can pull records within a range. Would be easy enough if date was in a single column but finding it nearly impossible when its split across three columns. To display the date, I am doing a CAST( CAST(year as varchar(4)) + '-' + CAST(month as varchar(2)) + '-' + CAST(day as varchar(2)) as date) AS "date"` in a select. I tried to put it as a parameter for datediff function or just the regular between but get no results. Thanks for any help.

    Read the article

< Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >